Desulphurisation of benzothiophene and dibenzothiophene by actinomycete organisms belonging to the genus Rhodococcus, and related taxa

Desulphurising enzymes remove the sulphur moiety from an organosulphur molecule leaving the carbon skeleton intact. Two kinds of desulphurisation reaction are recognised. The dibenzothiophene (DBT)-specific pathway desulphurises DBT to inorganic sulphite and 2- hydroxybiphenyl (HBP), and the benzothiophene (BTH)-specific pathway desulphurises BTH to 2-(2-hydroxyphenyl)ethan 1-al (HPEal) and probably inorganic sulphite. The DBT-desulphurisation pathway was originally identified in Rhodococcus erythropolis strain IGTS8 (ATCC 53968), and the BTH-desulphurisation pathway in Gordonia sp. strain 213E (NCIMB 40816). These organisms do not further metabolise the organic product of desulphurisation.In this article current knowledge of the biochemistry and genetics of the desulphurisation enzymes is reviewed. The need for separate, DBT- and BTH-specific desulphurisation routes is rationalised in terms of the chemical differences between the two compounds. The desulphurisation pathway is compared with other microbial DBT- degrading enzyme systems. Finally some comments are made concerning the application of desulphurisation enzymes for fuel desulphurisation and on the relevance of these enzymes to the ecology of the mycolata (sensu Chun et al, 1996).     

Diffusion of energetic compounds through biological membrane: Application of classical MD and COSMOmic approximations

Computational studies of the potential biological impact of several energetic compounds were performed. The most commonly used explosives were considered in the present studies: trinitrotoluene (TNT), 2,4-dinitrotoluene (2,4-DNT), 2,4-dinitroanisole (DNAN), and 5-Nitro-2,4-dihydro-3H-1,2,4-triazol-3-one (NTO). The effect of such factors as ionic strength and presence of DMSO in the water solution on the structure of the membrane were considered using the POPC lipid bilayer as an example. Molecular dynamics (MD) simulations revealed that, even on a short-time scale, the influence of those additives is noticeable, and therefore those factors should always be taken into account. The MD and the COSMOmic approaches were used to elucidate the ability of the energetic compounds to penetrate the living cell. Calculated free energy profiles and partitioning coefficients revealed distributions of the compounds in the lipid bilayer as well as an overall ability to enter the cell. MD in this case provides a better representation of the free energy profile, while the COSMOmic approach works better to predict log(K_lipw) values. The effect of the functional group was observed for the profiles that were obtained using the MD method.     

What determines the van der Waals coefficient beta in the LIE (linear interaction energy) method to estimate binding free energies using molecular dynamics simulations?

Recently a semiempirical method has been proposed by Aqvist et al. to calculate absolute and relative binding free energies. In this method, the absolute binding free energy of a ligand is estimated as deltaGbind = alpha + beta, where Vel(bound) and Vvdw(bound) are the electrostatic and van der Waals interaction energies between the ligand and the solvated protein from an molecular dynamics (MD) trajectory with ligand bound to protein and Vel(free) and Vel(free) and Vvdw(free) are the electrostatic and van der Waals interaction energies between the ligand and the water from an MD trajectory with the ligand in water. A set of values, alpha = 0.5 and beta = 0.16, was found to give results in good agreement with experimental data. Later, however, different optimal values of beta were found in studies of compounds binding to P450cam and avidin. The present work investigates how the optimal value of beta depends on the nature of binding sites for different protein-ligand interactions. By examining seven ligands interacting with five proteins, we have discovered a linear correlation between the value of beta and the weighted non-polar desolvation ratio (WNDR), with a correlation coefficient of 0.96. We have also examined the ability of this correlation to predict optimal values of beta for different ligands binding to a single protein. We studied twelve neutral compounds bound to avidin. In this case, the WNDR approach gave a better estimate of the absolute binding free energies than results obtained using the fixed value of beta found for biotin-avidin. In terms of reproducing the relative binding free energy to biotin, the fixed-beta value gave better results for compounds similar to biotin, but for compounds less similar to biotin, the WNDR approach led to better relative binding free energies.     

Ranking ligand binding affinities with avidin: a molecular dynamics-based interaction energy study.

