共查询到20条相似文献,搜索用时 46 毫秒
1.
Feeding high levels of zinc oxide to piglets significantly increased the relative abundance of ileal Weissella spp., Leuconostoc spp., and Streptococcus spp., reduced the occurrence of Sarcina spp. and Neisseria spp., and led to numerical increases of all Gram-negative facultative anaerobic genera. High dietary zinc oxide intake has a major impact on the porcine ileal bacterial composition.Zinc oxide (ZnO) is used as a feed additive for diarrhea prophylaxis in piglets (23). However, the mode of action of ZnO is not fully understood. Besides its effects on the host (10, 30, 31), high dietary zinc levels may affect the diversity of intestinal microbial communities (2, 11, 20). The prevention of postweaning diarrhea in piglets due to high dietary ZnO intake may not be directly related to a reduction of pathogenic E. coli (8) but, rather, to the diversity of the coliform community (15). Studies on the impact of high ZnO levels on the porcine ileal bacterial community are scarce but nevertheless important, as bacterial diarrhea is initiated in the small intestine (9, 17). The small intestine is a very complex habitat with many different factors shaping the bacterial community. Studies on the ecophysiology (22) and maturation of the porcine ileal microbiota (13, 27) indicate a drastic impact directly after weaning and a gradual decline of modifications during the following 2 weeks. Thus, the time point for analysis chosen in this study (14 days postweaning) does reflect a more stable period of the ileal porcine microbiota. In this study, we used bar-coded pyrosequencing of 16S rRNA genes to gain further insight into the mode of action of pharmacological levels of ZnO in the gastrointestinal tract of young pigs.Total DNA was extracted from the ileal digesta of 40- to 42-day-old piglets using a commercial kit (Qiagen stool kit; Qiagen, Hilden, Germany) and PCR amplified with unique bar-coded primer sets targeting the V1-to-V3 and the V6-to-V8 hypervariable regions (see the supplemental material for detailed methods). The rationale behind this approach was derived from the fact that no single “universal” primer pair can completely cover a complex bacterial habitat (4, 24, 32, 33). Furthermore, these studies also show that in silico information on the coverage of selected primer sets diverges from empirical results, and hence, two hypervariable regions were chosen in this study to maximize the detection of phylogenetically diverse bacterial groups.Equimolar dilutions of all samples were combined into one master sample. Pyrosequencing was performed by Agowa (Berlin, Germany) on a Roche genome sequencer FLX system using a Titanium series PicoTiterPlate. The resulting data files were uploaded to the MG-RAST server (http://metagenomics.nmpdr.org/) (19) and processed with its SEED software tool using the RDP database (5) as the reference database. After automated sequence analysis, all sequences with less than five identical reads per sample were deleted in order to increase the confidence of sequence reads and reduce bias from possible sequencing errors (12, 16). Thus, 0.43% of all sequences were not considered (1,882 of 433,302 sequences). These sequences were assigned to a total of 238 genera, of which most only occurred in a few samples (see the supplemental material). Furthermore, all unclassified sequences were removed (8.7%; 41,467 of 474,769 sequences). Due to the use of the RDP reference database, the SEED software incorrectly assigned the majority of unclassified sequences as unclassified Deferribacterales (83%; 34,393 sequences), which were actually identified as 16S soybean or wheat chloroplasts by BLAST or as cyanobacterial chloroplasts by the RDP II seqmatch tool.The pyrosequencing results for the two primer combinations were merged by taking only sequences from the primer combination that yielded the higher number of reads for a specific sequence assignment in a sample. The remaining reads were used to calculate the relative contribution of assigned sequences to total sequence reads in a sample.The Firmicutes phylum dominated the small intestinal bacterial communities in both the control group and the group with high dietary ZnO intake, with 98.3% and 97.0% of total sequence reads, respectively. No significant influence of high dietary ZnO intake was found for the main phyla Proteobacteria (0.92% versus 1.84%), Actinobacteria (0.61% versus 0.75%), Bacteroidetes (0.15% versus 0.17%), and Fusobacteria (0.09% versus 0.12%).On the order level, a total of 20 bacterial orders were detected (data not shown). Lactobacillales dominated bacterial communities in the control and high-dietary-ZnO-intake groups, with 83.37% and 93.24% of total reads. Lactic acid bacteria are well known to dominate the bacterial community in the ileum of piglets (11, 22). No significant difference between the control group and the group with high dietary ZnO intake was observed on the order level, although high dietary ZnO intake led to a strong numerical decrease for Clostridiales (14.4 ± 24.0% [mean ± standard deviation] versus 2.8 ± 1.7%), as well as to numerical increases for Pseudomonadales (0.3 ± 0.3% versus 0.6 ± 0.6%) and Enterobacteriales (0.2 ± 0.2% versus 0.5 ± 0.6%).On the genus level, a total of 103 genera were detected. Table Table11 summarizes the main 31 genera which exceeded 0.05% of total reads (see the supplemental material for a complete list). Lactobacilli clearly dominated the bacterial communities in both trial groups, but they also were numerically lower due to high dietary ZnO intake.
Open in a separate windowan = 6 piglets per trial group. A,B, results are significantly different by Kruskal-Wallis test.bSingle sample.Significant changes due to high dietary ZnO intake were observed for other lactic acid bacteria, including Weissella spp., Leuconostoc spp., and Streptococcus spp. A significant and strong decrease was observed for Sarcina spp., which is a genus of acid-tolerant strictly anaerobic species found in the intestinal tract of piglets and other mammals (6, 28, 29). This genus thus appeared to be very sensitive to modifications induced by high dietary ZnO intake.An interesting result was observed for Gram-negative Proteobacteria, (i.e., enterobacteria and relatives). Although not statistically significant, virtually all detected proteobacteria increased numerically due to high dietary ZnO intake (Enterobacter spp., Microbacterium spp., Citrobacter spp., Neisseria spp., and Acinetobacter spp.). Apparently, enterobacteria gained colonization potential by high dietary ZnO intake. This is in good agreement with the results of studies by Hojberg et al. (11), Amezcua et al. (1), and Castillo et al. (3). Therefore, the frequently observed diarrhea-reducing effect of zinc oxide may not be directly related to a reduction of pathogenic E. coli strains. Considering a possible antagonistic activity of lactobacilli against enterobacteria (25), it can be speculated that a numerical decrease of dominant lactobacilli may lead to increased colonization with Gram-negative enterobacteria. On the other hand, specific plasmid-borne genes for resistance against heavy metals have been reported for both Gram-positive and Gram-negative bacteria present in the intestine (21, 26), and an increased resistance against Zn ions may exist for Gram-negative enterobacteria. Zinc oxide is an amphoteric molecule and shows a high solubility at acid pH. The low pH in the stomach of piglets (pH 3.5 to 4.5) transforms a considerable amount of insoluble ZnO into zinc ions (54 to 84% free Zn2+ at 150 ppm and 24 ppm ZnO, respectively) (7), and thus, high concentrations of toxic zinc ions exist in the stomach. The stomach of piglets harbors large numbers of lactic acid bacteria, especially lactobacilli. Zn ions may thus lead to a modification of the lactic acid bacterial community in the stomach, and the changes observed in the ileum could have been created in the stomach. A reduction of dominant lactobacilli may thus point to an increased adaptation potential of Gram-negative facultative anaerobes and a generally increased bacterial diversity.Additionally, the direct effects of dietary ZnO on intestinal tissues include altered expression of genes responsible for glutathione metabolism and apoptosis (30), enhanced gastric ghrelin secretion, which increases feed intake (31), and increased production of digestive enzymes (10). An analysis of the intestinal morphology was beyond the scope of this study, but although ZnO concentrations are markedly increased in intestinal tissue, the influence of ZnO on morphology is apparently not always observed (10, 14, 18). Consequently, any changes in epithelial cell turnover, feed intake, or digestive capacity may influence the composition of bacterial communities in the small intestine.In conclusion, this study has shown that high dietary zinc oxide has a major impact on ileal bacterial communities in piglets. Future studies on the impact of zinc oxide in pigs should include a detailed analysis of host responses in order to identify the cause for the observed modifications of intestinal bacterial communities. 相似文献
TABLE 1.
Bacterial genera in the ileum of piglets fed diets supplemented with 200 or 3,000 ppm ZnOGenus | Proportion (% ± SD) of ileal microbiota in groupa receiving: | |
---|---|---|
200 ppm ZnO | 3,000 ppm ZnO | |
Lactobacillus | 59.3 ± 30.6 | 40.7 ± 19.1 |
Weissella | 11.6 ± 7.8 A | 24.1 ± 8.3 B |
Sarcina | 11.4 ± 20.5 A | 0.84 ± 1.2 B |
Leuconostoc | 4.7 ± 3.2 A | 9.4 ± 3.1 B |
Streptococcus | 1.8 ± 1.6 A | 5.7 ± 5.1 B |
Lactococcus | 1.6 ± 1.5 | 2.6 ± 3.1 |
Veillonella | 0.57 ± 0.63 | 0.34 ± 0.30 |
Gemella | 0.34 ± 0.67 A | 0.45 ± 0.25 B |
Acinetobacter | 0.25 ± 0.21 | 0.44 ± 0.50 |
Clostridium | 0.25 ± 0.40 | 0.22 ± 0.21 |
Enterococcus | 0.19 ± 0.15 | 0.26 ± 0.24 |
Acidovorax | 0.14 ± 0.04 | 0.16 ± 0.19 |
Arcobacter | 0.14 ± 0.15 | 0.16 ± 0.17 |
Neisseria | 0.14b | 0.03 ± 0.01 |
Enterobacter | 0.13 ± 0.09 | 0.29 ± 0.34 |
Lachnospira | 0.12 ± 0.13 | 0.13 ± 0.03 |
Peptostreptococcus | 0.11 ± 0.10 | 0.07 ± 0.09 |
Chryseobacterium | 0.10 ± 0.07 | 0.15 ± 0.16 |
Actinomyces | 0.09 ± 0.04 | 0.15 ± 0.16 |
Anaerobacter | 0.07 ± 0.08 | 0.02 ± 0.01 |
Aerococcus | 0.07 ± 0.04 | 0.07 ± 0.04 |
Dorea | 0.07b | 0.05 ± 0.05 |
Fusobacterium | 0.06 ± 0.09 | 0.08 ± 0.11 |
Microbacterium | 0.06 ± 0.01 | 0.07 ± 0.04 |
Carnobacterium | 0.06 ± 0.02 | 0.08 ± 0.13 |
Granulicatella | 0.06 ± 0.02 | 0.09 ± 0.10 |
Staphylococcus | 0.06 ± 0.04 | 0.05 ± 0.02 |
Facklamia | 0.05 ± 0.06 | 0.03 ± 0.01 |
Comamonas | 0.05 ± 0.03 | 0.04 ± 0.02 |
Citrobacter | 0.05 ± 0.02 | 0.07 ± 0.08 |
Erysipelothrix | 0.05 ± 0.01 | 0.22 ± 0.40 |
2.
Riboflavin significantly enhanced the efficacy of simulated solar disinfection (SODIS) at 150 watts per square meter (W m−2) against a variety of microorganisms, including Escherichia coli, Fusarium solani, Candida albicans, and Acanthamoeba polyphaga trophozoites (>3 to 4 log10 after 2 to 6 h; P < 0.001). With A. polyphaga cysts, the kill (3.5 log10 after 6 h) was obtained only in the presence of riboflavin and 250 W m−2 irradiance.Solar disinfection (SODIS) is an established and proven technique for the generation of safer drinking water (11). Water is collected into transparent plastic polyethylene terephthalate (PET) bottles and placed in direct sunlight for 6 to 8 h prior to consumption (14). The application of SODIS has been shown to be a simple and cost-effective method for reducing the incidence of gastrointestinal infection in communities where potable water is not available (2-4). Under laboratory conditions using simulated sunlight, SODIS has been shown to inactivate pathogenic bacteria, fungi, viruses, and protozoa (6, 12, 15). Although SODIS is not fully understood, it is believed to achieve microbial killing through a combination of DNA-damaging effects of ultraviolet (UV) radiation and thermal inactivation from solar heating (21).The combination of UVA radiation and riboflavin (vitamin B2) has recently been reported to have therapeutic application in the treatment of bacterial and fungal ocular pathogens (13, 17) and has also been proposed as a method for decontaminating donor blood products prior to transfusion (1). In the present study, we report that the addition of riboflavin significantly enhances the disinfectant efficacy of simulated SODIS against bacterial, fungal, and protozoan pathogens.Chemicals and media were obtained from Sigma (Dorset, United Kingdom), Oxoid (Basingstoke, United Kingdom), and BD (Oxford, United Kingdom). Pseudomonas aeruginosa (ATCC 9027), Staphylococcus aureus (ATCC 6538), Bacillus subtilis (ATCC 6633), Candida albicans (ATCC 10231), and Fusarium solani (ATCC 36031) were obtained from ATCC (through LGC Standards, United Kingdom). Escherichia coli (JM101) was obtained in house, and the Legionella pneumophila strain used was a recent environmental isolate.B. subtilis spores were produced from culture on a previously published defined sporulation medium (19). L. pneumophila was grown on buffered charcoal-yeast extract agar (5). All other bacteria were cultured on tryptone soy agar, and C. albicans was cultured on Sabouraud dextrose agar as described previously (9). Fusarium solani was cultured on potato dextrose agar, and conidia were prepared as reported previously (7). Acanthamoeba polyphaga (Ros) was isolated from an unpublished keratitis case at Moorfields Eye Hospital, London, United Kingdom, in 1991. Trophozoites were maintained and cysts prepared as described previously (8, 18).Assays were conducted in transparent 12-well tissue culture microtiter plates with UV-transparent lids (Helena Biosciences, United Kingdom). Test organisms (1 × 106/ml) were suspended in 3 ml of one-quarter-strength Ringer''s solution or natural freshwater (as pretreated water from a reservoir in United Kingdom) with or without riboflavin (250 μM). The plates were exposed to simulated sunlight at an optical output irradiance of 150 watts per square meter (W m−2) delivered from an HPR125 W quartz mercury arc lamp (Philips, Guildford, United Kingdom). Optical irradiances were measured using a calibrated broadband optical power meter (Melles Griot, Netherlands). Test plates were maintained at 30°C by partial submersion in a water bath.At timed intervals for bacteria and fungi, the aliquots were plated out by using a WASP spiral plater and colonies subsequently counted by using a ProtoCOL automated colony counter (Don Whitley, West Yorkshire, United Kingdom). Acanthamoeba trophozoite and cyst viabilities were determined as described previously (6). Statistical analysis was performed using a one-way analysis of variance (ANOVA) of data from triplicate experiments via the InStat statistical software package (GraphPad, La Jolla, CA).The efficacies of simulated sunlight at an optical output irradiance of 150 W m−2 alone (SODIS) and in the presence of 250 μM riboflavin (SODIS-R) against the test organisms are shown in Table Table1.1. With the exception of B. subtilis spores and A. polyphaga cysts, SODIS-R resulted in a significant increase in microbial killing compared to SODIS alone (P < 0.001). In most instances, SODIS-R achieved total inactivation by 2 h, compared to 6 h for SODIS alone (Table (Table1).1). For F. solani, C. albicans, ands A. polyphaga trophozoites, only SODIS-R achieved a complete organism kill after 4 to 6 h (P < 0.001). All control experiments in which the experiments were protected from the light source showed no reduction in organism viability over the time course (results not shown).
