Analysis of ribosomal RNA genes in somatic hybrids between wild and cultivated Solanum species

Ribosomal RNA genes were exploited as markers to identify somatic hybrids between Solanum tuberosum cv. Brodick and wild diploid Solanum species, S. megistacrolobum, S. sanctae-rosae and S. sparsipilum and DNA methylation as a possible regulatory factor in gene expression was investigated. Specific restriction enzyme/probe combinations revealed useful polymorphisms in the conserved coding and variable intergenic spacer regions of the ribosomal RNA genes. Some intermediate ribosomal RNA gene profiles indicate hybridity whereas others were characteristic of S. tuberosum cv. Brodick. This evidence is suggestive of somatic exchange/re-arrangement between the NOR region of S. sanctae-rosae and S. tuberosum cv. Brodick. Ribosomal RNA gene copy number analysis of the somatic hybrids did not reveal hexaploid values suggesting that these products are not symmetric hybrids derived from the parental diploid and tetraploid plants. The results indicate site-specific methylation of ribosomal RNA gene sequences for the parental plants; while some somatic hybrids display a reduction, others show an increase. The significance of the findings for somatic cell genetics and plant breeding studies is discussed.     

The nucleotide sequence of the chloroplast 5S ribosomal RNA from spinach.

Spinacia oleracia cholorplast 5S ribosomal RNA was end-labeled with [32P] and the complete nucleotide sequence was determined. The sequence is: pUAUUCUGGUGUCCUAGGCGUAGAGGAACCACACCAAUCCAUCCCGAACUUGGUGGUUAAACUCUACUGCGGUGACGAU ACUGUAGGGGAGGUCCUGCGGAAAAAUAGCUCGACGCCAGGAUGOH. This sequence can be fitted to the secondary structural model proposed for prokaryotic 5S ribosomal RNAs by Fox and Woese (1). However, the lengths of several single- and double-stranded regions differ from those common to prokaryotes. The spinach chloroplast 5S ribosomal RNA is homologous to the 5S ribosomal RNA of Lemna chloroplasts with the exception that the spinach RNA is longer by one nucleotide at the 3' end and has a purine base substitution at position 119. The sequence of spinach chloroplast 5S RNA is identical to the chloroplast 5S ribosomal RNA gene of tobacco. Thus the structures of the chloroplast 5S ribosomal RNAs from some of the higher plants appear to be almost totally conserved. This does not appear to be the case for the higher plant cytoplasmic 5S ribosomal RNAs.     

The complete DNA sequence of the nuclear ribosomal RNA gene complex of Verticillium dahliae: intraspecific heterogeneity within the intergenic spacer region

The complete DNA sequence of the nuclear ribosomal RNA gene complex of Verticillium dahliae: Intraspecific heterogeneity within the intergenic spacer region. Fungal Genetics and Biology 29, 19-27. The complete sequence of the nuclear ribosomal DNA gene complex of the phytopathogenic fungus Verticillium dahliae has been determined. The tandemly repeated unit was 7216 bp long and appears to be the shortest rDNA cluster described so far among filamentous fungi. Primer pairs were designed for amplification of the region spanning half of the 28S subunit, the intergenic spacer (IGS), and the 5' end of 18S subunit of a number of Verticillium strains, isolated from various hosts and geographic origins. Great heterogeneity was detected in the amplified products of the IGS region resulting in fragments varying from 1.6 to 2.0 kb. The majority of Verticillium isolates were classified into two groups with 1.6- and 1.7-kb amplified products, respectively. The former group included 31 V. dahliae, 7 V. longisporum, and 1 V. albo-atrum isolates, whereas the latter included 10 V. dahliae and 1 V. albo-atrum isolates. Sequence analysis of representative PCR products of the above groups identified a "hot-spot" region harboring most of larger insertions, whereas most of the small changes were due to transitions and transversions. One V. longisporum isolate with a 2.0-kb PCR product contained 13 perfectly conserved tandem repeats of 39 bp long. The presence of similar incomplete sequences in the corresponding regions of V. dahliae, V. longisporum, and V. albo-atrum isolates revealed a particular standard motif of insertions in the IGS region of the genus and is discussed.     

Structure and evolution of the 4.5-5S ribosomal RNA intergenic region from Glycine max (soya bean).

The nucleotide sequence for the 4.5-5S ribosomal DNA region from the chloroplastids of soya beans was determined as the basis of further comparative studies on the structure and evolution of this intergenic region. Comparisons with other plant sequences as well as equivalent sequences in eubacteria suggest that the longer internal transcribed spacer regions of plants have evolved, at least in part, by DNA sequence duplications and that the presence of the 4.5S rRNA in chloroplast may result from the accidental acquisition of a RNA maturation site during the evolution of longer internal transcribed spacer regions. Estimates of the secondary structures also indicate only a very limited retention of structural features and suggest that the primary role of the intergenic sequences may be to bring processed sites into close proximity.     