The binding of 14 biotin analogues to avidin is examined to evaluate the viability of calculating binding free energy based on molecular dynamics (MD) trajectories. Two approaches were investigated in this work. The first one uses the linear interaction energy approximation, while the other approach utilizes the interaction free energy. The results obtained from these two methods were found to correlate well with the experimental binding free energy data for 10 out of 14 ligands. For the other four ligands, both methods overestimate their binding strength by more than 7 kcal/mol. Free energy calculations using the thermodynamic integration method are employed to understand this overestimation. The effect of protein flexibility on binding free energy calculation and the effect of charged or neutral ligands on the calculated results are discussed. MD simulations are shown to be able to provide insight into the interactions occurring in the active site and the origins of variations in binding free energy.     

DNA structure: what's in charge?

DNA structure is well known to be sensitive to hydration and ionic strength. Recent theoretical predictions and experimental observations have raised the idea of the intrusion of monovalent cations into the minor groove spine of hydration in B-form DNA. To investigate this further, extensions and further analysis of molecular dynamics (MD) simulations on d(CGCCGAATTCGCG), d(ATAGGCAAAAAATAGGCAAAAATGG) and d(G(5)-(GA(4)T(4)C)(2)-C(5)), including counterions and water, have been performed. To examine the effective of minor groove ions on structure, we analyzed the MD snapshots from a 15 ns trajectory on d(CGCGAATTCGCG) as two subsets: those exhibiting a minor groove water spine and those with groove-bound ions. The results indicate that Na(+) at the ApT step of the minor groove of d(CGCCGAATTCGCG) makes only small local changes in the DNA structure, and these changes are well within the thermal fluctuations calculated from the MD. To examine the effect of ions on the differential stability of a B-form helix, further analysis was performed on two longer oligonucleotides, which exhibit A-tract-induced axis bending localized around the CpG step in the major groove. Plots of axis bending and proximity of ions to the bending locus were generated as a function of time and revealed a strong linear correlation, supporting the idea that mobile cations play a key role in local helix deformations of DNA and indicating ion proximity just precedes the bending event. To address the issue of "what's in charge?" of DNA structure more generally, the relative free energy of A and B-form d(CGCGAATTCGCG) structures from MD simulations under various environmental circumstances were estimated using the free energy component method. The results indicate that the dominant effects on conformational stability come from the electrostatic free energy, but not exclusively from groove bound ions per se, but from a balance of competing factors in the electrostatic free energy, including phosphate repulsions internal to the DNA, the electrostatic component of hydration (i.e. solvent polarization), and electrostatic effects of the counterion atmosphere. In summary, free energy calculations indicate that the electrostatic component is dominant, MD shows temporal proximity of mobile counterions to be correlated with A-track-induced bending, and thus the mobile ion component of electrostatics is a significant contributor. However, the MD structure of the dodecamer d(CGCGAATTCGCG) is not highly sensitive to whether there is a sodium ion in the minor groove.     

Parametrization scheme with accuracy and transferability for tight-binding electronic structure calculations with extended Hückel approximation and molecular dynamics simulations

A transferable tight-binding parametrization procedure for extended Hückel approximation is proposed, with the charge self-consistent scheme, that could be applied to the quantum molecular dynamics (MD) simulation for long-time dynamics of large-scale systems. In this procedure, either a target molecule is divided into small molecules or another realistic set of small molecules characterizing chemical bonds in the complicated target molecule is adopted. Then, the parameters for these small molecules are adjusted and compared with reference results of energy levels and wave functions by, for example, density functional theory. Upon application to the large target molecule, these parameters are then readjusted directly in the target molecule. An example is demonstrated with MD simulation applied to the ionic liquid molecule N-methyl-N-propylpiperidinium bis trifluoromethanesulfonyl imide (PP13-TFSI). The origin and stability of HOMO–LUMO gap are discussed.     

Lipid a from lipopolysaccharide recognition: Structure,dynamics and cooperativity by molecular dynamics simulations

