Evidence for involvement of 5-hydroxytryptamine(1B) autoreceptors in the enhancement of serotonin turnover in the mouse brain following repeated treatment with fluoxetine

The effect of repeated treatment with the selective serotonin reuptake inhibitor fluoxetine on synthesis and turnover of 5-hydroxytryptamine (5-HT) was studied in the mouse brain in vivo. The concentration of 5-hydroxytryptophan (5-HTP), 5-hydroxyindoleacetic acid (5-HIAA) and 5-HT was measured in hypothalamus, hippocampus and frontal cortex after inhibition of the aromatic amino acid decarboxylase activity with m-hydroxybenzylhydrazine (NSD 1015). Fluoxetine 6.9 mg/kg s.c. was injected once daily for three weeks. Three days after the final daily injection of fluoxetine 5-HT synthesis (5-HTP accumulation) and turnover (5-HIAA/5-HT ratio) were significantly enhanced compared with saline-treated mice. The 5-HIAA/5-HT ratio was already significantly elevated after 3 days of fluoxetine treatment and continued to increase during treatment for 2-3 weeks. The increase in 5-HIAA/5-HT ratio was considerably larger (150-200% of controls) than the increase in 5-HTP accumulation (110-120%), which reached significance only after 3 weeks of treatment. The increase in 5-HT synthesis may be secondary to that of the turnover. The 5-HIAA/5-HT ratio returned to control values after a 14 days washout period. Simultaneous treatment with the long-acting 5-HT(1B)-receptor antagonist, SB 224289 for 14 days counteracted the fluoxetine-induced increase in 5-HIAA/5-HT ratio that indicates involvement of 5-HT(1B) autoreceptors in the development of this increase. It is proposed that the fluoxetine-induced enhancement of 5-HT turnover was evoked by the long-lasting stimulation of 5-HT(1B) autoreceptors that resulted in an intraneuronal compensatory adaptation of the basal 5-HT release.     

Inhibition of protein synthesis by the cordycepin analog of (2'-5')ppp(Ap)nA, (2'-5')ppp(3'dAp)n3'dA, in intact mammalian cells

The introduction of the cordycepin analog of (2'-5')An, (2'-5')ppp(3'dAp)n3'dA [referred to as (2'-5')p33'dAn], into mouse L929 cells and cultured human fibroblasts resulted in a dose-dependent inhibition of protein synthesis which was comparable to the inhibition observed by (2'-5')ppp(Ap)nA [referred to as (2'-5')p3An]. The inhibition of protein synthesis by (2'-5')p33'dAn was much more persistent than that of the naturally occurring (2'-5')p3An following prolonged incubation of cells. Furthermore, the (2'-5')p3An was cytotoxic to mammalian cells in culture, whereas the (2'-5')p33'dAn was not.     

The protein SET binds the neuronal Cdk5 activator p35nck5a and modulates Cdk5/p35nck5a activity.

The neuronal Cdk5 kinase is composed of the catalytic subunit Cdk5 and the activator protein p35(nck5a) or its isoform, p39(nck5ai). To identify novel p35(nck5a)- and p39(nck5ai)-binding proteins, fragments of p35(nck5a) and p39(nck5ai) were utilized in affinity isolation of binding proteins from rat brain homogenates, and the isolated proteins were identified using mass spectrometry. With this approach, the nuclear protein SET was shown to interact with the N-terminal regions of p35(nck5a) and p39(nck5ai). Our detailed characterization showed that the SET protein formed a complex with Cdk5/p35(nck5a) through its binding to p35(nck5a). The p35(nck5a)-interacting region was mapped to a predicted alpha-helix in SET. When cotransfected into COS-7 cells, SET and p35(nck5a) displayed overlapping intracellular distribution in the nucleus. The nuclear co-localization was corroborated by immunostaining data of endogenous SET and Cdk5/p35(nck5a) from cultured cortical neurons. Finally, we demonstrated that the activity of Cdk5/p35(nck5a), but not that of Cdk5/p25(nck5a), was enhanced upon binding to the SET protein. The tail region of SET, which is rich in acidic residues, is required for the stimulatory effect on Cdk5/p35(nck5a).     