Open in a separate windowaConditions are at an intensity of 150 W m−2 unless otherwise indicated.bThe values reported are means ± standard errors of the means from triplicate experiments.cAdditional experiments for this condition were performed using natural freshwater.The highly resistant A. polyphaga cysts and B. subtilis spores were unaffected by SODIS or SODIS-R at an optical irradiance of 150 W m−2. However, a significant reduction in cyst viability was observed at 6 h when the optical irradiance was increased to 250 W m−2 for SODIS-R only (P < 0.001; Table Table1).1). For spores, a kill was obtained only at 320 W m−2 after 6-h exposure, and no difference between SODIS and SODIS-R was observed (Table (Table1).1). Previously, we reported a >2-log kill at 6 h for Acanthamoeba cysts by using SODIS at the higher optical irradiance of 850 W m−2, compared to the 0.1-log10 kill observed here using the lower intensity of 250 W m−2 or the 3.5-log10 kill with SODIS-R.Inactivation experiments performed with Acanthamoeba cysts and trophozoites suspended in natural freshwater gave results comparable to those obtained with Ringer''s solution (P > 0.05; Table Table1).1). However, it is acknowledged that the findings of this study are based on laboratory-grade water and freshwater and that differences in water quality through changes in turbidity, pH, and mineral composition may significantly affect the performance of SODIS (20). Accordingly, further studies are indicated to evaluate the enhanced efficacy of SODIS-R by using natural waters of varying composition in the areas where SODIS is to be employed.Previous studies with SODIS under laboratory conditions have employed lamps delivering an optical irradiance of 850 W m−2 to reflect typical natural sunlight conditions (6, 11, 12, 15, 16). Here, we used an optical irradiance of 150 to 320 W m−2 to obtain slower organism inactivation and, hence, determine the potential enhancing effect of riboflavin on SODIS.In conclusion, this study has shown that the addition of riboflavin significantly enhances the efficacy of simulated SODIS against a range of microorganisms. The precise mechanism by which photoactivated riboflavin enhances antimicrobial activity is unknown, but studies have indicated that the process may be due, in part, to the generation of singlet oxygen, H2O2, superoxide, and hydroxyl free radicals (10). Further studies are warranted to assess the potential benefits from riboflavin-enhanced SODIS in reducing the incidence of gastrointestinal infection in communities where potable water is not available. 相似文献
TABLE 1.
Efficacies of simulated SODIS for 6 h alone and with 250 μM riboflavin (SODIS-R)Organism | Conditiona | Log10 reduction in viability at indicated h of exposureb | |||
---|---|---|---|---|---|
1 | 2 | 4 | 6 | ||
E. coli | SODIS | 0.0 ± 0.0 | 0.2 ± 0.1 | 5.7 ± 0.0 | 5.7 ± 0.0 |
SODIS-R | 1.1 ± 0.0 | 5.7 ± 0.0 | 5.7 ± 0.0 | 5.7 ± 0.0 | |
L. pneumophila | SODIS | 0.7 ± 0.2 | 1.3 ± 0.3 | 4.8 ± 0.2 | 4.8 ± 0.2 |
SODIS-R | 4.4 ± 0.0 | 4.4 ± 0.0 | 4.4 ± 0.0 | 4.4 ± 0.0 | |
P. aeruginosa | SODIS | 0.7 ± 0.0 | 1.8 ± 0.0 | 4.9 ± 0.0 | 4.9 ± 0.0 |
SODIS-R | 5.0 ± 0.0 | 5.0 ± 0.0 | 5.0 ± 0.0 | 5.0 ± 0.0 | |
S. aureus | SODIS | 0.0 ± 0.0 | 0.0 ± 0.0 | 6.2 ± 0.0 | 6.2 ± 0.0 |
SODIS-R | 0.2 ± 0.1 | 6.3 ± 0.0 | 6.3 ± 0.0 | 6.3 ± 0.0 | |
C. albicans | SODIS | 0.2 ± 0.0 | 0.4 ± 0.1 | 0.5 ± 0.1 | 1.0 ± 0.1 |
SODIS-R | 0.1 ± 0.0 | 0.7 ± 0.1 | 5.3 ± 0.0 | 5.3 ± 0.0 | |
F. solani conidia | SODIS | 0.2 ± 0.1 | 0.3 ± 0.0 | 0.2 ± 0.0 | 0.7 ± 0.1 |
SODIS-R | 0.3 ± 0.1 | 0.8 ± 0.1 | 1.3 ± 0.1 | 4.4 ± 0.0 | |
B. subtilis spores | SODIS | 0.3 ± 0.0 | 0.2 ± 0.0 | 0.0 ± 0.0 | 0.1 ± 0.0 |
SODIS-R | 0.1 ± 0.1 | 0.2 ± 0.1 | 0.3 ± 0.3 | 0.1 ± 0.0 | |
SODIS (250 W m−2) | 0.1 ± 0.0 | 0.1 ± 0.1 | 0.1 ± 0.1 | 0.0 ± 0.0 | |
SODIS-R (250 W m−2) | 0.0 ± 0.0 | 0.0 ± 0.0 | 0.2 ± 0.0 | 0.4 ± 0.0 | |
SODIS (320 W m−2) | 0.1 ± 0.1 | 0.1 ± 0.0 | 0.0 ± 0.1 | 4.3 ± 0.0 | |
SODIS-R (320 W m−2) | 0.1 ± 0.0 | 0.1 ± 0.1 | 0.9 ± 0.0 | 4.3 ± 0.0 | |
A. polyphaga trophozoites | SODIS | 0.4 ± 0.2 | 0.6 ± 0.1 | 0.6 ± 0.2 | 0.4 ± 0.1 |
SODIS-R | 0.3 ± 0.1 | 1.3 ± 0.1 | 2.3 ± 0.4 | 3.1 ± 0.2 | |
SODIS, naturalc | 0.3 ± 0.1 | 0.4 ± 0.1 | 0.5 ± 0.2 | 0.3 ± 0.2 | |
SODIS-R, naturalc | 0.2 ± 0.1 | 1.0 ± 0.2 | 2.2 ± 0.3 | 2.9 ± 0.3 | |
A. polyphaga cysts | SODIS | 0.4 ± 0.1 | 0.1 ± 0.3 | 0.3 ± 0.1 | 0.4 ± 0.2 |
SODIS-R | 0.4 ± 0.2 | 0.3 ± 0.2 | 0.5 ± 0.1 | 0.8 ± 0.3 | |
SODIS (250 W m−2) | 0.0 ± 0.1 | 0.2 ± 0.3 | 0.2 ± 0.1 | 0.1 ± 0.2 | |
SODIS-R (250 W m−2) | 0.4 ± 0.2 | 0.3 ± 0.2 | 0.8 ± 0.1 | 3.5 ± 0.3 | |
SODIS (250 W m−2), naturalc | 0.0 ± 0.3 | 0.2 ± 0.1 | 0.1 ± 0.1 | 0.2 ± 0.1 | |
SODIS-R (250 W m−2), naturalc | 0.1 ± 0.1 | 0.2 ± 0.2 | 0.6 ± 0.1 | 3.4 ± 0.2 |
3.
4.
Andrew D. Morgan R. Craig MacLean Kristina L. Hillesland Gregory J. Velicer 《Applied and environmental microbiology》2010,76(20):6920-6927
Predator-prey relationships among prokaryotes have received little attention but are likely to be important determinants of the composition, structure, and dynamics of microbial communities. Many species of the soil-dwelling myxobacteria are predators of other microbes, but their predation range is poorly characterized. To better understand the predatory capabilities of myxobacteria in nature, we analyzed the predation performance of numerous Myxococcus isolates across 12 diverse species of bacteria. All predator isolates could utilize most potential prey species to effectively fuel colony expansion, although one species hindered predator swarming relative to a control treatment with no growth substrate. Predator strains varied significantly in their relative performance across prey types, but most variation in predatory performance was determined by prey type, with Gram-negative prey species supporting more Myxococcus growth than Gram-positive species. There was evidence for specialized predator performance in some predator-prey combinations. Such specialization may reduce resource competition among sympatric strains in natural habitats. The broad prey range of the Myxococcus genus coupled with its ubiquity in the soil suggests that myxobacteria are likely to have very important ecological and evolutionary effects on many species of soil prokaryotes.Predation plays a major role in shaping both the ecology and evolution of biological communities. The population and evolutionary dynamics of predators and their prey are often tightly coupled and can greatly influence the dynamics of other organisms as well (1). Predation has been invoked as a major cause of diversity in ecosystems (11, 12). For example, predators may mediate coexistence between superior and inferior competitors (2, 13), and differential trajectories of predator-prey coevolution can lead to divergence between separate populations (70).Predation has been investigated extensively in higher organisms but relatively little among prokaryotes. Predation between prokaryotes is one of the most ancient forms of predation (27), and it has been proposed that this process may have been the origin of eukaryotic cells (16). Prokaryotes are key players in primary biomass production (44) and global nutrient cycling (22), and predation of some prokaryotes by others is likely to significantly affect these processes. Most studies of predatory prokaryotes have focused on Bdellovibrionaceae species (e.g., see references 51, 55, and 67). These small deltaproteobacteria prey on other Gram-negative cells, using flagella to swim rapidly until they collide with a prey cell. After collision, the predator cells then enter the periplasmic space of the prey cell, consume the host cell from within, elongate, and divide into new cells that are released upon host cell lysis (41). Although often described as predatory, the Bdellovibrionaceae may also be considered to be parasitic, as they typically depend (apart from host-independent strains that have been observed [60]) on the infection and death of their host for their reproduction (47).In this study, we examined predation among the myxobacteria, which are also deltaproteobacteria but constitute a monophyletic clade divergent from the Bdellovibrionaceae (17). Myxobacteria are found in most terrestrial soils and in many aquatic environments as well (17, 53, 74). Many myxobacteria, including the model species Myxococcus xanthus, exhibit several complex social traits, including fruiting body formation and spore formation (14, 18, 34, 62, 71), cooperative swarming with two motility systems (64, 87), and group (or “wolf pack”) predation on both bacteria and fungi (4, 5, 8, 9, 15, 50). Using representatives of the genus Myxococcus, we tested for both intra- and interspecific variation in myxobacterial predatory performance across a broad range of prey types. Moreover, we examined whether prey vary substantially in the degree to which they support predatory growth by the myxobacteria and whether patterns of variation in predator performance are constant or variable across prey environments. The latter outcome may reflect adaptive specialization and help to maintain diversity in natural populations (57, 59).Although closely related to the Bdellovibrionaceae (both are deltaproteobacteria), myxobacteria employ a highly divergent mode of predation. Myxobacteria use gliding motility (64) to search the soil matrix for prey and produce a wide range of antibiotics and lytic compounds that kill and decompose prey cells and break down complex polymers, thereby releasing substrates for growth (66). Myxobacterial predation is cooperative both in its “searching” component (6, 31, 82; for details on cooperative swarming, see reference 64) and in its “handling” component (10, 29, 31, 32), in which secreted enzymes turn prey cells into consumable growth substrates (56, 83). There is evidence that M. xanthus employs chemotaxis-like genes in its attack on prey cells (5) and that predation is stimulated by close contact with prey cells (48).Recent studies have revealed great genetic and phenotypic diversity within natural populations of M. xanthus, on both global (79) and local (down to centimeter) scales (78). Phenotypic diversity includes variation in social compatibility (24, 81), the density and nutrient thresholds triggering development (33, 38), developmental timing (38), motility rates and patterns (80), and secondary metabolite production (40). Although natural populations are spatially structured and both genetic diversity and population differentiation decrease with spatial scale (79), substantial genetic diversity is present even among centimeter-scale isolates (78). No study has yet systematically investigated quantitative natural variation in myxobacterial predation phenotypes across a large number of predator genotypes.Given the previous discovery of large variation in all examined phenotypes, even among genetically extremely similar strains, we anticipated extensive predatory variation as well. Using a phylogenetically broad range of prey, we compared and contrasted the predatory performance of 16 natural M. xanthus isolates, sampled from global to local scales, as well as the commonly studied laboratory reference strain DK1622 and representatives of three additional Myxococcus species: M. flavescens (86), M. macrosporus (42), and M. virescens (63) (Table (Table1).1). In particular, we measured myxobacterial swarm expansion rates on prey lawns spread on buffered agar (31, 50) and on control plates with no nutrients or with prehydrolyzed growth substrate.
Open in a separate window 相似文献
TABLE 1.
List of myxobacteria used, with geographical originOrganism abbreviation used in text | Species | Strain | Geographic origin | Reference(s) |
---|---|---|---|---|
A9 | Myxococcus xanthus | A9 | Tübingen, Germany | 78 |
A23 | Myxococcus xanthus | A23 | Tübingen, Germany | 78 |
A30 | Myxococcus xanthus | A30 | Tübingen, Germany | 78 |
A41 | Myxococcus xanthus | A41 | Tübingen, Germany | 78 |
A46 | Myxococcus xanthus | A46 | Tübingen, Germany | 78 |
A47 | Myxococcus xanthus | A47 | Tübingen, Germany | 78 |
A75 | Myxococcus xanthus | A75 | Tübingen, Germany | 78 |
A85 | Myxococcus xanthus | A85 | Tübingen, Germany | 78 |
TV | Myxococcus xanthus | Tvärminne | Tvärminne, Finland | 79 |
PAK | Myxococcus xanthus | Paklenica | Paklenica, Croatia | 79 |
MAD | Myxococcus xanthus | Madeira 1 | Madeira, Portugal | 79 |
WAR | Myxococcus xanthus | Warwick 1 | Warwick, UK | 79 |
TOR | Myxococcus xanthus | Toronto 1 | Toronto, Ontario, Canada | 79 |
SUL2 | Myxococcus xanthus | Sulawesi 2 | Sulawesi, Indonesia | 79 |
KAL | Myxococcus xanthus | Kalalau | Kalalau, HI | 79 |
DAV | Myxococcus xanthus | Davis 1A | Davis, CA | 79 |
GJV1 | Myxococcus xanthus | GJV 1 | Unknown | 35, 72 |
MXFL1 | Myxococcus flavescens | Mx fl1 | Unknown | 65 |
MXV2 | Myxococcus virescens | Mx v2 | Unknown | 65 |
CCM8 | Myxococcus macrosporus | Cc m8 | Unknown | 65 |
5.