Molecular dynamics simulations of Lipid A and its natural precursor Lipid IVA from E.coli have been carried out free in solution, bound to the myeliod differentiation protein 2 (MD2) and in the complex of MD2 with the toll like receptor 4 (TLR4). In addition, simulations of the ligand free MD2 and MD2‐TLR4 complex were performed. A structural and energetic characterization of the bound and unbound states of Lipid A/IVA was generated. As the crystal structures depict, the main driving force for MD2‐Lipid A/IVA are the hydrophobic interactions between the aliphatic tails and the MD2 cavity. The charged phosphate groups do strongly interact with positively charged residues, located at the surface of MD2. However, they are not essential for keeping the lipids in the cavity, indicating a more prominent role in binding recognition and ionic interactions with TLR4 at the MD2/TLR4 interface. Interestingly, in the absence of any ligand MD2 rapidly closes, blocking the binding cavity. The presence of TLR4, though changing the dynamics, was not able to impede the aforementioned closing event. We hypothesize that fluctuations of the H1 region are essential for this phenomenon, and it is plausible that an equilibrium between the open and closed states exists, although the lengths of our simulations are not sufficient to encompass the reversible process. The MD2/Lipid A‐TLR4 complex simulations show that the presence of the ligand energetically stabilizes the complex relative to the ligand‐free structures, indicating cooperativity in the binding process. © Proteins 2013. © 2012 Wiley Periodicals, Inc.     

Ab Initio Molecular Dynamics for Simple Liquid Metals Based on the Hypernetted-Chain Approximation

Abstract

We present an ab initio molecular dynamics (MD) method for simple liquid metals based on the quantal hypernetted-chain (QHNC) theory derived from exact expressions for radial distribution functions (RDF's) of the electron-ion model for liquid metals. In our method based on the QHNC equations, the classical MD is performed repeatedly to determine a self-consistent effective interionic potential, which depends on the ion-ion RDF of the system. This resultant effective ionic potential is obtained to be consistent with the density distribution of a pseudoatom and the electron-ion RDF, as well as the ion-ion RDF and the ion-ion bridge function, which are determined exactly as a result of the repeated MD simulation. We have applied this QHNC-MD method for Li, Na, K, Rb, and Cs near the melting temperature using upto 16,000 particles for the MD simulation. It is found that the convergence of the effective interionic potential is fast enough for practical applications; typically two MD runs are enough for convergence of the effective ionic potential within accuracy of 3 to 4 digits. Furthermore the resultant static structure factor is in excellent agreement with experimental data of X-ray and/or neutron scatering.     

Novel urushiol derivatives as HDAC8 inhibitors: rational design,virtual screening,molecular docking and molecular dynamics studies

Three series of novel urushiol derivatives were designed by introducing a hydroxamic acid moiety into the tail of an alkyl side chain and substituents with differing electronic properties or steric bulk onto the benzene ring and alkyl side chain. The compounds’ binding affinity toward HDAC8 was screened by Glide docking. The highest-scoring compounds were processed further with molecular docking, MD simulations, and binding free energy studies to analyze the binding modes and mechanisms. Ten compounds had Glide scores of ?8.2 to ?10.2, which revealed that introducing hydroxy, carbonyl, amino, or methyl ether groups into the alkyl side chain or addition of –F, –Cl, sulfonamide, benzamido, amino, or hydroxy substituents on the benzene ring could significantly increase binding affinity. Molecular docking studies revealed that zinc ion coordination, hydrogen bonding, and hydrophobic interactions contributed to the high calculated binding affinities of these compounds toward HDAC8. MD simulations and binding free energy studies showed that all complexes possessed good stability, as characterized by low RMSDs, low RMSFs of residues, moderate hydrogen bonding and zinc ion coordination and low values of binding free energies. Hie147, Tyr121, Phe175, Hip110, Phe119, Tyr273, Lys21, Gly118, Gln230, Leu122, Gly269, and Gly107 contributed favorably to the binding; and Van der Waals and electrostatic interactions provided major contributions to the stability of these complexes. These results show the potential of urushiol derivatives as HDAC8 binding lead compounds, which have great therapeutic potential in the treatment of various malignancies, neurological disorders, and human parasitic diseases.     

Determinative factors in inhibition of aquaporin by different pharmaceuticals: Atomic scale overview by molecular dynamics simulation

The inhibition of water permeation through aquaporins by ligands of pharmaceutical compounds is considered as a method to control the cell lifetime. The inhibition of aquaporin 1 (AQP1) by bacopaside-I and torsemide, was explored and its atomistic nature was elucidated by molecular docking and molecular dynamics (MD) simulation collectively along with Poisson-Boltzmann surface area (PBSA) method. Docking results revealed that torsemide has a lower level of docking energy in comparison with bacopaside-I at the cytoplasmic side. Furthermore, the effect of steric constraints on water permeation was accentuated. Bacopaside-I inhibits the channel properly due to the strong interaction with the channel and larger spatial volume, whereas torsemide blocks the cytoplasmic side of the channel imperfectly. The most probable active sites of AQP1 for the formation of hydrogen bonds between the inhibitor and the channel were identified by numerical analysis of the bonds. Eventually, free energy assessments indicate that binding of both inhibitors is favorable in complex with AQP1, and van der Waals interaction has an important contribution in stabilizing the complexes.     