Analogues of ribose 5-phosphate and 5-phosphoribosyl pyrophosphate. The preparation and properties of ribose 5-phosphorothioate and 5-phosphoribosyl 1-methylenediphosphonate

1. 5-Phosphoribosyl 1-methylenediphosphonate was isolated after reaction of ribose 5-phosphate and O-adenylyl methylenediphosphonate with 5-phosphoribosyl pyrophosphate synthetase from Ehrlich ascites-tumour cells. 2. The analogue reacted with adenine phosphoribosyltransferase, hypoxanthine phosphoribosyltransferase and nicotinamide phosphoribosyltransferase [K(m) (analogue)/K(m) (5-phosphoribosyl pyrophosphate) 0.17, 0.19 and 6.3 respectively; V(max.) (analogue)/V(max.) (5-phosphoribosyl pyrophosphate) 0.011, 0.26 and 1.1 respectively]. 3. The analogue was not a substrate for 5-phosphoribosyl pyrophosphate amidotransferase or orotate phosphoribosyltransferase. 4. Ribose 5-phosphorothioate was synthesized by allowing ribose to react with thiophosphoryl chloride in triethyl phosphate. The analogue was a substrate for 5-phosphoribosyl pyrophosphate synthetase from Ehrlich ascites-tumour cells. When this reaction was coupled to either adenine phosphoribosyltransferase or hypoxanthine phosphoribosyltransferase, adenosine 5'-phosphorothioate or inosine 5'-phosphorothioate was formed respectively.     

DNA triplex formation of oligonucleotide analogues consisting of linker groups and octamer segments that have opposite sugar-phosphate backbone polarities

The DNA oligomer analogues 3'd(CTTTCTTT)5'-P4-5'd(TTCTTCTT)3' (IV), 5'd-(TTTCTTTC)3'-P2-3'd(CTTTCTTT)5' (V), and 5'd(TTTCTTTC)3'-P2-3'd(CTTTCTTT)5'-P4-5'd-(TTCTTCTT)3' (VI) (P2 = P*P and P4 = P*P*P*P, where P = phosphate and * = 1,3-propanediol) have been synthesized. These oligomers consist of a linker group or groups and homopyrimidine oligonucleotides which have opposite sugar-phosphate backbone polarities. These oligomer analogues are designed to form triplexes with a duplex, 5'd(AAAGAAAGCCCTTTCTTTAAGAAGAA)3'.5'd(TTCTTCTTAAA- GAAAGGGCTTTCTTT)3' (I), which contains small homopurine clusters alternately located in both strands. The length of the linker groups, P2 and P4, was based upon a computer modeling analysis. Triplex formation by the unlinked octamers 5'd(TTCTTCTT)3' (II) and 5'd(TTTCTTTC)3' (III) and the linked oligomer analogues IV-VI with the target duplex was studied by thermal denaturation at pH 5.2. The order of stabilities of triplex formation by these oligomers was I-V much much greater than I-IV greater than I-(II, III). The mixture of I and VI showed two transitions corresponding to the dissociation of the third strand. The higher transition corresponded to the dissociation of 3'-3'-linked octamer segments, and the lower one corresponded to the dissociation of 5'-5'-linked octamer segments. The Tm of the latter transition was higher than that of the I-IV triplex; thus the triplex formed by the 5'-5'-linked octamer segment was stabilized by the triplex formed by the 3'-3'-linked octamer segments in the I-VI triplex. Triplex formation of this system was also studied in the presence of ethidium bromide.(ABSTRACT TRUNCATED AT 250 WORDS)     

