Site-specific in vitro binding of plasmid pUB110 to Bacillus subtilis membrane fraction.

The in vitro membrane binding of pSL103, a composite plasmid consisting of Staphylococcus aureus plasmid pUB110 and a Bacillus pumilus trpC+ DNA fragment, to the Bacillus subtilis membrane fraction was studied with a total lysate of B. subtilis cells. The binding reaction required a heat treatment at 45 degrees C and had an optimum KCl concentration of 60 mM. Nonradioactive pSL103, but not Escherichia coli plasmid pACYC184, competed with 3H-labeled pSL103 for binding to the membrane. By the use of 32P-labeled restriction fragments of pSL103 and pUB110, it has been found that only the pUB110 portion of pSL103 binds to the membrane and that there are four specific regions in pUB110 which bind to the membrane. Two of the four binding regions flank the replication origin. This in vitro binding was high-salt sensitive and apparently independent of the configurations of the plasmid. We have previously shown that the functional product of the initiation gene dna-1 is required in vivo both for replication initiation and the binding of a DNA region near the replication origin to the membrane. Unlike in vivo binding, which is high-salt resistant and dependent on the product of dna-1 gene (type-I binding), the in vitro binding reported in this paper was high-salt sensitive and independent of the dna-1 gene product (type-II binding).     

Identification and nucleotide sequence of the minimal replicon of the low-copy-number plasmid pBS2

The plasmid pBS2 has a low copy number and is endogenous to Bacillus subtilis. The replication of this plasmid depends on the function of most of the host's dna genes including dnaB, which is unique to B. subtilis and is required for both the initiation of chromosome replication and the DNA-membrane association. We have identified the region that is essential for the replication of pBS2 and determined the complete 2279-bp nucleotide sequence of this region. In this region, there are two stretches of sequence homologous to the 18-bp consensus sequence which commonly appears at the origin of replication of plasmids pUB110 and pC194. The entire region contains six sizable open reading frames. Two of them are probably translated. One open reading frame, designated ORF A, coding for 269 amino acids, has significant homology, in terms of amino acid sequence, with the open reading frame of the gene for the Rep U protein of plasmid pUB110. The similarities between pBS2 and other plasmids suggest that the pBS2 may also replicate as a rolling circle, which appears to be the salient feature of a mechanism of replication that is common to small plasmids in gram-positive bacteria.     

Replication origins of single-stranded-DNA plasmid pUB110.

The two replication origins of plasmid pUB110 have been characterized. The site of initiation of DNA replication at the plus origin was mapped to within an 8-base-pair sequence. DNA synthesis initiated at the origin was made to terminate precociously in an inserted sequence of 18 base pairs that is homologous to a sequence in the origin. This suggests that pUB110 replicates as a rolling circle. The minus origin of plasmid pUB110 has been characterized, and the minimal sequence required for function has been determined. As with other minus origins, activity is orientation specific with respect to the direction of replication. Its activity is sensitive to rifampin in vivo, suggesting that RNA polymerase catalyzes single-strand to double-strand conversion. Unlike all other plasmids of gram-positive bacteria thus far described, the pUB110 minus origin is functional in more than one host.     

DNA sequence and analysis of a cryptic 4.2-kb plasmid from the filamentous cyanobacterium, Plectonema sp. strain PCC 6402.

The 4194-bp plasmid, pRF1, from Plectonema sp. Strain PCC 6402 was completely sequenced and analyzed. Seven potential open reading frames were identified. The predicted amino acid sequence of open reading frame C (ORF C) had identities of 34, 29, and 25% with Rep B from the Staphylococcus aureus plasmid, pUB110; Rep from the Bacillus amyloliquefaciens plasmid, pFTB14; and protein A from the S. aureus plasmid, pC194, respectively. A 75-amino-acid region conserved in these proteins (Rep B, Rep, and protein A) also was highly conserved in ORF C with identities of 45, 37, and 40%, respectively. Significantly, 16 of the 21 amino acids conserved in Rep B, Rep, and protein A were found at the same positions in ORF C. This ORF may encode a replication protein that includes a region conserved in some eubacteria. Additional structural features include a 425-bp region that contains palindromes, tandem repeats, and short direct repeats which may correspond to the origin of replication. An 18-bp inverted repeat was located between two open reading frames, A and G.     