The first living systems: a bioenergetic perspective.

The first systems of molecules having the properties of the living state presumably self-assembled from a mixture of organic compounds available on the prebiotic Earth. To carry out the polymer synthesis characteristic of all forms of life, such systems would require one or more sources of energy to activate monomers to be incorporated into polymers. Possible sources of energy for this process include heat, light energy, chemical energy, and ionic potentials across membranes. These energy sources are explored here, with a particular focus on mechanisms by which self-assembled molecular aggregates could capture the energy and use it to form chemical bonds in polymers. Based on available evidence, a reasonable conjecture is that membranous vesicles were present on the prebiotic Earth and that systems of replicating and catalytic macromolecules could become encapsulated in the vesicles. In the laboratory, this can be modeled by encapsulated polymerases prepared as liposomes. By an appropriate choice of lipids, the permeability properties of the liposomes can be adjusted so that ionic substrates permeate at a sufficient rate to provide a source of monomers for the enzymes, with the result that nucleic acids accumulate in the vesicles. Despite this progress, there is still no clear mechanism by which the free energy of light, ion gradients, or redox potential can be coupled to polymer bond formation in a protocellular structure.     

HMSS2: An advanced tool for the analysis of sulphur metabolism,including organosulphur compound transformation,in genome and metagenome assemblies

The global sulphur cycle has implications for human health, climate change, biogeochemistry and bioremediation. The organosulphur compounds that participate in this cycle not only represent a vast reservoir of sulphur but are also used by prokaryotes as sources of energy and/or carbon. Closely linked to the inorganic sulphur cycle, it involves the interaction of prokaryotes, eukaryotes and chemical processes. However, ecological and evolutionary studies of the conversion of organic sulphur compounds are hampered by the poor conservation of the relevant pathways and their variation even within strains of the same species. In addition, several proteins involved in the conversion of sulphonated compounds are related to proteins involved in sulphur dissimilation or turnover of other compounds. Therefore, the enzymes involved in the metabolism of organic sulphur compounds are usually not correctly annotated in public databases. To address this challenge, we have developed HMSS2, a profiled Hidden Markov Model-based tool for rapid annotation and synteny analysis of organic and inorganic sulphur cycle proteins in prokaryotic genomes. Compared to its previous version (HMS-S-S), HMSS2 includes several new features. HMM-based annotation is now supported by nonhomology criteria and covers the metabolic pathways of important organosulphur compounds, including dimethylsulphoniopropionate, taurine, isethionate, and sulphoquinovose. In addition, the calculation speed has been increased by a factor of four and the available output formats have been extended to include iTol compatible data sets, and customized sequence FASTA files.     

The interaction between two oppositely charged polyelectrolytes

Mixtures of a weak polybase (polyethylenimine) and a weak polyacid acrylamide-acrylic acid copolymer in aqueous solutions at several ionic strengths and polymer concentrations are studied potentiometrically. When the concentrations of the polyethylenimine and acrylamide-acrylic acid copolymer charges are not too different, phase separation into two liquid phases (“complex coacervation”) is observed. In the pH region where no phase separation occurs, potentiometric titrations are performed on mixtures of both polymers. From the titrations of polyethylenimine solutions, acrylamide-acrylic acid copolymer solutions, and the mixtures, the free energy of interaction has been evaluated according to the theory of Litan. The dependence of the free energy of interaction on pH, polymer concentrations, and ionic strength is explained quantitatively with a model of cooperative electrostatic physical association.     

Steric selectivity in Na channels arising from protein polarization and mobile side chains

Monte Carlo simulations of equilibrium selectivity of Na channels with a DEKA locus are performed over a range of radius R and protein dielectric coefficient epsilon(p). Selectivity arises from the balance of electrostatic forces and steric repulsion by excluded volume of ions and side chains of the channel protein in the highly concentrated and charged (approximately 30 M) selectivity filter resembling an ionic liquid. Ions and structural side chains are described as mobile charged hard spheres that assume positions of minimal free energy. Water is a dielectric continuum. Size selectivity (ratio of Na+ occupancy to K+ occupancy) and charge selectivity (Na+ to Ca2+) are computed in concentrations as low as 10(-5) M Ca2+. In general, small R reduces ion occupancy and favors Na+ over K+ because of steric repulsion. Small epsilon(p) increases occupancy and favors Na+ over Ca2+ because protein polarization amplifies the pore's net charge. Size selectivity depends on R and is independent of epsilon(p); charge selectivity depends on both R and epsilon(p). Thus, small R and epsilon(p) make an efficient Na channel that excludes K+ and Ca2+ while maximizing Na+ occupancy. Selectivity properties depend on interactions that cannot be described by qualitative or verbal models or by quantitative models with a fixed free energy landscape.     