Effects of 5-hydroxytryptamine on cat spinal motoneurons

The effects of 5-hydroxytryptamine (5-HT) on spinal motoneurons were examined in pentobarbital-anaesthetized cats and in nonanaesthetized decerebrate cats by intracellular recording and extracellular iontophoresis of 5-HT. 5-HT first induced a depolarization and then a long-lasting hyperpolarization (up to 60 min) with unchanged input resistance. The slow hyperpolarization was prevented by the 5-HT antagonists ketanserin (5-HT2), methysergide, and spiperone (5-HT1,2) and mimicked by the agonist (+/-)-1-(2,5-dimethoxy-4-iodophenyl)-2-aminopropane (5-HT2). The post-spike after hyperpolarization was enhanced after application of 5-HT. A depolarization was induce by the 5-HT agonists (+/-)-8-hydroxy-(2)-(di-n-propylamino)tetralin (5-HT1A) and 1-(2-methoxyphenyl)piperazine (5-HT1). Possible mechanisms for the 5-HT-induced hyperpolarization and its intracellular medication are discussed. The present data suggest multiple effects of 5-HT on cat spinal motoneurons.     

In vitro evaluation of ram sperm frozen with glycerol, ethylene glycol or acetamide

The aim was to assess the in vitro effect of glycerol, ethylene glycol or acetamide on frozen-thawed ram spermatozoa. Aliquots of each sixteen ejaculates from four rams of the Morada Nova breed were diluted in Tris-egg yolk with glycerol (5%), ethylene glycol (3% or 5%) or acetamide (3% or 5%) and frozen at -196°C. After thawing, progressive sperm motility was greater (P<0.05) in cryopreservation with glycerol 5% and ethylene glycol (3% or 5%) than with acetamide (3% or 5%). Acrosome integrity was greater (P<0.05) with ethylene glycol 5% than acetamide (3% or 5%). The percentage of sperm without oxidative stress was greater (P<0.05) with ethylene glycol (3% or 5%) than with acetamide (3% or 5%). Plasma membrane integrity was greater with glycerol 5% (P<0.05) than with the other cryoprotectants. Thus, it is concluded that glycerol 5% and ethylene glycol 3% or 5% protect ram sperm against the harmful effects of freezing and that glycerol 5% offers greater protection to sperm plasma membrane.     

Mechanism of interferon action. Effect of double-stranded RNA and the 5'-O-monophosphate form of 2',5'-oligoadenylate on the inhibition of reovirus mRNA translation in vitro

The effect of reovirus double-stranded RNA (dsRNA) and 5'-O-monophosphate form of 2',5'-oligoadenylate (pA(2'p5'A)2) on the translation and degradation of reovirus messenger RNA and on protein phosphorylation was examined in extracts prepared from interferon-treated mouse L fibroblasts. The following results were obtained. 1) The enhanced degradation of reovirus [3H]mRNA observed in the presence of either dsRNA or the 5'-O-triphosphate form of 2',5'-oligoadenylate (pppA(2'p5'A)3) was completely blocked by pA(2'p5'A)2. 2) The dsRNA-dependent phosphorylation of protein P1 and the alpha subunit of eukaryotic initiation factor (eIF-2) depended in a similar manner upon the concentration of dsRNA and was optimal at low dsRNA concentrations (0.1 to 1 microgram/ml). However, high concentrations of dsRNA (greater than 100 micrograms/ml) drastically reduced the phosphorylation of both P1 and eIF-2 alpha. Neither P1 nor eIF-2 alpha phosphorylation was affected by either pA(2'p5'A)2 or pppA(2'p5'A)3. 3) The translation of reovirus mRNA in vitro was inhibited by the addition of either low concentrations of dsRNA or pppA(2'p5'A)3. Whereas pA(2'p5'A)2 completely reversed the pppA(2'p5'A)3-mediated inhibition of translation, the inhibition mediated by low concentrations of dsRNA was only partially reversed by pA(2'p5'A)2. Under conditions where the pppA-(2'p5'A)3mediated degradation of reovirus mRNA was blocked, the translation of reovirus mRNA was still inhibited by low but not by high concentrations of dsRNA in a manner that correlated with the activation of P1 and eIF-2 alpha phosphorylation. These results suggest that the pppA(2'p5'A)n-dependent ribonuclease is not required and that protein phosphorylation may indeed be sufficient for the dsRNA-dependent inhibition of reovirus mRNA translation in cell-free systems derived from interferon-treated mouse fibroblasts.     