Functional analysis of the leading strand replication origin of plasmid pUB110 in Bacillus subtilis.

Supercoiled plasmid DNA is the substrate for initiation of pUB110 replication, and - by inference - for binding of its initiator protein (RepU) to the plasmid replication origin (oriU) in vivo. No hairpin structure is required for RepU-oriU recognition. RepH (the pC194 replication initiation protein) failed to initiate replication in trans at oriU. The nucleotides that determine the specificity of the replication initiation process are located within oriU but termination is unefficient. Therefore the segment that forms the full recognition signal for termination is probably located 3' of the oriU recognition sequence. Two overlapping domains, one for initiation and one required for termination, compose the leading strand replication origin of plasmid pUB110.     

Molecular structure of the replication origin of a Bacillus subtilis (natto) plasmid, pUH1.

The structure of a 2.0-kb BstEII DNA sequence necessary and sufficient for the replication of a 5.7-kb Natto plasmid, pUH1, which is responsible for gamma-polyglutamate production by Bacillus subtilis (natto), has been characterized by using a trimethoprim resistance gene derived from B. subtilis chromosomal DNA as a selective marker. The 2.0-kb DNA sequence contains an open reading frame, rep, stretching for 999 bp; a promoter region for rep expression; and a possible replication origin for the plasmid upstream of the promotor. The predicted Rep protein has highly homologous amino acid sequences with rep14 of pFTB14 in B. amyloliquefaciens, RepB of pUB110, and protein A, which is necessary for pC194 replication in staphylococci throughout the protein molecule, but is not homologous with RepC of staphylococcal plasmid pT181.     

Similarity of minus origins of replication and flanking open reading frames of plasmids pUB110, pTB913 and pMV158.

Plasmids pMV158 and pTB913, originating from Streptococcus agalactiae and a thermophilic Bacillus respectively, were sequenced to completion. Both contained a BA3-type minus origin of replication and an RSA-site, believed to constitute a site-specific recombination site. These two regions were more than 99% homologous to the corresponding regions of the Staphylococcus aureus plasmid pUB110. Deleting the BA3-type minus origin resulted in the accumulation of a considerable amount of single-stranded DNA, both in L. lactis subsp. lactis and B. subtilis, indicating that this minus origin was functional in both bacterial species. Like pUB110, both plasmids contained an open reading frame encoding a putative plasmid recombination enzyme (Pre protein), which was located downstream of the RSA-site. On the basis of sequence comparisons between pUB110, pMV158, pTB913, pT181, pE194, pNE131 and pT48 two distinct families of RSA-sites and Pre proteins could be distinguished.     

Nucleotide sequence and physical map of kanamycin-resistant plasmid pUB110 from Staphylococcus aureus

The complete nucleotide sequence of Staphylococcus aureus plasmid pUB10 was determined. The sequence consists of 4545 b.p. and contains 64% A-T and 36% G-C pairs. pUB110 was found to contain four open reading frames, capable of coding for polypeptides having more than 80 amino acids. All the putative polypeptides are coded for by one DNA strand. The molecular weights of four putative polypeptides are (in kilodaltons): A-49.5; B-38.8; C-28.8 and D-9.5. Polypeptide C is involved in kanamycin resistance. Polypeptide B is, possibly, involved in pUB110 replication. No role has yet been established for polypeptides A and D, since deletions in their coding sequences have no detectable effect on any properties of pUB110 plasmid.     

Lactobacillus hilgardii plasmid pLAB1000 consists of two functional cassettes commonly found in other gram-positive organisms.

