Polymorphism of the prion protein gene (<Emphasis Type="Italic">PRNP</Emphasis>) in two Chinese indigenous cattle breeds

Prion protein (PRNP) gene has been located at position q17 of chromosome 13 in cattle. The polymorphisms of PRNP gene might be associated with BSE susceptibility. In the present work, we investigated the polymorphisms of PRNP gene, including SNP in exon 3, 23-bp indel in promoter region, 12-bp indel in intron 1 in 2 Chinese indigenous cattle breeds of northeast China. Eighty-six animals from Yanbian (34) and Chinese Red Steppes (52) were genotyped at PRNP locus by analyzing genomic DNA. A total of 4 single nucleotide polymorphism (SNP) sites were revealed in the PRNP gene exon 3 of the 2 cattle breeds investigated. Three of these SNPs were non-synonymous mutations that resulted in the amino acid exchanges (K119N, S154N, and M177V), and one is silent nucleotide substitutions (A234G). The two amino acid mutations of S154N and M177V were detected only in Yanbian with a very low frequency (0.0147), and they appears to be absent in Chinese Red Steppes. The average gene heterozygosity (H _e), effective allele numbers (N _e), Shannon’s information index (I) and polymorphism information content (PIC) were 0.3088, 1.5013, 0.3814 and 0.2000 in Yanbian, respectively, being relatively higher than that of Chinese Red Steppes (0.2885, 1.4985, 0.3462 and 0.1873, respectively). In 23-bp indel and 12-bp indel loci, three different genotypes were identified in both Yanbian and Chinese Red Steppes breeds. Based 23- and 12-bp indels, four haplotypes was constructed in the 2 Chinese cattle breeds, of which the 23-bp (−)/12-bp (−) was main haplotypes accounting for more than 50% of the total in both Yanbian and Chinese Red Steppes breeds. These results might be useful in understanding the genetic characteristics of PRNP gene in Chinese indigenous cattle breeds.     

Detection of a new 20-bp insertion/deletion (indel) within sheep PRND gene using mathematical expectation (ME) method

Prion-related protein doppel gene (PRND), as an essential member of the mammalian prion gene family, is associated with the scrapie susceptibility as well as phenotype traits, so the genetic variation of the PRND has been highly concerned recently, including the single nucleiotide polymorphism (SNP) and insertion/deletion (indel). Therefore, the objective of present study was to examine the possible indel variants by mathematical expectation (ME) detection method as well as explore its associations with phenotype traits. A novel 20-bp indel was verified in 623 tested individuals representing 4 diversity sheep breeds. The results showed that 3 genotypes were detected and the minor allelic frequency were 0.008 (Lanzhou Fat-Tail sheep, LFTS), 0.084 (Small Tail Han sheep, STHS), 0.021(Tong sheep, TS) and 0.083 (Hu sheep, HS), respectively. Comparing with the traditional method of detecting samples one by one, the reaction times with ME method was decreased by 36.22% (STHS), 37.00% (HS), 68.67% (TS) and 83.33% (LFTS), respectively. Besides, this locus was significantly associated to cannon circumference index (P = 0.012) and trunk index (P = 0.037) in the Hu sheep breed. Notably, it was not concordance with the present result of DNA sequencing (GCTGTCCCTGCAGGGCTTCT) and dbSNPase of NCBI (NC_443194: g.46184887- 46184906delCTGCTGTCCCTGCAGGGCTT). Consequently, it was the first time to detect the new 20-bp indel of sheep PRND gene by ME strategy, which might provide a valuable theoretical basis for marker-assisted selection in sheep genetics and breeding.     