The 6R-oxygenase activity of arachidonate 5-lipoxygenase purified from porcine leukocytes

Arachidonate 5-lipoxygenase purified from porcine leukocytes was incubated with (5S)-hydroperoxy-6,8,11,14-eicosatetraenoic acid. In addition to degradation products of leukotriene A4 (6-trans-leukotriene B4 and its 12-epimer and others), (5S,6R)-dihydroperoxy-7,9,11,14-eicosatetraenoic acid was produced as a major product especially when the incubation was performed on ice rather than at room temperature. The amount of the (5S,6R)-dihydroperoxy acid was close to the total amount of leukotriene A4 degradation products. Under the anaerobic condition, production of the (5S,6R)-dihydroperoxy acid was markedly reduced. 5-Hydroxy-6,8,11,14-eicosatetraenoic acid could be a substrate of the enzyme and was transformed predominantly to a compound identified as (5S)-hydroxy-(6R)-hydroperoxy-7,9-trans-11,14-cis-eicosatetraenoic acid at about 1-2% rate of arachidonate 5-oxygenation. These findings indicated that the purified 5-lipoxygenase exhibited a 6R-oxygenase activity with (5S)-hydroxy and (5S)-hydroperoxy acids as substrates. The 6R-oxygenase activity, like the leukotriene A synthase activity, was presumed to be an integral part of 5-lipoxygenase because it required calcium and ATP and was affected by selective 5-lipoxygenase inhibitors.     

A-hydroxyphosphonate oligonucleotides: a promising DNA type?

The synthesis of monomers (S)-1, (R)-1 and 2 derived from (5'S)-, (5'R)-2'-deoxythymidine-5'-C-phosphonic acids and 2',5'-dideoxythymidine-5'-C-phosphonic acids was elaborated. The protection of the 5'-hydroxyl by the methoxycarbonyl group was a key step of the synthesis. Prepared monomers were used for the solid-phase assembly of several types oligothymidylate 15-mers (S)-3, (S)-4, (S)-5, (R)-4 and (R)-5 containing the chiral 3'-O-P-CH(OH)-5' internucleotide linkage. Their hybridization properties with dA15 and rA15 were studied as well as their resistance against nuclease cleavage.     

Endowing RNase H-inactive antisense with catalytic activity: 2-5A-morphants

A convergent synthetic approach was used to conjugate 2',5'-oligoadenylate (2-5A, p5'A2' [p5'A2'](n)()p5'A) to phosphorodiamidate morpholino oligomers (morphants). To provide requisite quantities of 2-5A starting material, commercially and readily available synthons for solid-phase synthesis were adapted for larger scale solution synthesis. Thus, the tetranucleotide 5'-phosphoryladenylyl(2'-->5')adenylyl(2'-->5')adenylyl(2'-->5')adenosine (p5'A2'p5'A2'](2)p5'A2', tetramer 2-5A, 9) was synthesized starting with 2',3'-O-dibenzoyl-N(6),N(6)-dibenzoyl adenosine prepared from commercially available 5'-O-(4-monomethoxytrityl) adenosine. Coupling with N(6)-benzoyl-5'-O-(4,4'-dimethoxytrityl)-3'-O-(tert-butyldimethylsilyl) adenosine-2'-(N,N-diisopropyl-2-cyanoethyl)phosphoramidite, followed by oxidization and deprotection, generated 5'-deprotected dimer 2-5A. Similar procedures lengthened the chain to form protected tetramer 2-5 A. The title product 9 p5'A(2'p5'A)(3) (tetramer 2-5A) was obtained through phosphorylation of the terminal 5'-hydroxy of the protected tetramer and removal of remaining protecting groups using concentrated ammonium hydroxide-ethanol (3:1, v/v) at 55 degrees C and tetrabutylammonium fluoride (TBAF) in THF at room temperature, respectively. The 2-5A-phosphorodiamidate morpholino antisense chimera 11 (2-5A-morphant) was synthesized by covalently linking an aminolinker-functionalized phosphorodiamidate morpholino oligomer with periodate oxidized 2-5A tetramer (p5'A2'[p5'A2'](2)p5'A). The resulting Schiff base was reduced with cyanoborohydride thereby transforming the ribose of the 2'-terminal nucleotide of 2-5A N-substituted morpholine. RNase L assays demonstrated that this novel 2-5A-antisense chimera had significant biological activity, thereby providing another potential tool for RNA ablation.     