A Lactobacillus hilgardii plasmid, pLAB1000, was studied to understand the organization of autonomous replicons from lactobacilli. Two cassettes could be identified. First, the replication region consisted of a sequence coding for a replication protein (Rep) and its corresponding target site, similar to those from plasmids pUB110, pC194 (Staphylococcus aureus), pFTB14, pBAA1 (Bacillus sp.), and pLP1 (Lactobacillus sp.). Sequence analysis indicated the possible synthesis of an antisense RNA that might regulate Rep production. The results also suggested that pLAB1000 replicates via a single-stranded DNA intermediate, and a putative lagging-strand initiation site was found that had similarities to those of alpha 3, St-1, and G4 isometric bacteriophages. The second cassette of pLAB1000 consisted of a sequence coding for a putative mobilization protein (Mob) and its corresponding RSA site. This cassette was similar to those found in pT181, pUB110, pE194 (S. aureus), and pG12 (Bacillus sp.), and it was found to be conserved among different Lactobacillus plasmid replicons. The origin and evolution of these functional cassettes are also discussed.     

Nucleotide sequence of sporulation locus spoIIA in Bacillus subtilis

We have determined a sequence of 2073 bp from two recombinant plasmids carrying the whole spoIIA locus from Bacillus subtilis, the expression of which is required for spore formation. The sequence contains three long open reading frames (ORFs), each of them being preceded by a ribosome binding site. These three putative proteins (mol. wts 13100, 16300 and 22200) are likely to be expressed and are probably encoded on the same mRNA. The stop codon of ORF1 overlaps with the start codon of ORF2 suggesting that there might be translational coupling between the two ORFs. Although some known promoter sequences were found, the only one upstream from the first open reading frame is about 260 bp from it.     

Alpha-amylase genes (amyR2 and amyE+) from an alpha-amylase-hyperproducing Bacillus subtilis strain: molecular cloning and nucleotide sequences.

amyR2, amyE+, and aroI+ alleles from an alpha-amylase-hyperproducing strain, Bacillus subtilis NA64, were cloned in temperate B. subtilis phage p11, and the amyR2 and amyE+ genes were then recloned in plasmid pUB110, which was designated pTUB4. The order of the restriction sites, ClaI-EcoRI-PstI-SalI-SmaI, found in the DNA fragment carrying amyR2 and amyE+ from the phage genome was also found in the 2.3-kilobase insert of pTUB4. Approximately 2,600 base pairs of the DNA nucleotide sequence of the amyR2 and amyE+ gene region in pTUB4 were determined. Starting from an ATG initiator codon, an open reading frame was composed of a total 1,776 base pairs (592 amino acids). Among the 1,776 base pairs, 1,674 (558 amino acids) were found in the cloned DNA fragment, and 102 base pairs (34 amino acids) were in the vector pUB110 DNA. The COOH terminal region of the alpha-amylase of pTUB4 was encoded in pUB110. The electrophoretic mobility in a 7.5% polyacrylamide gel of the alpha-amylase was slightly faster than that of the parental alpha-amylases. The NH2 termination portion of the gene encoded a 41-amino acid-long signal sequence (Ohmura et al., Biochem. Biophys. Res. Commun. 112:687-683, 1983). The DNA sequence of the mature extracellular alpha-amylase, a potential RNA polymerase recognition site and Pribnow box (TTGATAGAGTGATTGTGATAATTTAAAAT), and an AT-rich inverted repeat structure which has free energy of -8.2 kcal/mol (-34.3 kJ/mol) were identified. The AT-rich inverted repeat structure seemed to correspond to the hyperproducing character. The nucleotide sequence around the region was quite different from the promoter region of the B. subtilis 168 alpha-amylase gene which was cloned in the Escherichia coli vector systems.     