6.
7.
Dione B. Rolim Marcos F. G. Rocha Raimunda S. N. Brilhante Rossana A. Cordeiro Natanael P. Leit?o-Junior Timothy J. J. Inglis José J. C. Sidrim 《Applied and environmental microbiology》2009,75(4):1215-1218
Melioidosis has been considered an emerging disease in Brazil since the first cases were reported to occur in the northeast region. This study investigated two municipalities in Ceará state where melioidosis cases have been confirmed to occur. Burkholderia pseudomallei was isolated in 26 (4.3%) of 600 samples in the dry and rainy seasons.Melioidosis is an endemic disease in Southeast Asia and northern Australia (2, 4) and also occurs sporadically in other parts of the world (3, 7). Human melioidosis was reported to occur in Brazil only in 2003, when a family outbreak afflicted four sisters in the rural part of the municipality of Tejuçuoca, Ceará state (14). After this episode, there was one reported case of melioidosis in 2004 in the rural area of Banabuiú, Ceará (14). And in 2005, a case of melioidosis associated with near drowning after a car accident was confirmed to occur in Aracoiaba, Ceará (11).The goal of this study was to investigate the Tejuçuoca and Banabuiú municipalities, where human cases of melioidosis have been confirmed to occur, and to gain a better understanding of the ecology of Burkholderia pseudomallei in this region.We chose as central points of the study the residences and surrounding areas of the melioidosis patients in the rural areas of Banabuiú (5°18′35″S, 38°55′14″W) and Tejuçuoca (03°59′20″S, 39°34′50′W) (Fig. (Fig.1).1). There are two well-defined seasons in each of these locations: one rainy (running from January to May) and one dry (from June to December). A total of 600 samples were collected at five sites in Tejuçuoca (T1, T2, T3, T4, and T5) and five in Banabuiú (B1, B2, B3, B4, and B5), distributed as follows (Fig. (Fig.2):2): backyards (B1 and T1), places shaded by trees (B2 and T2), water courses (B3 and T3), wet places (B4 and T4), and stock breeding areas (B5 and T5).Open in a separate windowFIG. 1.Municipalities of Banabuiú (5°18′35″S, 38°55′14″W) and Tejuçuoca (03°59′20″S, 39°34′50″W).Open in a separate windowFIG. 2.Soil sampling sites in Banabuiú and Tejuçuoca.Once a month for 12 months (a complete dry/rainy cycle), five samples were gathered at five different depths: at the surface and at 10, 20, 30 and 40 cm (Table (Table1).1). The samples were gathered according to the method used by Inglis et al. (9). Additionally, the sample processing and B. pseudomallei identification were carried out as previously reported (1, 8, 9).
Open in a separate windowaSites designated with B are in Banabuiú, and sites designated with T are in Tejuçuoca. See the text for details.The data on weather and soil composition were obtained from specialized government institutions, such as FUNCEME, IPECE, and EMBRAPA. The average annual temperature in both municipalities is between 26 and 28°C. In 2007, the annual rainfall in Tejuçuoca was 496.8 mm, and that in Banabuiú was 766.8 mm. There are a range of soil types in both Tejuçuoca and Banabuiú: noncalcic brown, sodic planossolic, red-yellow podzolic, and litholic. In Banabuiú, there are also alluvial and cambisol soils. The characteristic vegetation in both municipalities is caatinga (scrublands).There were isolates of B. pseudomallei in 26 (4.3%) of the 600 samples collected. The bacterium was isolated at a rate (3%) similar to that previously reported (9). The bacterium isolation occurred in both the dry (53.8%) and the rainy (46.2%) seasons. Tejuçuoca represented 76.9% (20/26) of the strains isolated. Four sites in Tejuçuoca (T1, T3, T4, and T5) and three in Banabuiú (B1, B2, and B4) presented isolates of the bacterium (Table (Table1).1). The isolation of the B. pseudomallei strains varied from the surface down to 40 cm. However, 17 of the 26 positive samples (65.3%) were found at depths between 20 and 40 cm (Table (Table1).1). Only two isolates were found at the surface during the dry season.A study in Vietnam (13) and one in Australia (9) reported the presence of B. pseudomallei near the houses of melioidosis patients. In our study, the same thing happened. Site T3 (15/26; 57.6%) was located 290 m from the patient''s house, as reported by the Rolim group (14).B. pseudomallei was isolated from a sheep paddock in Australia, where animals sought shelter below mango and fig trees (17). In our study, the bacterium was isolated at site T5, a goat corral alongside the house where the outbreak occurred in Tejuçuoca. Four sites in places shaded by trees yielded positive samples (30.7%) in both Tejuçuoca (palm trees) and Banabuiú (mango trees). Additionally, B. pseudomallei was isolated on three occasions from a cornfield (site 4B) located alongside the house of the melioidosis patient in Banabuiú.In the main areas of endemicity, the disease is more prevalent in the rainy season (4, 5, 16). The outbreak in Tejuçuoca was related to rainfall (14). Besides the association of cases of the disease with rainfall itself, the isolation of B. pseudomallei in soil and water was also demonstrated during the dry season (12, 15). An Australian study isolated strains from soil and water during the dry and rainy seasons (17). A Thai study also reported B. pseudomallei in the dry season (18). In our study, the isolation of B. pseudomallei took place either at the end of the wet season or in the dry months. Fourteen of the positive samples (53.8%) were collected during the dry season, albeit near a river or reservoir (sites T3 and B4).Physical, biological, and chemical soil features appear to influence the survival of B. pseudomallei (6, 10). In the present study, the soil was classified as litholic with sandy or clayey textures. It is susceptible to erosion, and when there is a lack of water, it is subject to salinization. During the dry season, the clay layer becomes dried, cracked, and very hard. During the rainy season, it becomes soggy and sticky. The isolation of B. pseudomallei in the dry season is possibly related to the capacity for adaptation of this soil, since the extreme conditions of lithosols do not prevent the bacterial growth and survival.It has been shown that B. pseudomallei is more often isolated at depths between 25 and 45 cm (17). In our study, 65.3% of the positive samples were taken at depths between 20 and 40 cm. Moreover, of these 17 samples, 10 (58.8%) were collected during the dry months. Also, unlike in other regions, two positive samples were taken from the surface in the period without rainfall.The rainfall in Tejuçuoca and Banabuiú is generally low, and temperatures do not vary significantly during the year. Therefore, the isolation of B. pseudomallei in these places occurs outside the rainfall, temperature, and moisture conditions observed in other regions of endemicity. Our data thus suggest that peculiar environmental features, such as soil composition, might favor the multiplication of B. pseudomallei in northeast Brazil. 相似文献
TABLE 1.
Distribution of samples with isolates by site and soil depthSitesa and depth (cm) | No. of B. pseudomallei isolates in samples from:
| ||
---|---|---|---|
Banabuiú (n = 300) | Tejuçuoca (n = 300) | Total (n = 600) | |
B1/T1 | 3 | ||
Surface | 2 | ||
10 | |||
20 | 1 | ||
30 | |||
40 | |||
B2/T2 | 1 | ||
Surface | 1 | ||
10 | |||
20 | |||
30 | |||
40 | |||
B3/T3 | 15 | ||
Surface | 2 | ||
10 | 2 | ||
20 | 4 | ||
30 | 3 | ||
40 | 4 | ||
B4/T4 | 5 | ||
Surface | |||
10 | 1 | ||
20 | 1 | ||
30 | 1 | 1 | |
40 | 1 | ||
B5/T5 | 2 | ||
Surface | |||
10 | |||
20 | |||
30 | 2 | ||
40 | |||
Total | 6 | 20 | 26 |
8.
9.
10.
11.
12.
13.
Todd J. Ward Thomas Usgaard Peter Evans 《Applied and environmental microbiology》2010,76(19):6680-6684
A 30-probe assay was developed for simultaneous classification of Listeria monocytogenes isolates by lineage (I to IV), major serogroup (4b, 1/2b, 1/2a, and 1/2c), and epidemic clone (EC) type (ECI, ECIa, ECII, and ECIII). The assay was designed to facilitate rapid strain characterization and the integration of subtype data into risk-based inspection programs.Listeria monocytogenes is a facultative intracellular pathogen that can cause serious invasive illness (listeriosis) in humans and other animals. L. monocytogenes is responsible for over 25% of food-borne-disease-related deaths attributable to known pathogens and is a leading cause of food recalls due to microbial adulteration (12, 21). However, not all L. monocytogenes subtypes contribute equally to human illness, and substantial differences in the ecologies and virulence attributes of different L. monocytogenes subtypes have been identified (9, 13, 14, 23, 24, 33, 35, 36). Among the four major evolutionary lineages of L. monocytogenes, only lineages I and II are commonly isolated from contaminated food and human listeriosis patients (19, 27, 29, 33). Lineage I strains are overrepresented among human listeriosis isolates, particularly those associated with epidemic outbreaks, whereas lineage II strains are overrepresented in foods and the environment (13, 14, 24). Lineage III strains account for approximately 1% of human listeriosis cases but are common among animal listeriosis isolates and appear to be a host-adapted group that is poorly adapted to food-processing environments (6, 34-36). The ecological and virulence attributes of lineage IV are poorly understood, as this lineage is rare and was only recently described based on a small number of strains (19, 26, 29, 33).L. monocytogenes is differentiated into 13 serotypes; however, four major serogroups (4b, 1/2b, 1/2a, and 1/2c) from within lineages I and II account for more than 98% of human and food isolates (16, 31). Serogroups refer to evolutionary complexes typified by a predominant serotype but which include very rare serotypes that represent minor evolutionary variants (7, 9, 33). Phylogenetic analyses have indicated that rare serotypes may have evolved recently, or even multiple times, from one of the major serotypes (9), and numerous molecular methods fail to discriminate minor serotypes as independent groups (1, 4, 7, 9, 18, 22, 33, 38, 39). Serotyping is one of the most common methods for L. monocytogenes subtyping, and serogroup classifications are a useful component of strain characterization because ecotype divisions appear largely congruent with serogroup distinctions (16, 34). Serogroup 4b strains are of particular public health concern because contamination with these strains appears to increase the probability that a ready-to-eat (RTE) food will be implicated in listeriosis (16, 28). Serogroup 4b strains account for approximately 40% of sporadic listeriosis and also are responsible for the majority of listeriosis outbreaks despite being relatively rare contaminants of food products (9, 13, 17, 30, 34). In addition, serogroup 4b strains are associated with more severe clinical presentations and higher mortality rates than other serogroups (11, 16, 20, 31, 34). Serogroups 1/2a and 1/2b are overrepresented among food isolates but also contribute significantly to human listeriosis, whereas serogroup 1/2c rarely causes human illness and may pose a lower risk of listeriosis for humans (16). Serogroup-specific differences in association with human listeriosis are consistent with the prevalence of virulence-attenuating mutations in inlA within these serogroups (32, 34); however, a number of additional factors likely contribute to these differences.Four previously described epidemic clones (ECs; ECI, ECIa, ECII, and ECIII) of L. monocytogenes have been implicated in numerous listeriosis outbreaks and have contributed significantly to sporadic illness (15, 34). ECI, ECIa, and ECII are distinct groups within serogroup 4b that were each responsible for repeated outbreaks of listeriosis in the United States and Europe. ECIII is a lineage II clone of serotype 1/2a that persisted in the same processing facility for more than a decade prior to causing a multistate outbreak linked to contaminated turkey (15, 25). While there has been speculation that epidemic clones possess unique adaptations that explain their frequent involvement in listeriosis outbreaks (9, 34, 37), it is not clear that epidemic clones are more virulent than other strains with the same serotype. However, contamination of RTE food with EC strains would be cause for increased concern due to the previous involvement of these clones in major outbreaks of listeriosis (16).As a result of the L. monocytogenes subtype-specific differences in ecology, virulence, and association with human illness, molecular subtyping technologies have the potential to inform assessments of relative risk and to improve risk-based inspection programs. The objective of the present study was to develop a single assay for rapid and accurate classification of L. monocytogenes isolates by lineage, major serogroup, and epidemic clone in order to facilitate strain characterization and the integration of subtype data into inspection programs that are based on assessment of relative risk.A database of more than 5.3 Mb of comparative DNA sequences from 238 L. monocytogenes isolates (9, 33-35) was scanned for single nucleotide polymorphisms that could be used to differentiate lineages, major serogroups, and epidemic clones via a targeted multilocus genotyping (TMLGT) approach. The acronym TMLGT is used to distinguish this approach from previously published multilocus genotyping (MLGT) assays that were lineage specific and designed for haplotype discrimination (9, 33). To provide for simultaneous interrogation of the selected polymorphisms via TMLGT, six genomic regions (Table (Table1)1) were coamplified in a multiplex PCR. While the previous MLGT assays were based on three lineage-specific multiplexes and required prior identification of lineage identity, TMLGT was designed to target variation across all of the lineages simultaneously and is based on a unique set of amplicons. PCR was performed in 50-μl volumes with 1× High Fidelity PCR buffer (Invitrogen Life Technologies), 2 mM MgSO4, 100 μM deoxynucleoside triphosphate (dNTP), 300 nM primer, 1.5 U Platinum Taq high-fidelity DNA polymerase (Invitrogen Life Technologies), and 100 ng of genomic DNA. PCR consisted of an initial denaturation of 90 s at 96°C, followed by 40 cycles of 30 s at 94°C, 30 s at 50°C, and 90 s at 68°C. Amplification products were purified using Montage PCR cleanup filter plates (Millipore) and served as a template for allele-specific primer extension (ASPE) reactions utilizing subtype-specific probes.