Kinetics of 5--nucleotidase in sera of liver cirrhotic and normal Iraqi individuals.

5'-Nucleotidase activity was elevated in patients with liver cirrhosis; greater values of 5'-Nucleotidase activity were found in biliary cirrhosis, 5'-Nucleotidase from liver cirrhotic sera was less stable than from normal sera. The velocity of 5'Nucleotidase from liver cirrhotic sera per minute, at t = 10, was greater than normal controls. The optimum (S) for 5'-Nucleotidase was found to be 1.0 mM A-5'-MP, for both normal and liver cirrhotic sera. Km (A-5'-MP) and (2'-d-A-5'-MP) of 5'-Nucleotidase was found to be significantly lower in patients with liver cirrhosis than normal controls.     

Expression and function of 5-HT3 receptors in the enteric neurons of mice lacking the serotonin transporter

The actions of enteric 5-HT are terminated by 5-HT transporter (SERT)-mediated uptake, and gastrointestinal motility is abnormal in SERT -/- mice. We tested the hypothesis that adaptive changes in enteric 5-HT(3) receptors help SERT -/- mice survive despite inefficient 5-HT inactivation. Expression of mRNA encoding enteric 5-HT(3A) subunits was similar in SERT +/+ and -/- mice, but that of 5-HT(3B) subunits was fourfold less in SERT -/- mice. 5-HT(3B) mRNA was found, by in situ hybridization, in epithelial cells and enteric neurons. 5-HT evoked a fast inward current in myenteric neurons that was pharmacologically identified as 5-HT(3) mediated. The EC(50) of the 5-HT response was lower in SERT +/+ (18 microM) than in SERT -/- (36 microM) mice and desensitized rapidly in a greater proportion of SERT -/- neurons; however, peak amplitudes, steady-state current, and decay time constants were not different. Adaptive changes thus occur in the subunit composition of enteric 5-HT(3) receptors of SERT -/- mice that are reflected in 5-HT(3) receptor affinity and desensitization.     

Structure of a cDNA for Ciona Cytochrome b(5) and the ubiquitous expression of mRNA in embryonic tissues

A cDNA clone for cytochrome b(5) was isolated from a cDNA library of an ascidian, Ciona savignyi, by a plaque hybridization method using a digoxigenin-labeled cDNA for the soluble form of human cytochrome b(5). The cDNA is composed of 5'- and 3'-noncoding sequences, and a 396-base pair coding sequence. The 3'-noncoding sequence contains polyadenylation signal sequences. The amino acid sequence of 132 residues deduced from the nucleotide sequence of the cDNA showed 61% identity and 82% similarity to the cytochrome b(5) of another ascidian species, Polyandrocarpa misakiensis, which we previously cloned. The amino-terminal hydrophilic domain of 98 residues contains well-conserved structures around two histidine residues for heme binding. A cDNA expression system was constructed to prepare a putative soluble form of Ciona cytochrome b(5). The recombinant soluble cytochrome b(5) showed an asymmetrical absorption spectrum at 560 nm as is shown by mammalian cytochromes b(5) upon reduction with NADH and NADH-cytochrome b(5) reductase. The recombinant Ciona cytochrome b(5) is reduced by NADH-cytochrome b(5) reductase with an apparent K(m) value of 3.3 microM. This value is similar to that of the cytochrome b(5) of Polyandrocarpa misakiensis. The expression of Ciona cytochrome b(5) mRNA during development was examined by an in situ hybridization method and ubiquitous expression in embryonic tissues was observed. The results indicate that cytochrome b(5) plays important roles in various metabolic processes during development.     