The large Bacillus plasmid pTB19 contains two integrated rolling-circle plasmids carrying mobilization functions

Plasmid pTB19 is a 27-kb plasmid originating from a thermophilic Bacillus species. It was shown previously that pTB19 contains an integrated copy of the rolling-circle type plasmid pTB913. Here we describe the analysis of a 4324-bp region of pTB19 conferring resistance to tetracycline. The nucleotide sequence of this region revealed all the characteristics of a second plasmid replicating via the rolling-circle mechanism. This sequence contained (i) the tetracycline resistance marker of pTB19, which is highly similar to other tetL-genes of gram-positive bacteria; (ii) a hybrid mob gene, which bears relatedness to both the mob-genes of pUB110 and pTB913; (iii) a palU type minus origin identical to those of pUB110 and pTB913; and (iv) a plus origin of replication similar to that of pTB913. A repB-type replication initiation gene sequence identical to that of pTB913 was present, which lacked the middle part (492 bp), thus preventing autonomous replication of this region. The hybrid mob gene was functional in conjugative mobilization of plasmids between strains of Bacillus subtilis.     

Nucleotide sequence of the Clostridium thermocellum laminarinase gene.

The sequence presented (1022 bp) shows the Clostridium thermocellum laminarinase gene (lam1) and its flanking regions. The gene lam1 comprises an open reading frame of 726 nt, encoding a 242-aa protein with predicted Mr 27661. The ORF startswith the translation initiation codon ATG. This ATG codon is preceded at a spacing of 7 bp by a potential ribosome binding site (GGAGGT). A putative signal peptide was identified (the potential cleavage site is between position 27-28 aa). The comparison of the primary protein sequence with other beta-1, 3-1, 4-glucanases showed extensive homology for Bacillus amyloliqefaciens and Bacillus subtilis glucanases (identity-46.7%; similarity-57.0%).     

A small plasmid, pCA2.4, from the cyanobacterium Synechocystis sp. strain PCC 6803 encodes a rep protein and replicates by a rolling circle mechanism.

Different cryptic plasmids are widely distributed in many strains of cyanobacteria. A small cryptic plasmid, pCA2.4, from Synechocystis strain PCC 6803 was completely sequenced, and its replication mode was determined. pCA2.4 contained 2,378 bp and encoded a replication (Rep) protein, designated RepA. An analysis of the deduced amino acid sequence revealed that RepA of pCA2.4 has significant homology with Rep proteins of pKYM from Shigella sonnei, a pUB110 plasmid family from gram-positive bacteria, and with a protein corresponding to an open reading frame in a Nostoc plasmid and open reading frame C of Plectonema plasmid pRF1. pKYM and pUB110 family plasmids replicate by a rolling circle mechanism in which a Rep protein nicks the origin of replication to allow the generation of a single-stranded plasmid as a replication intermediate. RepA encoded by pC2.4 was expressed in Escherichia coli cells harboring a vector, pCRP336, containing the entire repA gene. The observed molecular weight of RepA was consistent with the value of 39,200 calculated from its deduced amino acid sequence, as was the N-terminal sequence analysis done through the 12th residue. Single-stranded plasmid DNA of pCA2.4 that was specifically degraded by S1 nuclease was detected in Synechocystis cells by Southern hybridization. These observations suggest that pCA2.4 replicates by a rolling circle mechanism in Synechocystis cells.     

Heat-inducible translational coupling in Bacillus subtilis.

Bacillus subtilis plasmid pGR71 is a promoter-probe shuttle vector derived from pUB110. The expression of the cat gene on pGR71 in B. subtilis requires the insertion of a Bacillus promoter and a ribosomal binding site (RBS) into the HindIII cloning site immediately upstream from the cat gene. A recombinant plasmid of pGR71, named pGR71-369, was obtained by a spontaneous deletion of a fragment containing most of the inserted HindIII fragment and the replication origin necessary for multiplication in Escherichia coli. The expression of the cat gene in B. subtilis cells carrying this plasmid was inducible by heat. Nucleotide sequence analysis of the upstream region of the cat gene, deletion analysis, and dot blot hybridization analysis of mRNA in various conditions revealed that the cat gene was expressed by heat-inducible translational coupling and that the regulatory region of heat inducibility was present in the upstream region of the cat gene.