Open in a separate windowaCorresponding nucleotide positions in the complete genome sequence of L. monocytogenes strain EGD-e (GenBank accession number ).bSee IUPAC codes for definition of degenerate bases.ASPE was performed in multiplex reactions including 30 probes, with each lineage (I to IV), major serogroup (4b, 1/2b, 1/2a, and 1/2c), and epidemic clone (ECI, ECIa, ECII, and ECIII) targeted by two different probes (Table NC_003210(Table2).2). In addition, positive-control probes were included to confirm the presence of each amplicon in the multiplex PCR. As serogroups and epidemic clones are nested within a particular lineage, probes for these groups were designed to be specific within the appropriate lineage and values for these probes were evaluated only for isolates of the appropriate lineage. For example, serogroup 1/2a probes were evaluated only for isolates that were positive for lineage II probes. ASPE probes were designed with a unique 5′ sequence tag specific to individual sets of xMAP fluorescent polystyrene microspheres (Luminex Corporation) used to sort extension products. Extension and hybridization reactions were performed as described previously (9) except microspheres were twice pelleted by centrifugation (4 min at 2,250 × g) and resuspended in 75 μl 1× TM buffer prior to being pelleted and resuspended in 100 μl 1× TM buffer containing 2 μg/ml streptavidin-R-phycoerythrin (Invitrogen Life Technologies). Samples were incubated for 15 min at 37°C prior to detecting the microsphere complexes with a Luminex 100 flow cytometer (Luminex Corporation). The median fluorescence intensity (MFI) from biotinylated extension products attached to 100 microspheres was measured for each probe. The average MFI from three template-free control samples was also determined and subtracted from the raw MFI of each sample to account for background fluorescence. Probe performance was initially evaluated via the index of discrimination (ID) as described by Ducey et al. (9), and probes with ID values less than 2.0 were redesigned.
Open in a separate windowaNA, not applicable for positive amplicon control probes.bLuminex microsphere sets (Luminex Corporation) used for hybridization reactions are indicated following the hyphen.cn, number of isolates representing the target subtype among the 906 tested isolates.dThe 5′ sequence tag portions of extension probes are capitalized. See IUPAC codes for definitions of degenerate bases.eID, index of discrimination.Validation of the TMLGT assay was performed using 906 L. monocytogenes isolates for which the lineage, major serogroup, and epidemic clone type had been determined independently (see Table S1 in the supplemental material). A subset of 92 isolates, including at least five isolates from each lineage, serogroup, and epidemic clone type, was used to evaluate the discriminatory power of subtype-specific probes and the repeatability of the assay (see Table S1). Two independent runs of the 30-probe TMLGT assay produced identical results for these 92 isolates. In addition, genotypes matched expectations for all isolate/probe combinations, and the fluorescence intensities for positive genotypes (those targeted by a particular probe) were 3.8 to 58.3 (mean, 18.5) times as high as background values for isolates with negative genotypes (those not targeted by a particular probe) (Table (Table2).2). The performances of individual probes also were assessed in terms of sensitivity and specificity, where sensitivity is defined as the percentage of positive samples that produced positive results and specificity indicates the percentage of negative samples that produce negative results (5). Based on results from all 906 isolates analyzed by TMLGT, probe sensitivity was at least 98.6% and 23 of the 24 subtype-specific probes exhibited 100% sensitivity (Table (Table2).2). The specificities for all probes were also greater than 98.6%, and 21 of the 24 subtype-specific probes exhibited 100% specificity (Table (Table22).All but three of the 906 isolates in the validation panel were fully and accurately typed relative to lineage, serogroup, and epidemic clone by using the TMLGT assay (typeability, 99.9%; accuracy of isolate assignment, 99.8%). One of the lineage II isolates, NRRL B-33880, could not be assigned to a serogroup based on the TMLGT results because this isolate was positive for one of the serogroup 1/2a probes (VGCb-40) and one of the serogroup 1/2c probes (LMO-9). This isolate was previously identified as a member of serogroup 1/2c based on mapping lineage-specific MLGT data onto a multilocus phylogeny (34) but produced a serogroup 1/2a-specific banding pattern (data not shown) with the multiplex PCR assay described by Doumith et al. (7). Similar strains, including the common laboratory strain EGD-e, were found to have genomes that are more similar to serogroup 1/2c strains than to strains from the 1/2a serogroup (8, 33) and likely represent intermediates in the evolution of the 1/2c clade from 1/2a ancestors. There is a poor correlation between genomic and antigenic variation for such isolates (34), consistent with the ambiguous results produced by application of the TMLGT assay to NRRL B-33880. The two other problematic isolates, NRRL B-33555 and NRRL B-33559, were accurately identified based on TMLGT data as lineage II isolates from the 1/2a serogroup. However, these two isolates were positive for both ECIII-specific probes in the TMLGT assay but have lineage-specific MLGT haplotypes (Lm2.46), indicating that they are representatives of a sister group closely related to ECIII (33).In 2005, the Food Safety and Inspection Service (FSIS) implemented an approach to inspection that includes consideration of relative risk in order to determine L. monocytogenes sampling frequency among establishments that produce certain RTE products. This approach incorporates information on production volume, outgrowth potential in the product, steps taken to prevent postlethality contamination, and FSIS sampling history. However, L. monocytogenes subtype-specific variation in ecology and virulence indicates that information on the lineage, major serogroup, and epidemic clone identities of isolates could be used to inform assessments of relative risk and to improve inspection programs that are based on consideration of risk. Several PCR-based methods have been described for differentiation of various combinations of these subgroups (1-3, 5, 7, 10, 35, 37); however, these approaches have focused on a single subgroup or a smaller set of subgroups than is differentiated by TMLGT analysis. Although we previously developed a set of three MLGT assays that can be used to differentiate all of the major serogroups and epidemic clones of L. monocytogenes (9, 33, 34), those assays did not include probes for lineage discrimination and require identification of the lineage prior to application of one of three unique sets of probes. In addition, the MLGT assays were designed to maximize strain discrimination, as opposed to subgroup identification, and require the use of at least twice as many probes as is needed for TMLGT analysis. MLGT data analysis is also more complicated than analysis of TMLGT data, and serogroup or epidemic clone type identification via MLGT requires phylogenetic analyses to place novel haplotypes within an established phylogenetic framework.In the present study, we developed the first assay for simultaneous discrimination of the four lineages, the four major serogroups, and the four previously described epidemic clones of L. monocytogenes. The assay includes multiple markers for each of these subtype probes as well as control probes to ensure that negative probe data were not the result of amplification failure, providing a high degree of internal validation required for use in inspection programs that consider risk in making sampling decisions. In addition, the utility of the assay has been validated with a large and diverse panel of 906 isolates, including 567 isolates from FSIS surveillance of RTE products and processing facilities (see Table S1 in the supplemental material). Data produced by the TMLGT assay are amenable to high-throughput analysis, and a simple spreadsheet utility has been developed to semiautomate subtype identifications and to alert investigators to potentially conflicting probe data (available upon request). In addition to having a potential application in inspection programs, the TMLGT assay provides a rapid and accurate means of characterizing L. monocytogenes isolates from different environments, which would facilitate pathogen tracking and improve understanding of L. monocytogenes ecology. 相似文献
TABLE 1.
Primers used in multiplex amplification for the TMLGT assayAmplicon | Positiona | Gene(s) | Primer | Sequence (5′-3′)b |
---|---|---|---|---|
INLa | 455381-456505 | inlA | inl2-a1 | GTCCTTGATAGTCTACTG |
inl2-a2 | ACCAAATTAGTAATCTAGCAC | |||
INLb | 457726-458752 | inlB | inl-f1d | GAATTRTTTAGYCAAGAATGT |
inlb-r | CTACCGGRACTTTATAGTAYG | |||
LMO | 325116-326096 | lmo0298-lmo0300 | lmo-a1 | AAGGCTTACAAGATGGCT |
lmo1a-1r | AAATAATAYGTGATACCGAC | |||
VGCa | 205366-206622 | plcA, hly | plca-f | CTCATCGTATCRTGTGTACC |
hly-r | TCTGGAAGGTCKTGTAGGTTC | |||
VGCb | 208447-209465 | mpl | ra_mpl-f | GTGGAYAGAACTCATAAAGG |
ra_mpl-r | ACTCCCTCCTYGTGATASGCT | |||
VGCc | 209728-211239 | actA | vgc1a-2f | TTCMATRCCAGCAGAACG |
vgc1a-2r | GCAGACCTAATAGCAATGTTG |
TABLE 2.
TMLGT probes and probe performance dataProbeb | Target (n)c | Probe sequenced | IDe | Sensitivity (%) | Specificity (%) |
---|---|---|---|---|---|
VGCb-21 | Lineage I (506) | AATCCTTTCTTTAATCTCAAATCAgcggaagcttgggaagcggtc | 7.3 | 100 | 100 |
VGCa-94 | Lineage I | CTTTCTATCTTTCTACTCAATAATcaacccgatgttcttcctgtc | 51.7 | 100 | 100 |
VGCc-8 | Lineage II (340) | AATCCTTTTACATTCATTACTTACattagctgattcgctttcct | 14.1 | 100 | 100 |
INLb-51 | Lineage II | TCATTTCAATCAATCATCAACAATagcgccaataaagctggc | 21.9 | 100 | 100 |
VGCb-19 | Lineage III (50) | TCAATCAATTACTTACTCAAATACccgctattaaaatgtactcca | 31.0 | 100 | 100 |
VGCb-29 | Lineage III | AATCTTACTACAAATCCTTTCTTTggtataccgctattaaaatgt | 45.1 | 100 | 100 |
LMO-17 | Lineage IV (10) | CTTTAATCCTTTATCACTTTATCAgaaccaaacaatgttattggt | 11.8 | 100 | 100 |
VGCa-27 | Lineage IV | CTTTTCAAATCAATACTCAACTTTttaacgacggtaacgtgccac | 58.3 | 100 | 100 |
INLb-84 | Serogroup 4b (213) | TCAACTAACTAATCATCTATCAATggtaaaaatatgcgaatattg | 9.7 | 100 | 100 |
INLb-85 | Serogroup 4b | ATACTACATCATAATCAAACATCActcgtgaacaagctttcc | 5.5 | 100 | 100 |
INLb-16 | Serogroup 1/2b (293) | AATCAATCTTCATTCAAATCATCAggtaaaaatatgcgtatctta | 11.7 | 100 | 100 |
INLb-100 | Serogroup 1/2b | CTATCTTTAAACTACAAATCTAACgtgaataagctatcggtctat | 13.0 | 100 | 100 |
LMO-42 | Serogroup 1/2a (268) | CTATCTTCATATTTCACTATAAACtggcgttgctgrctaagtttg | 6.6 | 100 | 100 |
VGCb-40 | Serogroup 1/2a | CTTTCTACATTATTCACAACATTAaatcaagcsgctcatatgaag | 10.4 | 100 | 98.6 |
LMO-9 | Serogroup 1/2c (72) | TAATCTTCTATATCAACATCTTACtttactggtgaaatggcg | 13.5 | 100 | 100 |
VGCb-5 | Serogroup 1/2c | CAATTCAAATCACAATAATCAATCaagattacgaatcgcttccac | 20.8 | 98.6 | 100 |
LMO-10 | ECI (111) | ATCATACATACATACAAATCTACAatgattaaaagtcagggaaag | 19.0 | 100 | 100 |
LMO-28 | ECI | CTACAAACAAACAAACATTATCAAaatcgaggcttacgaacgt | 23.7 | 100 | 100 |
VGCc-80 | ECIa (44) | CTAACTAACAATAATCTAACTAACactacaacgaaaacagcgc | 10.7 | 100 | 100 |
VGCa-35 | ECIa | CAATTTCATCATTCATTCATTTCAgttacttttatgtcgagt | 9.2 | 100 | 100 |
LMO-12 | ECII (35) | TACACTTTCTTTCTTTCTTTCTTTataccgattatttggacggtt | 3.8 | 100 | 100 |
LMO-30 | ECII | TTACCTTTATACCTTTCTTTTTACgacttgtagcagttgatttcaa | 7.5 | 100 | 100 |
VGCc-45 | ECIII (10) | TCATTTCACAATTCAATTACTCAActcttatttgcttttgttggtc | 21.1 | 100 | 99.4 |
INLa-3 | ECIII | TACACTTTATCAAATCTTACAATCgagcttaatgaaaatcagcta | 17.0 | 100 | 99.4 |
INLa-1 | INLa control | CTTTAATCTCAATCAATACAAATCagaagtggaagctgggaa | NAa | NA | NA |
INLb-13 | INLb control | CAATAAACTATACTTCTTCACTAAtgcacctaaacctccgac | NA | NA | NA |
LMO-88 | LMO control | TTACTTCACTTTCTATTTACAATCccgtttccttatgccaca | NA | NA | NA |
VGCa-23 | VGCa control | TTCAATCATTCAAATCTCAACTTTcaagycctaagacgccaatcg | NA | NA | NA |
VGCb-25 | VGCb control | CTTTTCAATTACTTCAAATCTTCAgcatgcgttagttcatgrcca | NA | NA | NA |
VGCc-82 | VGCc control | TACATACACTAATAACATACTCATgactgcatgctagaatctaag | NA | NA | NA |
14.
15.