Effects of nitroxyl radicals on pathogenic properties of herpesvirus (the spin-label technique in the study of virus-macrophage interactions)]

The effect of various concentrations of both methyl ether of 5-doxyl-stearic acid (M5DS) and 4-maleimido-TEMPO (4MT) on the pathogenicity of herpes simplex virus (HSV-1) was studied. It is known that the reagents modify the lipid matrix and the proteins of virion envelope. The decrease of the HSV-1 pathogenicity was shown when using the concentration of reagents more 5 x 10(-5) M. HSV-1 having high pathogenicity and cytotoxicity was obtained when the concentrations of the reagents were less 5 x 10(-5) M.     

Serotonergic modulation of murine fundic tone

Fundic tone is maintained through a balance of excitatory and inhibitory input to fundic smooth muscle. The aim of this study was to determine the role of serotonin (5-HT) and 5-HT receptors in modulating murine fundic tone. Muscle strips were prepared from the murine fundus. Intracellular recordings were made from circular smooth muscle cells, and the effects of 5-HT on tone and excitatory and inhibitory junction potentials evoked by electrical field stimulation (EFS) were determined. 5-HT induced a concentration-dependent contraction and smooth muscle depolarization that was tetrodotoxin resistant. The 5-HT(1B/D) receptor antagonists GR-127935 and BRL-155172 significantly inhibited 5-HT-induced contractions. The 5-HT(1B/D) agonist sumatriptan contracted murine fundic muscle. The 5-HT(1A) receptor agonist buspirone relaxed fundic smooth muscle, and the relaxation was inhibited by WAY-100135 but not by N(omega)-nitro-l-arginine or tetrodotoxin. 5-HT enhanced both the excitatory and inhibitory responses to EFS. The 5-HT(3) receptor antagonist MDL-72222 partly inhibited both the excitatory and inhibitory response elicited by EFS, whereas the 5-HT(4) receptor antagonist GR-113808 partly inhibited the EFS-evoked inhibitory response. The 5-HT reuptake inhibitor fluoxetine contracted smooth muscle strips, a contraction that was partially inhibited by GR-127935 and abolished by tetrodotoxin. In conclusion, the data suggest that 5-HT modulates murine fundic contractile activity through several different receptor subtypes. Sustained release of 5-HT maintains fundic tone through postjunctional 5-HT(1B/D) receptors. 5-HT(3) receptors modulate excitatory neural input to murine fundic smooth muscle, and both 5-HT(3) and 5-HT(4) receptors modulate inhibitory neural input to murine fundic smooth muscle.     

Functional analysis of 2-5A-dependent RNase and 2-5a using 2',5'-oligoadenylate-cellulose

2-5A is an intracellular effector that has been implicated in interferon action, hormonal regulation, and cell growth control. 2-5A action is mediated through its activation of 2-5A-dependent RNase (RNase L, RNase F). Affinity resins [2-5A-cellulose and core (2-5A)-cellulose] were chemically synthesized for purification and immobilization of 2-5A-dependent RNase from mouse L cells and rabbit reticulocyte lysates. The breakdown of poly(U)-[3'-32P]Cp to acid-soluble fragments was demonstrated using the 2-5A-dependent RNase:2-5A -cellulose complex; this activity was enhanced by adding (free) 2-5A. In contrast, RNase activity was measured from the 2-5A-dependent RNase:core (2-5A)-cellulose complex only after the addition of free 2-5A. The rabbit reticulocyte 2-5A-dependent RNase is activated only by tetramer or higher oligomers of 2-5A; therefore there was breakdown of poly(U)-[3'-32P]Cp using core (2-5A)-cellulose-bound reticulocyte 2-5A-dependent RNase after addition of tetramer 2-5A but there was no poly(U) degradation in the presence of trimer 2-5A. The absence of significant general nuclease in the assays was demonstrated by the resistance to breakdown of poly(C)-[3'-32P]Cp (not susceptible to 2-5A-dependent RNase). Moreover, core (2-5A)-cellulose was used to develop a sensitive (subnanomolar) assay for the detection of authentic 2-5A. 2-5A, or the material to be tested, was added to mouse L-cell 2-5A-dependent RNase:core (2-5A)-cellulose complex in the presence of poly(U)-[3'-32P]Cp. The concentration of 2-5A in the sample could be measured from the amount of poly(U) degradation. Several closely related analogs of 2-5A were tested and found to be completely inactive. The technology described herein may be applied to the study of the regulation of 2-5A-dependent RNase, the detection of 2-5A from cells and tissues, and other aspects of the 2-5A system.     