Analysis of Intraspecific Sequence Variation Among Eight Isolates of the Rumen Symbiont, Isotricha prostoma (Ciliophora), from Two Continents

The internally transcribed spacer regions 1 and 2 (ITS-1 and ITS-2) and the 5.8S ribosomal RNA gene of Isotricha prostoma were examined for intraspecific sequence variation. There were no differences in the ITS-1/5.8S/ITS-2 region among cattle and sheep isolates of I. prostoma from Australia, Canada, and the United States, indicating that this region is 100% conserved among eight isolates from two continents.     

Comparison of the nucleotide sequence of soybean 18S rRNA with the sequences of other small-subunit rRNAs

We present the sequence of the nuclear-encoded ribosomal small-subunit RNA from soybean. The soybean 18S rRNA sequence of 1807 nucleotides (nt) is contained in a gene family of approximately 800 closely related members per haploid genome. This sequence is compared with the ribosomal small-subunit RNAs of maize (1805 nt), yeast (1789 nt), Xenopus (1825 nt), rat (1869 nt), and Escherichia coli (1541 nt). Significant sequence homology is observed among the eukaryotic small-subunit rRNAs examined, and some sequence homology is observed between eukaryotic and prokaryotic small-subunit rRNAs. Conserved regions are found to be interspersed among highly diverged sequences. The significance of these comparisons is evaluated using computer simulation of a random sequence model. A tentative model of the secondary structure of soybean 18S rRNA is presented and discussed in the context of the functions of the various conserved regions within the sequence. On the basis of this model, the short base-paired sequences defining the four structural and functional domains of all 18S rRNAs are seen to be well conserved. The potential roles of other conserved soybean 18S rRNA sequences in protein synthesis are discussed.     

Specific 5S ribosomal RNA primers for plant species i dentification in admixtures 3

The DNA sequences of the spacers between the 5S ribosomal RNA genes were determined for the cereals maize, barley, soghum, rye, rice, oat, and wheat. Species-specific primers were designed from the spacer region. PCR with these primers and a common primer from the conserved 5S ribosomal RNA gene sequence was investigated as a method for detection of the seven cereal species. DNA from these species could be specifically detected in mixtures. This technique could find application in the determination of the composition of admixtures or processed cereal products. The protocol described has potential for general application in the identification of plant species.     

A comparison of Olpidium isolates from a range of host plants using internal transcribed spacer sequence analysis and host range studies

Olpidium brassicae is a ubiquitous obligate root-infecting fungal pathogen. It is an important vector of a wide range of plant viruses. Olpidium isolates that infected brassica plants did not infect lettuce plants and vice-versa. Host range tests, PCR amplification and sequencing of the internal transcribed spacer (ITS) and 5.8S regions of 25 Olpidium isolates from brassica, carrot, cucumber and lettuce originating from four continents revealed differences between isolates. Based on their ability to infect lettuce and brassicas and the differences between their ITS1, 5.8S and ITS2 regions they could be separated into a number of distinct groups. Comparisons with other published sequences revealed two distinct genetic groups of brassica-infecting isolates, two distinct groups of lettuce-infecting isolates, one of which contained a carrot-infecting isolate and a distinct group comprising a cucumber-infecting isolate and a melon-infecting isolate. The possibility of the isolates belonging to three distinct species is discussed.     

Molecular differentiation of Renibacterium salmoninarum isolates from worldwide locations

Renibacterium salmoninarum is a genospecies that is an obligate pathogen of salmonid fish and is capable of intracellular survival. Conventional typing systems have failed to differentiate isolates of R. salmoninarum. We used two methods to assess the extent of molecular variation which was present in isolates from different geographic locations. In one analysis we investigated possible polymorphisms in a specific region of the genome, the intergenic spacer (ITS) region between the 16S and 23S rRNA genes. In the other analysis we analyzed differences throughout the genome by using randomly amplified polymorphic DNA (RAPD). We amplified the spacer region of 74 isolates by using PCR and performed a DNA sequence analysis with 14 geographically distinct samples. The results showed that the 16S-23S ribosomal DNA spacer region of R. salmoninarum is highly conserved and suggested that only a single copy of the rRNA operon is present in this slowly growing pathogen. DNA sequencing of the spacer region showed that it was the same length in all 14 isolates examined, and the same nucleotide sequence, sequevar 1, was obtained for 11 of these isolates. Two other sequevars were found. No tRNA genes were found. We found that RAPD analysis allows reproducible differentiation between isolates of R. salmoninarum obtained from different hosts and different geographic regions. By using RAPD analysis it was possible to differentiate between isolates with identical ITS sequences.     