Yunhong Kong Maolong He Tim McAlister Robert Seviour Robert Forster 《Applied and environmental microbiology》2010,76(20):6933-6938
At present there is little quantitative information on the identity and composition of bacterial populations in the rumen microbial community. Quantitative fluorescence in situ hybridization using newly designed oligonucleotide probes was applied to identify the microbial populations in liquid and solid fractions of rumen digesta from cows fed barley silage or grass hay diets with or without flaxseed. Bacteroidetes, Firmicutes, and Proteobacteria were abundant in both fractions, constituting 31.8 to 87.3% of the total cell numbers. They belong mainly to the order Bacteroidales (0.1 to 19.2%), hybridizing with probe BAC1080; the families Lachnospiraceae (9.3 to 25.5%) and Ruminococcaceae (5.5 to 23.8%), hybridizing with LAC435 and RUM831, respectively; and the classes Deltaproteobacteria (5.8 to 28.3%) and Gammaproteobacteria (1.2 to 8.2%). All were more abundant in the rumen communities of cows fed diets containing silage (75.2 to 87.3%) than in those of cows fed diets containing hay (31.8 to 49.5%). The addition of flaxseed reduced their abundance in the rumens of cows fed silage-based diets (to 45.2 to 58.7%) but did not change markedly their abundance in the rumens of cows fed hay-based diets (31.8 to 49.5%). Fibrolytic species, including Fibrobacter succinogenes and Ruminococcus spp., and archaeal methanogens accounted for only a small proportion (0.4 to 2.1% and 0.2 to 0.6%, respectively) of total cell numbers. Depending on diet, between 37.0 and 91.6% of microbial cells specifically hybridized with the probes used in this study, allowing them to be identified in situ. The identities of other microbial populations (8.4 to 63.0%) remain unknown.The rumen is an anaerobic ecosystem used by herbivores to convert fibrous plant material into fermentation products that are in turn used as energy by the host. Fibrolytic degradation is accomplished by a complex microbial community which includes specialized fungi, protozoa, and bacteria (14). More than 200 bacterial species (5) have been isolated from rumen, and many of these have been phylogenetically and physiologically characterized. Several of these, including Fibrobacter succinogenes, Ruminococcus albus, and Ruminococcus flavefaciens, have the ability to hydrolyze cellulose in axenic culture (24). Despite the presence of these fibrolytic populations, a large portion of the fiber in low-quality forage diets passes through the rumen undigested. In the rumen, fibrolytic bacteria do not digest plant cell walls in isolation but rather interact with a consortium of bacteria (18). Although culture-dependent studies have improved our understanding of rumen microbiology, the importance of the isolates to the structure and function of the rumen microbial community, with the possible exception of the fibrolytic strains, is still unknown. Expanding our knowledge of the structure and function of the rumen microbial community may provide insights into approaches to improve the efficiency of fiber digestion and biofuel production (14).To provide a high-resolution view of the population structure of the rumen bacterial community, we used quantitative fluorescence in situ hybridization (qFISH) to investigate the composition and distribution of bacterial populations associated with the liquid and solid rumen contents from 12 ruminally cannulated Holstein dairy cows (3 cows were used for each diet) fed (for at least 21 days) grass hay or barley silage diets with or without flaxseed (Table (Table1).1). Six new 16S rRNA-targeted FISH probes (Table (Table2)2) for not only the fibrolytic groups but also other unclassified bacterial groups in the rumen were designed, using ARB software (17), against the rumen 16S rRNA gene sequences (data not shown) retrieved from the Ribosomal Database Project (RDP) database (6). The new probes target Bacteroidales-related clones (probe BAC1080) (phylum Bacteroidetes), Lachnospiraceae- and Ruminococcaceae-related clones (probes LAC435 and RUM831, respectively) (phylum Firmicutes), Butyrivibrio fibrisolvens-related clones (probe BFI826), and R. albus- and R. flavefaciens-related clones (probes RAL1436 and RFL155, respectively).
Open in a separate window
Open in a separate windowaThe numbers in parentheses after the probe names represent the probe accession numbers in probeBase (16).bFA, formamide concentration used in the FISH buffer.cThe optimum formamide concentration for the probe was determined in this study.The optimal formamide concentrations (OFC) of the new probes used in FISH were assessed in different ways. Probes RUM831 and BAC1080 were assessed by using pure cultures of Ruminococcus and Prevotella strains with zero and one mismatch (Fig. (Fig.1)1) to the probes. The OFC of probes LAC435 and BFI826 were assessed using Clone-FISH (21) with zero and one mismatch 16S rRNA clone (Fig. (Fig.1)1) by following the procedure described previously (9, 10). The highest formamide concentration (tested in 5% stepwise increases) at which a clear fluorescent signal was observed with the reference bacterium or competent cells with zero mismatches after FISH probing, but not with bacteria or competent cells with one mismatch, was selected. The OFC of probes FIB225 (designed by Stahl et al. [23]), RFL155, and RAL1436 were assessed using only pure cultures of F. succinogenes, R. flavefaciens, and R. albus, respectively, all having perfect matches to each probe (Fig. (Fig.1).1). The highest formamide concentration (tested in 5% stepwise increases) at which a clear fluorescent signal was observed with the reference bacterium after FISH probing was selected. These probes were employed with other available probes (Table (Table2)2) chosen from probeBase (16) based on the alignment and classification of the 16S rRNA gene sequences retrieved from rumen communities.Open in a separate windowFIG. 1.Alignments of the probe sequences and their target sites and sequences of corresponding sites in reference bacteria or clones. The probe names in parentheses after the abbreviated names are according to Oligonucleotide Probe Database nomenclature (2). Only the nucleotides that are different from target sequences are shown. E, empty space; R., Ruminococcus; P., Prevotella; F., Fibrobacter.The digest samples from the top, bottom, and middle of the rumen were collected through a cannula, thoroughly mixed, and fractioned as liquid fraction (LiqF) and solid fraction (SolF). On-site, about 100 ml was transferred to a heavy-wall 250-ml beaker and squeezed using a Bodum coffee maker plunger (Bodum Inc., Triengen, Switzerland). The extruded liquid samples (containing the planktonic cells) were fixed in ethanol and paraformaldehyde (PFA) for FISH probing (3). The remaining liquid was discarded, and the squeezed particulate samples (used to collect particulate-attached cells) were washed with 100 ml phosphate buffer (5.23 g/liter K2HPO4, 2.27 g/liter KH2PO4, 3.00 g/liter NaHCO3, and 20 ml/liter 2.5% cysteine HCl) by stirring gently with a spatula, followed by squeezing again and decanting. Washed particulate samples (5 g) were then fixed for FISH as described above.After fixation, the particulate samples plus the fixation solution were transferred into a stomacher bag and “stomached” (Stomacher 400 Circulator, Seaward England) at 230 rpm for 6 min. Treated samples were then transferred into a clean 250-ml beaker and squeezed again. Microscopic examination of the squeezed residues after DAPI (4′,6-diamidino-2-phenylindole) staining (100 μl [0.003 mg/ml] for 10 min) showed only a few bacterial cells attached on the plant fibers, indicating that most bacterial cells had been “stomached” into the liquid (data not shown). To recover cells, filtrates were centrifuged (5,000 × g), and the cell pellet was washed three times with phosphate buffer before being used for FISH probing. On the day of sampling, each cow was sampled twice, at 1100 h and 1600 h. The liquid FISH samples obtained from the 3 cows fed with the same diet (at two different sampling times) were mixed, as were the particulate FISH samples, and used in qFISH analysis. FISH was carried out according to Amann (3). FISH was carried out on glass coverslips (24 by 60 mm) coated with gelatin (9). DAPI staining of biomass samples was carried out after FISH probing. FISH and DAPI images were captured with a Zeiss epifluorescence microscope (Zeiss PM III) equipped with a Canon 5D Mark II camera. Raw images captured randomly were transferred into gray TIF images and sharpened in Adobe Photoshop CS3. Cells stained with DAPI and hybridized to the probes were enumerated using the function provided in ImageJ (1). The percent compositions of these probe-defined groups (against all DAPI-stained cells in the same microscopic field) in the different fractions of rumen contents from cows fed different diets are presented in Table Table33.
Open in a separate windowaThe two numbers represent the mean value (%) and the standard deviation of individual probe-defined microbial groups in a specified rumen digest fraction, which were calculated based on 3 mean values, each consisting of 20 enumerations.bThe numbers represent the sum of percentages of all individual probe-defined microbial groups in a specified rumen digest fraction. The percentages obtained with FISH probes RAL1436, RFL155, and BFI826 were not counted in the sum because the bacterial cells hybridizing with the former two probes also hybridized with RUM831, and the bacterial cells hybridizing with the last probe also hybridized with probe LAC435.cThe numbers represent the percentages of microorganisms which were not identified by FISH in a specified rumen digest fraction.We provided quantitative data by using qFISH to show that Bacteroidetes, Firmicutes, and Proteobacteria were abundant in both the LiqF and the SolF, constituting 31.8 to 87.3% of the total cell numbers. These FISH data add weight to the view that Firmicutes and Bacteroidetes might be dominant in rumens, as suggested previously from their high ratios retrieved from 16S rRNA clone libraries (e.g., see references 12, 26, and 27). However, information emerging from 16S rRNA gene clone library data cannot be used to reach conclusions on the quantitative composition of the rumen bacterial community. Bacteria may have 1 to 14 copies of rRNA genes, and several biases are known to be associated with their PCR amplification (8).These 3 dominant bacterial groups have been identified at a high-resolution level. They belong mainly to the order Bacteroidales (0.1 to 19.2%), hybridizing with probe BAC1080 (Fig. (Fig.22 A); the families Lachnospiraceae (9.3 to 25.5%) and Ruminococcaceae (5.5 to 23.8%), hybridizing with LAC435 (Fig. (Fig.2E)2E) and RUM831 (Fig. (Fig.2D),2D), respectively; and the classes Deltaproteobacteria (5.8 to 28.3%) and Gammaproteobacteria (1.2 to 8.2%), hybridizing with SRBmix (equal moles of SRB385 and SRB385Db) (Fig. (Fig.2C)2C) and GAM42a (Fig. (Fig.2B),2B), respectively. All were more abundant in the microbial communities in the rumens of cows fed diets containing silage (75.2 to 87.3%) than in those in the rumens of cows fed diets containing hay (31.8 to 49.5%). These results show how diets containing different forages (hay or silage) may influence the distribution of the microbial populations, which is in line with data by Tajima et al. (25). We also found in this study that the addition of flaxseed (to inhibit methane emission) reduced their abundance in the rumens of cows fed silage-based diets (to 45.2 to 58.7%) but did not change markedly their abundance in the rumens of cows fed hay-based diets (31.8 to 49.5%), suggesting that adding flaxseed to these diets also affected rumen microbial community composition, although the extent of its influence reflected the forage used, being more profound with a silage-based diet than when hay was used.Open in a separate windowFIG. 2.Images of digest samples from the rumens of cows fed hay- or silage-based diets with and without flaxseed after color combination. Images from probes are labeled in red, and those from DAPI staining are in green. The yellow (combination of red and green), including those partly colored cells in panels A to F, hybridized with probes BAC1080, GAM42a, SRBmix, RUM831, LAC435, and ARCH915, respectively. A few cells (arrows) hybridizing with SRBmix (C) were not stained by DAPI. Bars, 10 μm.We also present evidence here to suggest that Proteobacteria are common members of the microbial community, with sulfur-reducing bacteria (SRB) belonging to Deltaproteobacteria in particular being readily detected (up to 28% of the total cells) in both the LiqF and the SolF of rumen contents from cows fed the four different diets examined here. SRB have seldom been retrieved in clone libraries obtained from rumen samples. Lin et al. (15) have estimated SRB abundance in the rumen using DNA hybridization and concluded that they were of minor importance (0.7 to 0.8% of the total rRNA). Our estimates are much higher than those for every diet regime examined, possibly reflecting the coverage of the probes used in the two different studies. The probe mixture SRBmix used here targets most members of the Deltaproteobacteria, while those of Lin et al. (15) covered mainly members of the Desulfobacteraceae, Desulfovibrionaceae, and Desulfobulbaceae. We also recognized that the probe mixture SRBmix perfectly matched with the 16S rRNA genes of some bacteria other than SRB in Deltaproteobacteria. The possibility of overestimation of SRB cannot be ruled out. Interestingly, our data suggest that Gammaproteobacteria were abundant in some of the rumen communities we examined by FISH, comprising 1.2 to 8.2% of total cells.The other unexpected finding was that the fibrolytic bacteria and archaeal methanogens accounted for only a minor fraction of the communities. Of the three characterized fibrolytic bacterial species, F. succinogenes was not detected in the rumen digesta from cattle fed the hay-based diet but was present in the remainder of the diets. In contrast, R. albus and R. flavefaciens were present in both the LiqF and the SolF of the rumen digesta from cows fed all four diets. Although the importance of these bacteria within the rumen microbial community cannot be denied, these three populations accounted for only 0.7 to 2.1% of the total microbial cells. This numerical range compares well with that determined previously for F. succinogenes (0.1 to 6.9% of total rRNA) (4, 23) and Ruminococcus spp. (1.5 to 2.9% of total rRNA) (11), considering that different animals and diets were used in those studies and that different specificities of the probes and different detection methods were used. However, this is much lower than the 9% (of total rRNA) detected by Michalet-Doreau et al. (19) in their work. The abundance of fibrolytic B. fibrisolvens-related species was also low, being present at <1% in all fractions, except in the LiqF in cows fed the mixture of silage and flaxseed, where they contributed 2.4% of total cells.Methanogens hybridized to ARCH915 (Fig. (Fig.2F)2F) were present (0.1 to 0.6%) in all rumen samples examined by FISH, which is close to or within the range (0.3 to 3.3%) estimated in other studies (15, 22). Interestingly, no marked difference in abundance of the methanogens could be seen between the samples from the rumens of cows fed diets with flaxseed and those from the rumens of cows fed diets without flaxseed, although it has been reported (7) that the addition of fatty acids could decrease methane production in the rumen. This may be due to the presence of methanogens with different activities in different rumen samples or the inability of probe ARCH915 to hybridize to all methanogens in the rumen samples examined here.Bacteria belonging to Chloroflexi, TM7, Spirochetes, and Actinobacteria hybridizing with CHLmix, TM7-905, SPRO1400, and HGC69a, respectively, accounted for only a minor fraction of the total cell numbers observed. In most cases, their abundances in each fraction did not change markedly with diet, always being present in small numbers (0 to 1%), suggesting that they have a minor role there. This conclusion, however, has to be confirmed since many (8.4 to 63.0%, depending on diet) of the bacteria could not be identified in the rumens of cows fed with all diets except the silage-based diet (Table (Table33).FISH with the probes designed in this study failed to identify all of the bacterial cells. This is because the probes do not target all rumen 16S rRNA gene sequences and/or the true extent of rumen biodiversity has not been revealed from cloning analyses. This indicates that our current understanding of the quantitative composition of the rumen microbial community is far from complete. Moreover, no physiological data were generated in this study to suggest what the role(s) of most of the dominant populations (except the SRB hybridized with probe SRBmix) identified by FISH might be, meaning that it is still not possible to link their abundance to their in situ function. Furthermore, each FISH-probed population probably includes bacteria with different phenotypes. Clearly, much needs to be done before the structure and function of the rumen microbial community are fully understood.FISH is a useful tool in the investigation of microbial composition in complex ecosystems (3). However, FISH probes targeting rumen bacterial populations are limited. By comparison with other culture-independent methods, e.g., quantitative PCR, FISH has several advantages (8). In particular, in combination with histochemical staining methods (20) and microautoradiography (MAR-FISH) (13), the in situ ecophysiology of a targeted population can be determined under specified electron acceptor conditions. These techniques may provide important clues as to the functional role of microbial populations within complex communities, like that of the rumen. The possession of the FISH probes described in this paper could allow such studies to be undertaken in herbivore rumens. 相似文献
TABLE 1.
Composition of diets used in this studyIngredient | Diet composition (% dry weight) | |||
---|---|---|---|---|
Hay-based diet | Hay and flaxseed diet | Silage-based diet | Silage and flaxseed diet | |
Alfalfa grass hay (chopped) | 47.5 | 47.5 | 0 | 0 |
Barley silage | 0 | 0 | 47.5 | 47.5 |
Steamed rolled barley grain | 47.5 | 32.5 | 47.5 | 32.5 |
Ground flaxseeds | 0 | 15 | 0 | 15 |
Other | 5 | 5 | 5 | 5 |
TABLE 2.