An explorative study on Staphylococcus aureus MurE inhibitor: induced fit docking,binding free energy calculation,and molecular dynamics

Staphylococcus aureus MurE enzyme catalyzes the addition of l-lysine as third residue of the peptidoglycan peptide moiety. Due to the high substrate specificity and its ubiquitous nature among bacteria, MurE enzyme is considered as one of the potential target for the development of new therapeutic agents. In the present work, induced fit docking (IFD), binding free energy calculation, and molecular dynamics (MD) simulation were carried out to elucidate the inhibition potential of 2-thioxothiazolidin-4-one based inhibitor 1 against S. aureus MurE enzyme. The inhibitor 1 formed majority of hydrogen bonds with the central domain residues Asn151, Thr152, Ser180, Arg187, and Lys219. Binding free-energy calculation by MM-GBSA approach showed that van der Waals (ΔG_vdW, ?57.30?kcal/mol) and electrostatic solvation (ΔG_solv, ?36.86?kcal/mol) energy terms are major contributors for the inhibitor binding. Further, 30-ns MD simulation was performed to validate the stability of ligand–protein complex and also to get structural insight into mode of binding. Based on the IFD and MD simulation results, we designed four new compounds D1–D4 with promising binding affinity for the S. aureus MurE enzyme. The designed compounds were subjected to the extra-precision docking and binding free energy was calculated for complexes. Further, a 30-ns MD simulation was performed for D1/4C13 complex.     

Simulation of the different biological activities of diethylstilbestrol (DES) on estrogen receptor alpha and estrogen-related receptor gamma

We describe the application of the molecular dynamics (MD) and molecular mechanics-generalized Born/surface area (MM-GB/SA) approaches to the simulation of the different biological activity of diethylstilbestrol (DES) on two highly homologous nuclear receptors-estrogen receptor alpha (ER-alpha) and estrogen-related receptor gamma (ERR-gamma). DES exerts an agonistic effect against ER-alpha and an antagonistic effect against ERR-gamma. Using the x-ray crystal structures of ER-alpha in the canonical agonist bound form (PDB code: 3ERD) and antagonist bound form (PDB code: 3ERT), ERR-gamma homology models have been constructed for the receptor in two different conformations. MM-GB/SA binding free energy calculations of DES in the ER-alpha and ERR-gamma structures suggest that DES exhibits a greater free energy of binding in the agonist bound conformation of ER-alpha, while the antagonist bound conformation is preferred for ERR-gamma. Further dissection of the free energy contributions coupled with calculation of the ligand binding pocket volume suggests that the van der Waals interactions for DES within the smaller binding pocket volume of ERR-gamma are less favorable and this is the main factor for DES antagonism in ERR-gamma. This approach has potential general applicability to the prediction of the biological activity of nuclear receptor ligands.     

Analysis of excess Gibbs energy of electrolyte solutions: a new model for aqueous solutions

This paper presents an analysis of the excess Gibbs free energy of aqueous electrolytes. The analysis of experimental data leads to the conclusion that the equilibrium state for dilute univalent electrolytes in water involves an intercalation of water and ionic liquid crystal domains. Excess free energy of the solution is determined by the Madelung energy of hydrated ion-pair liquid crystals, and the energy associated with a shift in the structural equilibrium of water. The data that point to such a model include: molecular orbital-molecular dynamics applied to electrolyte water systems; Raman spectra; infrared spectra; magnetic resonance spectra of ions; the apparent density of water; and the excess free energy of electrolytes in aqueous solutions. Molecular orbital-molecular dynamics calculations of relatively large water clusters containing a molecule of sodium iodide show that the solvent separated ion pair exists in a substantial potential well compared to other possible structures. Raman spectra of univalent electrolyte solutions as a function of concentration can be quantitatively modeled using only the spectra of pure water and electrolyte solution at the concentration of the solvent separated ion pair. The other observations are consistent with the structures proposed from the Raman spectral study. The new model provides a satisfactory account of the fact that the excess free energy of dilute (<0.2 mol/l) solutions is generally more negative than anticipated on the basis of Debye-Hückel theory, and that the equilibrium evidence points to the same functional behavior at very low concentrations as is seen at 0.05 mol/l. We present a testable hypothesis that the excess free energy, and other thermodynamic properties of the solutions do not follow the Debye-Hückel limiting law. The tests of this hypothesis must involve only equilibrium measurements at concentrations between 0.05 and 0.0005 mol/l. This hypothesis concerning the structure of aqueous electrolyte solutions is not in conflict in any way with the Debye-Hückel-Onsager theory of electrical conductivity.     