Comparison of the nucleotide sequence of soybean 18S rRNA with the sequences of other small-subunit rRNAs

Summary We present the sequence of the nuclearencoded ribosomal small-subunit RNA from soybean. The soybean 18S rRNA sequence of 1807 nucleotides (nt) is contained in a gene family of approximately 800 closely related members per haploid genome. This sequence is compared with the ribosomal small-subunit RNAs of maize (1805 nt), yeast (1789 nt),Xenopus (1825 nt), rat (1869 nt), andEscherichia coli (1541 nt). Significant sequence homology is observed among the eukaryotic small-subunit rRNAs examined, and some sequence homology is observed between eukaryotic and prokaryotic small-subunit rRNAs. Conserved regions are found to be interspersed among highly diverged sequences. The significance of these comparisons is evaluated using computer simulation of a random sequence model. A tentative model of the secondary structure of soybean 18S rRNA is presented and discussed in the context of the functions of the various conserved regions within the sequence. On the basis of this model, the short basepaired sequences defining the four structural and functional domains of all 18S rRNAs are seen to be well conserved. The potential roles of other conserved soybean 18S rRNA sequences in protein synthesis are discussed.     

Ribosomal RNA genes of Saccharomyces cerevisiae. II. Physical map and nucleotide sequence of the 5 S ribosomal RNA gene and adjacent intergenic regions.

A DNA fragment containing the structural gene for the 5 S ribosomal RNA and intergenic regions before and after the 35 S ribosomal RNA precursor gene of Saccharomyces cerevisiae has been amplified in a bacterial plasmid and physically mapped by restriction endonuclease cleavage and hybridization to purified yeast 5 S ribosomal RNA. The nucleotide sequence of the DNA fragments carrying the 5 S ribosomal RNA gene and adjacent regions has been determined. The sequence unambiguously identifies the 5 S ribosomal RNA gene, determines its polarity within the ribosomal DNA repeating unit, and reveals the structure of its promoter and termination regions. Partial DNA sequence of the regions near the beginning and end of the 35 S ribosomal RNA gene has also been determined as a preliminary step in establishing the structure of promoter and termination regions for the 35 S ribosomal RNA gene.     

Zoogloea ramigera: A phylogenetically diverse species

Abstract Amplification of the gene encoding 23S rRNA of Aeromonas hydrophila by polymerase chain reaction, with primers complementary to conserved regions of 16S and the 3'-end of 23S rRNA genes, resulted in a DNA fragment of approximately 3 kb. This fragment was cloned in Escherichia coli , and its nucleotide sequence determined. The region encoding 23S rRNA shows high homology with the published sequences of 23S rRNA from other members of the gamma division of Proteobacteria . The sequence of the intergenic spacer region, between the 16S and 23S rRNA genes, was determined in five clones. Three types of spacer were identified: two clones were identical and encoded tRNA^Ile and tRNA^Ala while the remaining three clones contained tRNA^Glu, only two had the same spacer sequences. This variation in sequence indicates that the different clones may be derived from different ribosomal RNA operons.     

The nucleotide sequence of the 4.5S and 5S rRNA genes and flanking regions from Spirodela oligorhiza chloroplasts

The base sequence of Spirodela oligorhiza chloroplast DNA coding for 4.5S and 5S ribosomal RNA, the flanking regions and the spacer between these two genes has been determined. We have compared these sequences with the corresponding ones in other higher plants. Besides a high degree of homology, some interesting differences are found.     

Analysis of DNA encoding 23S rRNA and 16S–23S rRNA intergenic spacer regions from Plesiomonas shigelloides

Amplification of the gene encoding 23S rRNA of Plesiomonas shigelloides by polymerase chain reaction (PCR), with primers complementary to conserved regions of 16S and the 3' end of 23S rRNA genes, resulted in a DNA fragment of approximately 3 kb. This fragment was cloned in Escherichia coli and its nucleotide sequence determined. The region encoding 23S rRNA shows high homology with the published sequences of 23S rRNA from other members of the gamma division of Proteobacteria. The sequence of the intergenic spacer region, between the 16S and 23S rRNA genes, was determined in a further two clones. In one the sequence of a single tRNA(Glu) was found which was absent from the other two. This variation in sequence suggests that the different clones may be derived from different ribosomal RNA operons.