Oligonucleotide probes and their target populations used in this study for FISH analysesProbe namea | Target rRNA | Designed target(s) | % FAb | Reference |
---|---|---|---|---|
EUB338 (00159) | 16S | Domain Bacteria | 0-50 | 16 |
EUB338II (00160) | 16S | Phylum Planctomycetes | 0-50 | 16 |
EUB338III (00161) | 16S | Phylum Verrucomicrobia | 0-50 | 16 |
NONEUB (00243) | 16S | Control probe complementary to EUB338 | 0-50 | 16 |
ALF968 (00021) | 16S | Class Alphaproteobacteria, phylum Proteobacteria | 20 | 16 |
BET42a (00034) | 23S | Class Betaproteobacteria, phylum Proteobacteria | 35 | 16 |
GAM42a (00174) | 23S | Class Gammaproteobacteria, phylum Proteobacteria | 35 | 16 |
SRB385 (00300) | 16S | Class Deltaproteobacteria, phylum Proteobacteria | 35 | 16 |
SRB385Db (00301) | 16S | Class Deltaproteobacteria, phylum Proteobacteria | 35 | 16 |
HGC69a (00182) | 23S | Phylum Actinobacteria | 25 | 16 |
GNSB941 (00718) | 16S | Phylum Chloroflexi | 35 | 16 |
CFX1223 (00719) | 16S | Phylum Chloroflexi | 35 | 16 |
SPIRO1400 (01004) | 16S | Subgroup of family Spirochaetaceae | 20 | 16 |
TM7-905 (00600) | 16S | Candidate phylum TM7 | 20 | 16 |
LGC354A (00195) | 16S | Phylum Firmicutes | 35 | 16 |
LGC354B (00196) | 16S | Phylum Firmicutes | 35 | 16 |
LGC354C (00197) | 16S | Phylum Firmicutes | 35 | 16 |
RUM831 | 16S | Rumen clones in family Ruminococcaceae, phylum Firmicutes | 35 | This study |
RAL1436 | 16S | Ruminococcus albus-related clones, phylum Firmicutes | 20 | This study |
RFL155 | 16S | Ruminococcus flavefaciens-related clones, phylum Firmicutes | 45 | This study |
LAC435 | 16S | Clones in family Lachnospiraceae, phylum Firmicutes | 35 | This study |
BFI826 | 16S | Butyrivibrio fibrisolvens-related clones, phylum Firmicutes | 35 | This study |
BAC1080 | 16S | Clones in order Bacteroidales, phylum Bacteroidetes | 20 | This study |
Fibr225 (00005) | 16S | Fibrobacter succinogenes-related clones, phylum Fibrobacteres | 20c | 16 |
ARCH915 (00027) | 16S | Domain Archaea | 20 | 16 |
TABLE 3.
Distribution and composition of FISH probe-defined groups in rumen microbial communities in cows fed with different dietsProbe-defined microbial group | Composition (mean value [%] ± SD)a | |||||||
---|---|---|---|---|---|---|---|---|
Hay-based diet | Hay and flaxseed diet | Silage-based diet | Silage and flaxseed diet | |||||
LiqF | SolF | LiqF | SolF | LiqF | SolF | LiqF | SolF | |
BAC1080 | 9.6 ± 1.33 | 0.1 ± 0.02 | 19.2 ± 3.71 | 4.2 ± 0.72 | 14.2 ± 3.11 | 18.8 ± 3.88 | 14.4 ± 2.89 | 16.7 ± 4.33 |
ALF968 | 0.2 ± 0.02 | 0.2 ± 0.02 | 0.2 ± 0.03 | 0.2 ± 0.04 | 0.7 ± 0.14 | 1.5 ± 0.41 | 0.1 ± 0.01 | 0.1 ± 0.01 |
BET42a | 0 | 0 | 0.6 ± 0.01 | 1.2 ± 0.27 | 0.1 ± 0.01 | <0.1 | 0.4 ± 0.06 | 0.2 ± 0.04 |
GAM42a | 3.2 ± 0.53 | 4.4 ± 0.57 | 4.2 ± 0.76 | 4.5 ± 0.67 | 2.0 ± 0.32 | 1.2 ± 0.23 | 8.2 ± 1.23 | 5.3 ± 0.95 |
SRBmix | 5.8 ± 0.88 | 11.6 ± 2.43 | 9.0 ± 1.52 | 10.1 ± 2.56 | 28.3 ± 4.43 | 23.3 ± 4.54 | 7.7 ± 0.78 | 13.2 ± 2.22 |
CHLmix | 1.7 ± 0.27 | 0 | 0.5 ± 0.01 | 0 ± 0 | 0.2 ± 0.02 | 0.4 ± 0.07 | 0.1 ± 0.01 | 0.1 ± 0.02 |
SPIRO1400 | 0.5 ± 0.09 | 1.9 ± 0.32 | 1.7 ± 0.33 | 2.0 ± 0.21 | 1.4 ± 0.31 | 1.9 ± 0.33 | 0.4 ± 0.03 | 0.4 ± 0.07 |
TM7-905 | 0.6 ± 0.08 | 0.8 ± 0.07 | 0.5 ± 0.01 | 0.1 ± 0.03 | 1.5 ± 0.23 | 0.2 ± 0.02 | 0.6 ± 0.02 | 0.3 ± 0.08 |
HGC69a | 1.3 ± 0.28 | 2.1 ± 0.31 | 0.3 ± 0.06 | 0.3 ± 0.05 | 0.4 ± 0.03 | 0.1 ± 0.02 | 0.5 ± 0.09 | 0.2 ± 0.02 |
RUM831 | 5.5 ± 0.13 | 5.7 ± 0.89 | 5.8 ± 0.73 | 8.9 ± 1.32 | 18.0 ± 4.13 | 23.8 ± 3.11 | 5.6 ± 1.14 | 7.4 ± 1.32 |
RAL1436 | 0.4 ± 0.06 | 0.3 ± 0.03 | 0.2 ± 0.06 | 0.2 ± 0.03 | 0.3 ± 0.05 | 0.6 ± 0.09 | 0.7 ± 0.13 | 0.6 ± 0.12 |
RFL155 | 0.7 ± 0.11 | 0.2 ± 0.03 | 0.3 ± 0.07 | 0.7 ± 0.19 | 0.1 ± 0.01 | 0.8 ± 0.11 | 0.5 ± 0.06 | 1.2 ± 0.34 |
LAC435 | 25.5 ± 3.98 | 10.0 ± 1.51 | 9.6 ± 1.31 | 11.7 ± 1.67 | 12.6 ± 2.56 | 20.2 ± 3.23 | 9.3 ± 1.51 | 16.1 ± 3.31 |
BFI826 | 0.3 ± 0.06 | 0.4 ± 0.05 | 0.4 ± 0.06 | 0.7 ± 0.12 | 0.5 ± 0.05 | 0.3 ± 0.08 | 2.4 ± 0.37 | 0.2 ± 0.02 |
Fibr225 | 0 | 0 | 0.2 ± 0.04 | 0.1 ± 0.02 | 0.8 ± 0.14 | 0.7 ± 0.14 | 0.4 ± 0.11 | 0.1 ± 0.04 |
ARCH915 | 0.3 ± 0.08 | 0.2 ± 0.07 | 0.6 ± 0.01 | 0.3 ± 0.07 | 0.6 ± 0.09 | 0.1 ± 0.02 | 0.4 ± 0.05 | 0.4 ± 0.06 |
Total hybridizedb | 54.1 | 37 | 52.4 | 43.7 | 80.9 | 91.6 | 48 | 60.7 |
Otherc | 45.9 | 63 | 47.6 | 56.3 | 19.1 | 8.4 | 52 | 39.3 |
16.
17.
Jochen K. Lennerz Jonathan B. Hurov Lynn S. White Katherine T. Lewandowski Julie L. Prior G. James Planer Robert W. Gereau IV David Piwnica-Worms Robert E. Schmidt Helen Piwnica-Worms 《Molecular and cellular biology》2010,30(21):5043-5056
Par-1 is an evolutionarily conserved protein kinase required for polarity in worms, flies, frogs, and mammals. The mammalian Par-1 family consists of four members. Knockout studies of mice implicate Par-1b/MARK2/EMK in regulating fertility, immune homeostasis, learning, and memory as well as adiposity, insulin hypersensitivity, and glucose metabolism. Here, we report phenotypes of mice null for a second family member (Par-1a/MARK3/C-TAK1) that exhibit increased energy expenditure, reduced adiposity with unaltered glucose handling, and normal insulin sensitivity. Knockout mice were protected against high-fat diet-induced obesity and displayed attenuated weight gain, complete resistance to hepatic steatosis, and improved glucose handling with decreased insulin secretion. Overnight starvation led to complete hepatic glycogen depletion, associated hypoketotic hypoglycemia, increased hepatocellular autophagy, and increased glycogen synthase levels in Par-1a−/− but not in control or Par-1b−/− mice. The intercrossing of Par-1a−/− with Par-1b−/− mice revealed that at least one of the four alleles is necessary for embryonic survival. The severity of phenotypes followed a rank order, whereby the loss of one Par-1b allele in Par-1a−/− mice conveyed milder phenotypes than the loss of one Par-1a allele in Par-1b−/− mice. Thus, although Par-1a and Par-1b can compensate for one another during embryogenesis, their individual disruption gives rise to distinct metabolic phenotypes in adult mice.Cellular polarity is a fundamental principle in biology (6, 36, 62). The prototypical protein kinase originally identified as a regulator of polarity was termed partitioning defective (Par-1) due to early embryonic defects in Caenorhabditis elegans (52). Subsequent studies revealed that Par-1 is required for cellular polarity in worms, flies, frogs, and mammals (4, 17, 58, 63, 65, 71, 89). An integral role for Par-1 kinases in multiple signaling pathways has also been established, and although not formally addressed, multifunctionality for individual Par-1 family members is implied in reviews of the list of recognized upstream regulators and downstream substrates (Table (Table1).1). Interestingly, for many Par-1 substrates the phosphorylated residues generate 14-3-3 binding sites (25, 28, 37, 50, 59, 61, 68, 69, 78, 95, 101, 103). 14-3-3 binding in turn modulates both nuclear/cytoplasmic as well as cytoplasmic/membrane shuttling of target proteins, thus allowing Par-1 activity to establish intracellular spatial organization (15, 101). The phosphorylation of Par-1 itself promotes 14-3-3 binding, thereby regulating its subcellular localization (37, 59, 101).
Open in a separate windowaLKB1 also is known as Par-4; MARKK also is known as Ste20-like; (−), inhibitory/negative regulation has been shown; GPCR, G protein-coupled receptors. MARKK is highly homologous to TAO-1 (thousand-and-one amino acid kinase) (46).The mammalian Par-1 family contains four members (Table (Table2).2). Physiological functions of the Par-1b kinase have been studied using targeted gene knockout approaches in mice (9, 44). Two independently derived mouse lines null for Par-1b have implicated this protein kinase in diverse physiological processes, including fertility (9), immune system homeostasis (44), learning and memory (86), the positioning of nuclei in pancreatic beta cells (35, 38), and growth and metabolism (43).
TABLE 1.
Multifunctionality of Par-1 polarity kinase pathwaysaRegulator or substrate | Function | Reference(s) |
---|---|---|
Regulators (upstream function) | ||
LKB1 | Wnt signaling, Peutz-Jeghers syndrome, insulin signal transduction, pattern formation | 2, 63, 93 |
TAO1 | MEK3/p38 stress-responsive mitogen-activated protein kinase (MAPK) pathway | 46 |
MARKK | Nerve growth factor signaling in neurite development and differentiation | 98 |
aPKC | Ca2+/DAG-independent signal transduction, cell polarity, glucose metabolism | 14, 37, 40, 45, 59, 75, 95 |
nPKC/PKD | DAG-dependent, Ca2+-independent signal transduction (GPCR) | 101 |
PAR-3/PAR-6/aPKC | (−); regulates Par-1, assembly of microtubules, axon-dendrite specification | 19 |
GSK3β | (−); tau phosphorylation, Alzheimer''s dementia, energy metabolism, body patterning | 54, 97 |
Pim-1 oncogene | (−); G2/M checkpoint, effector of cytokine signaling and Jak/STAT(3/5) | 5 |
CaMKI | (−); Ca2+-dependent signal transduction, neuronal differentiation | 99 |
Substrates (downstream function) | ||
Cdc25C | Regulation of mitotic entry by activation of the cdc2-cyclin B complex | 25, 72, 78, 103 |
Class II HDAC | Control of gene expression and master regulator of subcellular trafficking | 28, 50 |
CRTC2/TORC2 | Gluconeogenesis regulator via LKB1/AMPK/TORC2 signaling, PPARγ1a coactivator | 49 |
Dlg/PSD-95 | Synaptogenesis and neuromuscular junction, tumor suppressor (102) | 104 |
Disheveled | Wnt signaling, translocation of Dsh from cytoplasmic vesicles to cortex | 73, 94 |
KSR1 | Regulation of the Ras-MAPK pathway | 68, 69 |
MAP2/4/TAU | Dynamic instability (67, 83) of microtubules, Alzheimer''s dementia (30) | 11, 31-33, 47, 70, 96 |
Mib/Notch | Mind bomb (Mib degradation and repression of Notch signaling results in neurogenesis) | 57, 74, 81 |
Par3/OSKAR/Lgl | Cytoplasmic protein segregation, cell polarity, and asymmetric cell division | 7, 10 |
Pkp2 | Desmosome assembly and organization; nuclear shuttling | 68, 69 |
PTPH1 | Linkage between Ser/Thr and Tyr phosphorylation-dependent signaling | 103 |
Rab11-FIP | Regulation of endocytosis (23), trafficking of E-cadherin (64) | 34 |
TABLE 2.