Synthesis and biological activities of a phosphorodithioate analog of 2',5'-oligoadenylate.

To enhance the resistance of 2-5A (pppA2'p5'A2'p5'A) to degradation by exo- and endonucleases, a phosphorodithioate analog was synthesized using a solid-phase phosphite triester approach with N6-benzoyl-5'-O-dimethoxytrityl-3'-O-t-butyldimethylsilyladenosine 2'-[S-(beta-thiobenzoylethyl)-pyrrolidinophosphorothioamidit e]. 5'-Monophosphorylation was accomplished with 2-[2-(4,4'-dimethoxytrityloxy)-ethylsulfonyl]ethyl-(2-cyanoe thyl)-(N,N- diisopropyl)-phosphoramidite. The resulting product, p5'A2'(s2p)- 5'A2'(s2p)5'A, was approximately 10-fold less effective as an activator of purified human recombinant 2-5A-dependent RNase than was 2-5A itself. This loss of activation ability was related directly to the loss of binding ability of the phosphorodiothioate analog. As predicted, p5'A2'(s2p)5'A2' (s2p)5'A was stable to snake venom phosphodiesterase and the nucleolytic activities of both human lymphoblastoid CEM cell extracts and human serum, under conditions that led to facile degradation of parent 2-5A. This nuclease stability permitted the observation of the CEM cell extracts and human serum phosphatase activity which led to 5'-dephosphorylation of p5'A2'(s2p)5'A2'(s2p)5'A.     

Synthesis and analgesic activity of N-(N-acetyl-L-amino-acyl)-5-methoxytryptamines

5-Methoxytryptamine was acylated with N-acetyl-L-amino acids to give rise the corresponding N-(N-acetyl-L-amino acyl)-5-methoxytryptamines. The analgesic activity was evaluated by the tail flick test. Among the 6 compounds, the analgesic potency of N-(N-acetyl-tryptophanyl)-5-methoxytryptamine (5e) and N-(N-acetyl-glycyl)-5-methoxytryptamine (5a) are much more potent than that of melatonin.     

Induction of 5-Deiodinase Activity in Astroglial Cells by 12-O-Tetradecanoylphorbol 13-Acetate and Fibroblast Growth Factors

In the brain, 5'-deiodinase (5'-D) is responsible for the metabolic activation of thyroxine (T4) into 3,5,3'-triiodothyronine (T3) and 5-deiodinase (5-D) deiodinates T4 and T3 into inactive metabolites. This study examines the effects of factors known to induce astroglial 5'-D activity on the 5-D activity in cultured rat astroglial cells. The potencies of these factors were compared after 8 h of incubation, when stimulations by these factors near their maximal effects. 12-O-Tetradecanoylphorbol 13-acetate (TPA) at 10(-7) M was a potent inducer of 5-D activity, producing a 30- to 80-fold increase after 8 h. The maximal effect of TPA was observed after about 14 h. The TPA stimulation of 5-D activity was not dependent on glucocorticoids, unlike 5'-D activity. In comparison with TPA, 8-bromo-cyclic AMP (10(-3) M) was a poor inducer of 5-D activity whereas it is an excellent inducer of 5'-D activity. It produced a 2- to 20-fold increase in 5-D activity after 8 h. Natural acidic fibroblast growth factor (20 ng/ml) produced a degree of stimulation similar to that of TPA after 8 h. The maximal effect of acidic fibroblast growth factor was observed after about 16 h (until a 120-fold increase). Recombinant acidic fibroblast growth factor also induced 5-D activity. Basic fibroblast growth factor was less potent than acidic fibroblast growth factor for increasing 5-D activity (maximal increase by 40- to 50-fold after 8 h).(ABSTRACT TRUNCATED AT 250 WORDS)