Membrane Partitioning of Anionic,Ligand-Coated Nanoparticles Is Accompanied by Ligand Snorkeling,Local Disordering,and Cholesterol Depletion

Intracellular uptake of nanoparticles (NPs) may induce phase transitions, restructuring, stretching, or even complete disruption of the cell membrane. Therefore, NP cytotoxicity assessment requires a thorough understanding of the mechanisms by which these engineered nanostructures interact with the cell membrane. In this study, extensive Coarse-Grained Molecular Dynamics (MD) simulations are performed to investigate the partitioning of an anionic, ligand-decorated NP in model membranes containing dipalmitoylphosphatidylcholine (DPPC) phospholipids and different concentrations of cholesterol. Spontaneous fusion and translocation of the anionic NP is not observed in any of the 10-µs unbiased MD simulations, indicating that longer timescales may be required for such phenomena to occur. This picture is supported by the free energy analysis, revealing a considerable free energy barrier for NP translocation across the lipid bilayer. 5-µs unbiased MD simulations with the NP inserted in the bilayer core reveal that the hydrophobic and hydrophilic ligands of the NP surface rearrange to form optimal contacts with the lipid bilayer, leading to the so-called snorkeling effect. Inside cholesterol-containing bilayers, the NP induces rearrangement of the structure of the lipid bilayer in its vicinity from the liquid-ordered to the liquid phase spanning a distance almost twice its core radius (8–10 nm). Based on the physical insights obtained in this study, we propose a mechanism of cellular anionic NPpartitioning, which requires structural rearrangements of both the NP and the bilayer, and conclude that the translocation of anionic NPs through cholesterol-rich membranes must be accompanied by formation of cholesterol-lean regions in the proximity of NPs.     

DNA-binding of water-soluble furocoumarins: a thermodynamic and conformational approach to understanding different biological effects.

The interaction of two water-soluble furocoumarins, 8-(omega-diethyl aminopropyloxy)psoralen hydrochloride (I) and its 5-isomer (II), with DNA has been investigated by spectroscopic, equilibrium dialysis, hydrodynamic and chiroptical techniques. Both compounds intercalate into the polynucleotide double helix. From the dependence of the binding on ionic strength, ion release and binding free energy corrected for counterion release have been quantitatively estimated. It is shown that the differences in DNA-affinity observed for compounds I and II arise primarily from non electrostatic contributions. The binding process is exothermic, with slightly different van't Hoff enthalpies for the examined furocoumarins. Helix lengthening and dichroic effects indicate different intercalation geometries for the isomeric compounds. These studies allow a possible explanation for the finding that isomer I exhibits largely better DNA-photobinding properties, while isomer II is by far more effective as an antiviral agent.     

Liquid crystal formation in supercoiled DNA solutions

The critical concentrations pertaining to the liquid crystal formation of pUC18 plasmid in saline solutions were obtained from (31)P nuclear magnetic resonance, polarized light microscopy, and phase equilibrium experiments. The transition is strongly first order with a broad gap between the isotropic and anisotropic phase. The critical boundaries are strongly and reversibly dependent on temperature and weakly dependent on ionic strength. With polarized light microscopy on magnetically oriented samples, the liquid crystalline phase is assigned cholesteric with a pitch on the order of 4 microm. Preliminary results show that at higher concentrations a true crystal is formed. The isotropic-cholesteric transition is interpreted with lyotropic liquid crystal theory including the effects of charge, orientation entropy, and excluded volume effects. It was found that the molecular free energy associated with the topology of the superhelix is of paramount importance in controlling the width of the phase gap. The theoretical results compare favorably with the critical boundary pertaining to the disappearance of the isotropic phase, but they fail to predict the low concentration at which the anisotropic phase first appears.