Terminology and localization of mammalian Par-1 family membersOpen in a separate windowaPar should not to be confused with protease-activated receptor 1 (PAR1 [29]); C-TAK1, Cdc twenty-five C-associated kinase 1; MARK, microtubule affinity regulating kinase; MARKL, MAP/microtubule affinity-regulating kinase-like 1.bBasolateral to a lesser degree than Par-1b (37).cHuman KP78 is asymmetrically localized to the apical surface of epithelial cells (76).dVariant that does not show asymmetric localization in epithelial cells when overexpressed (95).Beyond Par-1b, most information regarding the cell biological functions of the Par-1 kinases comes from studies of Par-1a. Specifically, Par-1a has been implicated in pancreatic (76) and hepatocarcinogenesis (51), as well as colorectal tumors (77), hippocampal function (100), CagA (Helicobacter pylori)-associated epithelial cell polarity disruption (82), and Peutz-Jeghers syndrome (48), although the latter association has been excluded recently (27). As a first step toward determining unique and redundant functions of Par-1 family members, mice disrupted for a second member of the family (Par-1a/MARK3/C-TAK1) were generated. We report that Par-1a−/− mice are viable and develop normally, and adult mice are hypermetabolic, have decreased white and brown adipose tissue mass, and unaltered glucose/insulin handling. However, when challenged by a high-fat diet (HFD), Par-1a−/− mice exhibit resistance to hepatic steatosis, resistance to glucose intolerance, and the delayed onset of obesity relative to that of control littermates. Strikingly, overnight starvation results in a complete depletion of glycogen and lipid stores along with an increase in autophagic vacuoles in the liver of Par-1a−/− but not Par-1b−/− mice. Correspondingly, Par-1a−/− mice develop hypoketotic hypoglycemia. These findings reveal unique metabolic functions of two Par-1 family members. 相似文献18.
Pablo I. Nikel Andrea M. Giordano Alejandra de Almeida Manuel S. Godoy M. Julia Pettinari 《Applied and environmental microbiology》2010,76(22):7400-7406
The effect of eliminating d-lactate synthesis in poly(3-hydroxybutyrate) (PHB)-accumulating recombinant Escherichia coli (K24K) was analyzed using glycerol as a substrate. K24KL, an ldhA derivative, produced more biomass and had altered carbon partitioning among the metabolic products, probably due to the increased availability of carbon precursors and reducing power. This resulted in a significant increase of PHB and ethanol synthesis and a decrease in acetate production. Cofactor measurements revealed that cultures of K24K and K24KL had a high intracellular NADPH content and that the NADPH/NADP+ ratio was higher than the NADH/NAD+ ratio. The ldhA mutation affected cofactor distribution, resulting in a more reduced intracellular state, mainly due to a further increase in NADPH/NADP+. In 60-h fed-batch cultures, K24KL reached 41.9 g·liter−1 biomass and accumulated PHB up to 63% ± 1% (wt/wt), with a PHB yield on glycerol of 0.41 ± 0.03 g·g−1, the highest reported using this substrate.Poly(3-hydroxybutyrate) (PHB) is the best-known and most common polyhydroxyalkanoate (PHA). PHAs are polymers with thermoplastic properties that are totally biodegradable by microorganisms present in most environments and that can be produced from different renewable carbon sources (38). Accumulated as intracellular granules by many bacteria under unfavorable conditions (1, 21), PHAs are carbon and energy reserves and also act as electron sinks, enhancing the fitness and stress resistance of bacteria and contributing to redox balance (12, 30). Escherichia coli offers a well-defined physiological environment for the construction and manipulation of various metabolic pathways to produce different bioproducts, such as PHB, from cost-effective carbon sources.In recent years, a significant increase in the production of biodiesel has caused a sharp fall in the cost of glycerol, the main by-product of biodiesel synthesis. As a result, glycerol has become a very attractive substrate for bacterial fermentations (10), specially for reduced products, such as PHB (36). The E. coli strain used in this work, K24K, carries phaBAC, the structural genes responsible for PHB synthesis, from Azotobacter sp. strain FA8 (23) (Table (Table1).1). The pha genes in K24K are expressed from a chimeric promoter and consequently are not subject to the genetic regulatory systems present in natural PHA producers. Because of this, it can be assumed that regulation of PHA synthesis in the recombinants is restricted by enzyme activity levels, modulated principally by substrate availability. In most natural producers, and also in PHB-producing E. coli recombinants, PHB is synthesized through the condensation of two molecules of acetyl-coenzyme A (acetyl-CoA), catalyzed by an acetoacetyl-CoA transferase or 3-ketothiolase, resulting in acetoacetyl-CoA. This compound is subsequently reduced by an NAD(P)H-dependent acetoacetyl-CoA reductase to R-(−)-3-hydroxybutyryl-CoA, which is then polymerized by a specific PHA synthase (34).
Open in a separate windowaStrain obtained through the E. coli Genetic Stock Center, Yale University, New Haven, CT.bFor oligonucleotides, the ATG codon of ldhA is underlined and the sequences with homology to FRT-kan-FRT in the template plasmid pKD4 (11) are shown in boldface.Cells growing on glycerol are in a more reduced intracellular state than cells grown on glucose under similar conditions of oxygen availability. This has a significant effect on the intracellular redox state, which causes the cells to direct carbon flow toward the synthesis of more-reduced products when glycerol is used than when glucose is used in order to achieve redox balance (31). When metabolic product distribution was analyzed in bioreactor cultures of K24K using glucose or glycerol as the substrate, product distributions with the two substrates were found to be different, as glycerol-grown cultures produced smaller amounts of acetate, lactate, and formate and more ethanol than those grown on glucose. However, PHB production from glycerol was lower than that from glucose, except under conditions of low oxygen availability (13).Manipulations to enhance the synthesis of a metabolic product include several approaches to increase the availability of the substrates needed for its formation or to inhibit competing pathways. The effect of eliminating competing pathways on PHB production from glucose has been investigated through the inactivation of different genes, such as those encoding enzymes participating in the synthesis of acetate (ackA, pta, and poxB) or d-lactate (ldhA). A pta mutant, which produces very little acetate (6), and an frdA ldhA double mutant (40) had increased PHB accumulation from glucose. A recent report using an ackA pta poxB ldhA adhE mutant under microaerobic conditions attained similar results (17). The inactivation of ldhA has also been shown to have an important effect on the metabolic product distribution in recombinant E. coli with glycerol as the carbon source, promoting ethanol synthesis (28). In the present work we analyzed the effect of ldhA inactivation in strain K24K using glycerol as the carbon source, with special emphasis on changes in carbon distribution and in the intracellular redox state, determined through cofactor levels. 相似文献
TABLE 1.
E. coli strains, plasmids, and oligonucleotides used in this studyStrain, plasmid, or oligonucleotide | Relevant characteristicsb | Reference or source |
---|---|---|
E. coli strains | ||
K1060a | F−fadE62 lacI60 tyrT58(AS) fabB5 mel-1 | 29 |
K24 | Same as K1060, carrying pJP24; Apr | 23 |
K24K | Same as K1060, carrying pJP24K; Apr Kmr | 23 |
ALS786a | F− λ−rph-1 ΔldhA::kan; Kmr | 14 |
K24LT | Same as K1060 but ΔldhA::kan by K1060 × P1(ALS786), carrying pJP24; Apr Kmr | This work |
K24KL | Same as K1060 but ΔldhA by allelic replacement, carrying pJP24K; Kmr | This work |
TA3522a | F− λ− Δ(his-gnd)861 hisJo-701 | 2 |
TA3514a | Same as TA3522 but pta-200 | 19 |
TA3522L | Same as TA3522 but ΔldhA::kan by TA3522 × P1(ALS786); Kmr | This work |
TA3514L | Same as TA3514 but ΔldhA::kan by TA3514 × P1(ALS786); Kmr | This work |
Plasmids | ||
pQE32 | Expression vector, ColE1 ori; Apr | Qiagen GmbH, Hilden, Germany |
pJP24 | pQE32 derivative expressing a 4.3-kb BamHI-HindIII insert containing the phaBAC genes from Azotobacter sp. strain FA8 under the control of a T5 promoter/lac operator element; Apr | 23 |
pJP24K | pJP24 derivative; Apr Kmr | 23 |
pCP20 | Helper plasmid used for kan excision; Saccharomyces cerevisiae FLP λ cI857 λ PRrepA(Ts); Apr Cmr | 7 |
Oligonucleotides | ||
ΔldhA-F | 5′-TAT TTT TAG TAG CTT AAA TGT GAT TCA ACA TCA CTG GAG AAA GTC TTA TGG TGT AGG CTG GAG CTG CTT C-3′ | This work |
ΔldhA-R | 5′-CTC CCC TGG AAT GCA GGG GAG CGG CAA GAT TAA ACC AGT TCG TTC GGG CAC ATA TGA ATA TCC TCC TTA G-3′ | This work |
19.
Hassan Rashidi Muhammad T. Akhtar Frank van der Kooy Robert Verpoorte Wouter A. Duetz 《Applied and environmental microbiology》2009,75(22):7135-7141
The microbial biotransformation of Δ9-tetrahydrocannabinol was investigated using a collection of 206 alkane-degrading strains. Fifteen percent of these strains, mainly gram-positive strains from the genera Rhodococcus, Mycobacterium, Gordonia, and Dietzia, yielded more-polar derivatives. Eight derivatives were produced on a mg scale, isolated, and purified, and their chemical structures were elucidated with the use of liquid chromatography-mass spectrometry, 1H-nuclear magnetic resonance (1H-NMR), and two-dimensional NMR (1H-1H correlation spectroscopy and heteronuclear multiple bond coherence). All eight biotransformation products possessed modified alkyl chains, with hydroxy, carboxy, and ester functionalities. In a number of strains, β-oxidation of the initially formed C5 carboxylic acid led to the formation of a carboxylic acid lacking two methylene groups.Δ9-Tetrahydrocannabinol (Δ9-THC) is the decarboxylated product of the corresponding Δ9-THC acid, the major cannabinoid present in the cannabis plant (Cannabis sativa L., Cannabaceae). This compound is officially registered as a drug for the stimulation of appetite and antiemesis in patients under chemotherapy and human immunodeficiency virus therapy regimens. Other biological activities ascribed to this compound include lowering intraocular pressure in glaucoma, acting as an analgesic for muscle relaxation, immunosuppression, sedation, bronchodilation, and neuroprotection (11).Δ9-THC and many of its derivatives are highly lipophilic and poorly water soluble. Calculations of the n-octanol/water partition coefficient (Ko/w) of Δ9-THC at neutral pH vary between 6,000, using the shake flask method (15), and 9.44 × 106, by reverse-phase high-performance liquid chromatography estimation (19). The poor water solubility and high lipophilicity of cannabinoids cause their absorption across the lipid bilayer membranes and fast elimination from blood circulation. In terms of the “Lipinsky rule of 5” (14), the high lipophilicity of cannabinoids hinders the further development of these compounds into large-scale pharmaceutical products.To generate more water-soluble analogues, one can either apply de novo chemical synthesis (as, e.g., in reference 16) or modify naturally occurring cannabinoids, e.g., by introducing hydroxy, carbonyl, or carboxy groups. Chemical hydroxylation of compounds such as cannabinoids is difficult (Δ9-THC is easily converted into Δ8-THC under mild conditions), and therefore microbial biotransformation of cannabinoids is potentially a more fruitful option to achieve this goal.So far, studies on biotransformation of Δ9-THC were mainly focused on fungi, which led to the formation of a number of mono- and dihydroxylated derivatives. Previous reports on the biotransformation of cannabinoids by various microorganisms are summarized in Table Table1.1. The aim of the present study was to test whether bacterial strains are capable of transforming Δ9-THC into new products (with potentially better pharmaceutical characteristics) at a higher yield and specificity than previously found for fungal strains. For this purpose, we have chosen to use a collection of alkane-degrading strains, since it was shown in previous studies (8, 18, 20) that alkane oxygenases often display a broad substrate range. Production of novel cannabinoid derivatives that might have interesting pharmacological activities was another objective of this project.
Open in a separate windowaCBD, cannabidiol; CBN, cannabinol. 相似文献
TABLE 1.
Previous biotransformation experiments conducted using various microorganisms to transform cannabinoidsCannabinoid(s)a | Microorganism(s) used | No. of transformed products | Reference |
---|---|---|---|
Δ9-THC | Cunninghamella blakesleeana | 6 | 3 |
Δ8-THC | Pellicularia filamentosa | 4 | 21 |
Δ8-THC | Streptomyces lavendulae | 4 | 21 |
Δ6a,10a-THC | 400 cultures (soil microorganisms) | Various | 1 |
Nabilone | 400 cultures (soil microorganisms) | Various | 1 |
Δ6a,10a-THC | 358 cultures containing bacteria, actinomycetes, and molds | 3 | 10 |
Δ9-THC, Δ8-THC, CBD, CBN | Syncephalastrum racemosum, Mycobacterium rhodochrous | Various | 17 |
Δ9-THC | Chaetomium globosum | 3 | 7 |
Δ9-THC | 51 fungal strains | 8 | 4 |
Nabilone | Microbes | Various | 2 |
Δ9-THC | Fusarium nivale, Gibberella fujikuroi, and Thamnidium elegans | 8 | 5 |
20.
Ana Roque Carmen Lopez-Joven Beatriz Lacuesta Laurence Elandaloussi Sariqa Wagley M. Dolores Furones Imanol Ruiz-Zarzuela Ignacio de Blas Rachel Rangdale Bruno Gomez-Gil 《Applied and environmental microbiology》2009,75(23):7574-7577
Presented here is the first report describing the detection of potentially diarrheal Vibrio parahaemolyticus strains isolated from cultured bivalves on the Mediterranean coast, providing data on the presence of both tdh- and trh-positive isolates. Potentially diarrheal V. parahaemolyticus strains were isolated from four species of bivalves collected from both bays of the Ebro delta, Spain.Gastroenteritis caused by Vibrio parahaemolyticus has been reported worldwide, though only sporadic cases have been reported in Europe (7, 14). The bacterium can be naturally present in seafood, but pathogenic isolates capable of inducing gastroenteritis in humans are rare in environmental samples (2 to 3%) (15) and are often not detected (10, 19, 20).The virulence of V. parahaemolyticus is based on the presence of a thermostable direct hemolysin (tdh) and/or the thermostable direct hemolysin-related gene (trh) (1, 5). Both are associated with gastrointestinal illnesses (2, 9).Spain is not only the second-largest producer in the world of live bivalve molluscs but also one of the largest consumers of bivalve molluscs, and Catalonia is the second-most important bivalve producer of the Spanish Autonomous Regions. Currently, the cultivation of bivalves in this area is concentrated in the delta region of the Ebro River. The risk of potentially pathogenic Vibrio spp. in products placed on the market is not assessed by existing legislative indices of food safety in the European Union, which emphasizes the need for a better knowledge of the prevalence of diarrheal vibrios in seafood products. The aim of this study was to investigate the distribution and pathogenic potential of V. parahaemolyticus in bivalve species exploited in the bays of the Ebro delta.Thirty animals of each species of Mytilus galloprovincialis, Crassostrea gigas, Ruditapes decussatus, and Ruditapes philippinarum were collected. They were sampled from six sites of the culture area, three in each bay of the Ebro River delta, at the beginning (40°37′112"N, 0°37′092"E [Alfacs]; 40°46′723"N, 0°43′943"E [Fangar]), middle (40°37′125"N, 0°38′570"E [Alfacs]; 40°46′666"N, 0°45′855"E [Fangar]), and end (40°37′309"N, 0°39′934"E [Alfacs]; 40°46′338"N, 0°44′941"E [Fangar]) of the culture polygon. Clams were sampled from only one site per bay as follows: in the Alfacs Bay from a natural bed of R. decussatus (40°37′44"N, 0°38′0"E) and in the Fangar Bay from an aquaculture bed of R. philippinarum (40°47′3"N, 0°43′8"E). In total, 367 samples were analyzed in 2006 (180 oysters, 127 mussels, 30 carpet shell clams, and 30 Manila clams) and 417 samples were analyzed in 2008 (178 oysters, 179 mussels, 30 carpet shell clams, and 30 Manila clams).All animals were individually processed and homogenized, and 1 ml of the homogenate was inoculated into 9 ml of alkaline peptone water (Scharlau, Spain). Following a 6-h incubation at 37°C, one loopful of the contents of each tube of alkaline peptone water was streaked onto CHROMagar vibrio plates (CHROMagar, France) and incubated for 18 h at 37°C. Mauve-purple colonies were purified, and each purified isolate was cryopreserved at −80°C (135 isolates in 2006 and 96 in 2008). From the initial homogenate portion, 100 μl was inoculated onto marine agar (Scharlau, Spain) and onto thiosulfate citrate-bile salts-sucrose agar (Scharlau, Spain) for total heterotrophic marine bacteria counts and total vibrio counts, respectively (Table (Table11).
Open in a separate windowaMg, Mytilus galloprovincialis; Cg, Crassostrea gigas; Rd, Ruditapes decussatus; Rp, R. phillipinarum; A, Alfacs; F, Fangar; ND, not determined; TCBS, thiosulfate citrate-bile salts-sucrose.Total DNA was extracted from each purified isolate using the Wizard genomic DNA purification kit (Promega), following the instructions of the manufacturer. A one-step PCR analysis was performed to identify/confirm which isolates were tl positive (species marker for V. parahaemolyticus). Further detection of the tdh or trh gene was carried out on all positive tl strains. All PCR analyses were carried out using the primers described by Bej et al. (2) with the following amplification conditions on the thermocycler (Eppendorf Mastercycler Personal): an initial denaturation at 95°C for 8 min, followed by 40 cycles of a 1-min denaturation at 94°C, annealing at 55°C for 1 min, elongation at 72° for 1 min, and a final extension of 10 min at 72°C. Positive and negative controls were included in all reaction mixtures: two positive controls, tl and tdh CAIM 1400 and trh CAIM 1772 (Collection of Aquatic Important Microorganisms [http://www.ciad.mx/caim/CAIM.html]), and negative control DNA-free molecular grade water (Sigma-Aldrich, Spain). Expected amplicons were visualized in 2% agarose gels stained with ethidium bromide.Fifty-eight isolates contained the gene tl in 2006 and 96 in 2008, which confirmed their identity as V. parahaemolyticus. In 2006, the distribution of the 58 isolates was as follows: 7 from 127 mussels, 34 from 180 oysters, and 17 from 30 R. decussatus clams. No tl-positive isolates were found in R. philippinarum. PCR analysis of the tl-positive isolates for the presence of the tdh or trh gene indicated that eight isolates contained the tdh gene and four contained the trh gene. In 2008, the source of the confirmed V. parahaemolyticus isolates was as follows: 31 from 88 oysters, 44 from 89 mussels, 9 from 30 R. decussatus clams, and 12 from 30 R. philippinarum clams. Of these, 17 were found to contain the tdh gene and 7 contained the trh gene. Two isolates (I806 and I1042) contained both toxigenic genes, tdh and trh.Putative tdh- and trh-positive PCR products were purified using the QIAquick PCR purification kit (Qiagen) following the manufacturer''s instructions and were sequenced bidirectionally by Macrogen Inc. Sequences were aligned using BioEdit (8) and analyzed using BLAST (National Center for Biotechnology Information). None of the toxigenic isolates was found positive by PCR analysis for the presence of open reading frame 8 of the phage 237 (16), a marker for the pandemic strain O3:K6.The isolates were fingerprinted by repetitive extragenic palindromic PCR (rep-PCR) as described previously (3), and the resulting electrophoretic band patterns were analyzed with the GelCompar II software (v4.5; Applied Maths). The similarity matrix was calculated with the Jaccard coefficient with a band position tolerance of 0.8%, and the dendrogram was constructed with the Ward algorithm. A high level of genomic diversity was found among the 32 toxigenic isolates characterized by rep-PCR. Three clonal groups were identified (those having identical rep-PCR band patterns) (Fig. 1a to c).Open in a separate windowFIG. 1.rep-PCR dendrogram of toxigenic isolates of V. parahaemolyticus isolated in the Ebro delta. Letters denote clonal groups of isolates.In vitro antibiotic susceptibility tests were performed using the diffusion disc test following a previously described protocol (18). The antibiotics used were gentamicin (10 μg), oxolinic acid (10 μg), amoxicillin (25 μg), polymyxin B (300 UI), vancomycin (30 μg), trimethoprim sulfamethoxazole (1.25/23.75 μg), nitrofurantoin (300 μg), doxycyclin (30 μg), ceftazidime (30 μg), streptomycin (10 μg), neomycin (30 UI), penicillin (6 μg), flumequine (30 μg), tetracycline (30 μg), ampicillin (10 μg), kanamycin (30 μg), ciprofloxacin (5 μg), and sulfonamide (300 μg). All tests were performed in duplicate. A Student t test for two samples with unequal variance was performed to compare the sensitivity of all 2006 isolates against the sensitivity of 2008 isolates for each antibiotic (Microsoft Office Excel 97-2003). Antibiogram results revealed a lower susceptibility in 2008 than in 2006, indicating a possible shift in overall susceptibility. Results from the t test indicated that significantly lower susceptibility in 2008 was detected (P ≤ 0.05; n = 36) for the following antibiotics: vancomycin, polymyxin B, ampicillin, amoxicillin, gentamicin, neomycin, trimethoprim sulfamethoxazole, nitrofurantoin, doxycyclin, ceftazidime, tetracycline, flumequine, and ciprofloxacin.The serological types for 27 strains were determined by the agglutination method using commercially available V. parahaemolyticus antisera (Denka Seiken Ltd.; Cosmos Biomedical Ltd, United Kingdom) following the manufacturer''s instructions. Potentially toxigenic V. parahaemolyticus isolates collected in 2006 were serologically heterogeneous (8 out of the 11 isolates) (Table (Table1).1). In isolates collected in 2008, results were more homogenous, with seven serotypes found among 19 isolates analyzed. The O3:K6 serotype was not detected in any of the strains analyzed, in agreement with the open reading frame 8 PCR results.The present study is the first to report the detection of potentially diarrheal V. parahaemolyticus strains isolated from cultured bivalves on Spanish Mediterranean coasts, providing data on the presence of both tdh- and trh-positive isolates. V. parahaemolyticus has previously been detected in several European countries (4, 13, 21, 22). A recent study carried out in Spain detected tdh-positive V. parahaemolyticus strains from patients who had consumed fresh oysters in a market in Galicia on the Atlantic coast of Spain (12) and potentially pathogenic V. parahaemolyticus strains have also been reported in France (17). These studies indicate that the risk of infections caused by V. parahaemolyticus in Europe is low compared to that in America or Asia (15). However, this risk could have been underestimated, since V. parahaemolyticus is not included in the current European surveillance programs, such as the European Network for Epidemiological Surveillance and Control of Communicable Diseases.Toxigenic V. parahaemolyticus strains detected in this study were genomically and serologically heterogeneous. The pandemic serotype O3:K6 was not detected, and although attempts to isolate O3:K6 from the environment and from seafood have not always been successful in previous studies reviewed by Nair and coauthors (15), this finding seems to be in agreement with the fact that no outbreak of diarrhea was observed in the area. Interestingly, isolates I806 and I1042 have been found positive for both tdh and trh in PCR tests. The coexistence of tdh and trh genes has already been reported in isolates from Japan, the United States, and Mexico (3, 6, 11, 19, 23). To our knowledge, no occurrence of an environmental isolate positive for both tdh and trh had previously been reported in Europe. All isolates tested were slightly different in their antibiotic resistance profiles. Typically, a high level of resistance could be determined. The detection of tdh- and/or trh-positive V. parahaemolyticus strains for the first time on the Mediterranean coast emphasizes the need to monitor for the presence of potentially diarrheal vibrios and bacterial gastroenteritis, and these data should be taken into consideration to revise the European legislation on the requirements for shellfish harvested for consumption in order to include the surveillance of these pathogens in Europe. 相似文献
TABLE 1.
Vibrio parahaemolyticus isolates, serotypes, and origins and total number of vibrios/heterotrophic bacteria contained in the bivalveaIsolate | Date of collection | Organism and site of origin | Temp (°C) | Salinity (‰) | Gene(s) | Serotype | Bacterial count using indicated medium (CFU ml−1) | |
---|---|---|---|---|---|---|---|---|
TCBS agar | Marine agar | |||||||
I745 | 8 August 2006 | Mg-F | 24.5 | 37 | tdh | ND | 1.5 × 104 | 1.2 × 104 |
I793 | 14 August 2006 | Cg-A | 25 | 35 | tdh | ND | 9.2 × 102 | 8.5 × 103 |
I805 | 14 August 2006 | Cg-A | 25 | 35 | tdh | O2:KUT | 7.2 × 102 | 9 × 103 |
I806 | 14 August 2006 | Cg-A | 25 | 35 | tdh and trh | O3:K33 | 1.9 × 103 | 4.6 × 103 |
I809 | 14 August 2006 | Cg-A | 25 | 35 | tdh | O2:K28 | 8 × 104 | 7.3 × 102 |
I678 | 4 July 2006 | Rd-A | 28.6 | 36 | tdh | O2:K28 | 3.1 × 105 | 2.5 × 105 |
I628 | 4 July 2006 | Rd-A | 28.6 | 36 | tdh | O4:KUT | 2.9 × 104 | 8.4 × 104 |
I775 | 8 August 2006 | Cg-A | 24.5 | 37 | tdh | ND | 4.21 × 103 | 1.1 × 104 |
I691 | 4 July 2006 | Rd-A | 28.6 | 36 | trh | O1:K32 | 2.2 × 105 | 2.6 × 105 |
I712 | 27 July 2006 | Mg-A | 29.4 | 35.5 | trh | O1:KUT | 8.6 × 103 | 8.4 × 103 |
I765 | 8 August 2006 | Cg-F | 24.5 | 37 | trh | O4:K34 | 1 × 104 | Uncountable |
I980 | 22 July 2008 | Cg-A | 26.7 | 33.5 | tdh | O1:K32 | 2.7 × 104 | 1.3 × 104 |
I981 | 22 July 2008 | Cg-A | 26.7 | 33.5 | trh | O1:KUT | 1 × 104 | 2.2 × 104 |
I993 | 22 July 2008 | Cg-A | 26.7 | 33.5 | tdh | O5:K17 | 3 × 103 | 1.1 × 104 |
I994 | 29 July 2008 | Mg-A | 27.7 | 37 | trh | O3:KUT | 3.4 × 103 | 7 × 103 |
I1031 | 5 August 2008 | Cg-F | 27.7 | 37 | tdh | O5:KUT | 5.5 × 104 | 3.3 × 104 |
I1034 | 5 August 2008 | Cg-F | 27.7 | 37 | tdh | O3:KUT | 8.7 × 104 | 4 × 104 |
I1040 | 5 August 2008 | Cg-F | 27.7 | 37 | tdh | O3:KUT | 1.6 × 104 | 3.2 × 104 |
I1042 | 5 August 2008 | Cg-F | 27.7 | 37 | tdh and trh | ND | 2.8 ×104 | 3 × 104 |
I1050 | 5 August 2008 | Cg-F | 27.7 | 37 | tdh | O1:KUT | 4.7 × 104 | 7.3 × 104 |
I1063 | 20 August 2008 | Mg-F | 25.9 | 36 | tdh | O3:KUT | 7.9 ×104 | 1.4 × 104 |
I1065 | 20 August 2008 | Mg-F | 25.9 | 36 | tdh | O2:KUT | 2.2 × 103 | 1.2 × 104 |
I1068 | 20 August 2008 | Mg-F | 25.9 | 36 | tdh | O5:KUT | 2.6 × 104 | 5.2 × 104 |
I1069 | 20 August 2008 | Mg-F | 25.9 | 36 | tdh | O3:KUT | 2.4 × 103 | 5.3 × 104 |
I1073 | 20 August 2008 | Mg-F | 25.9 | 36 | tdh | O5:KUT | 2.3 × 103 | 7.5 × 103 |
I1074 | 20 August 2008 | Mg-F | 25.9 | 36 | tdh | O3:KUT | 7.6 × 104 | 6.9 × 104 |
I1077 | 20 August 2008 | Mg-F | 25.9 | 36 | tdh | O4:KUT | 1.7 × 103 | 1.6 × 103 |
I1079 | 20 August 2008 | Mg-F | 25.9 | 36 | trh | O3:KUT | 2.5 × 103 | 1.1 × 104 |
I1092 | 20 August 2008 | Mg-F | 25.9 | 36 | tdh | ND | 1.7 × 103 | 1.6 × 103 |
I1130 | 25 August 2008 | Rd-A | 26.4 | 35 | tdh | ND | 1.7 × 104 | 3.8 × 104 |
I1143 | 25 August 2008 | Rd-A | 26.4 | 35 | tdh | ND | 1.1 × 104 | 1.9 × 104 |
I1165 | 25 August 2008 | Rd-A | 26.4 | 35 | trh | O2:KUT | 4.4 × 104 | 6.8 × 104 |
I1133 | 25 August 2008 | Rp-F | 25.5 | 36.5 | tdh | ND | 3.4 × 104 | 4 × 104 |
I1134 | 25 August 2008 | Rp-F | 25.5 | 36.5 | tdh | ND | 3.9 × 104 | 5.8 × 104 |
I1158 | 25 August 2008 | Rp-F | 25.5 | 36.5 | trh | O4:KUT | 6.6 × 104 | 4.7 × 104 |
I1161 | 25 August 2008 | Rp-F | 25.5 | 36.5 | trh | O3:KUT | 2.2 × 104 | 6.6 × 104 |