Genetic effects of PRNP gene insertion/deletion (indel) on phenotypic traits in sheep

Prion protein (PRNP) gene is well known for affecting mammal transmissible spongiform encephalopathies (TSE), and is also reported to regulate phenotypic traits (e.g. growth traits) in healthy ruminants. To identify the insertion/deletion (indel) variations of the PRNP gene and evaluate their effects on growth traits, 768 healthy individuals from five sheep breeds located in China and Mongolia were identified and analyzed. Herein, four novel indel polymorphisms, namely, Intron-1-insertion-7bp (I1-7bp), Intron-2-insertion-15bp (I2-15bp), Intron-2-insertion-19bp (I2-19bp), and 3′ UTR-insertion-7bp (3′ UTR-7bp), were found in the sheep PRNP gene. In five analyzed breeds, the minor allelic frequencies (MAF) of the above indels were in the range of 0.008 to 0.986 (I1-7bp), 0.113 to 0.336 (I2-15bp), 0.281 to 0.510 (I2-19bp), and 0.040 to 0.238 (3′ UTR-7bp). Additionally, there were 15 haplotypes and the haplotype ‘I_I2-15bp-D_3’UTR-7bp-D_I2-19bp-D_I1-7bp’ had the highest frequency, which varied from 0.464 to 0.629 in five breeds. Moreover, association analysis revealed that all novel indel polymorphisms were significantly associated with 13 different growth traits (P < 0.05). Particularly, the influences of I2-15bp on chest width (P = 0.001) in Small Tail Han sheep (ewe), 3′ UTR-7bp on chest circumference (P = 0.003) in Hu sheep, and I2-19bp on tail length (P = 0.001) in Tong sheep, were highly significant (P < 0.01). These findings may be a further step toward the detection of indel-based typing within and across sheep breeds, and of promising target loci for accelerating the progress of marker-assisted selection in sheep breeding.     

Allele Distributions and Frequencies of the Six Prion Protein Gene (PRNP) Polymorphisms in Asian Native Cattle, Japanese Breeds, and Mythun (Bos frontalis)

Six polymorphic sites of the bovine prion protein gene (PRNP) were genotyped in 569 animals of Asian native cattle, Japanese breeds, purebred mythun (Bos frontalis), and mythun × cattle composite animals. At the 23-bp indel site, a deletion (23?) allele was a major allele in all populations except mythun. At the 12-bp indel site, an insertion (12+) allele was a major allele in all populations. The 14-bp indel site was polymorphic in all Asian native cattle. In the octapeptide repeat region, a six-repeat allele was a major allele in all populations, and 5/5 and 4/6 genotypes were detected in Japanese Black and Mongolian cattle and in mythun, respectively. Two nonsynonymous single nucleotide polymorphisms (SNPs) (K3T and S154N) were detected in Asian native cattle and mythun. Haplotype analysis using the genotypes of the six sites estimated 33 different haplotypes. The haplotype 23? 12? K 6 S 14+ was found in all populations.     

Comparative PRNP genotyping of U.S. cattle sires for potential association with BSE

The recent discovery of significant associations between bovine spongiform encephalopathy (BSE) susceptibility in German cattle and the frequency distributions of insertion/deletion (indel) polymorphisms within the bovine PRNP gene prompted an evaluation of 132 commercial U.S. artificial insemination (AI) sires from 39 breeds. Forward primer sequences from published primer sets targeting indels within the putative bovine PRNP promoter, intron 1, and the 3 UTR (untranslated region) were synthesized with unique 5 fluorescent labels and utilized to develop a rapid multiplexed PCR assay for identifying BSE-associated indels as well as facilitating polymorphism analyses and/or marker-assisted selection. Significant differences (p < 0.05 all tests) were detected between the frequencies of bovine PRNP promoter alleles for 48 healthy German cattle previously described and 132 commercial U.S. cattle sires. The frequency of the 23-bp promoter allele observed for commercial U.S. cattle sires strongly resembled that recently described for 43 BSE-affected German cattle. No significant difference (p=0.051) was detected between the distributions of promoter genotypes for healthy German cattle and our panel of commercial U.S. cattle sires. Interestingly, significant differences (p < 0.01; p < 0.02) were also noted between the frequencies and distributions of intron 1 alleles and genotypes, respectively, for BSE-affected German cattle and our panel of U.S. cattle sires. No significant allelic or genotypic differences were detected for the 14-bp 3 UTR indel for any given comparison between German cattle and commercial U.S. cattle sires.     

Evaluation of PRNP expression based on genotypes and alleles of two indel loci in the medulla oblongata of Japanese Black and Japanese Brown cattle

Background

Prion protein (PrP) level plays the central role in bovine spongiform encephalopathy (BSE) susceptibility. Increasing the level of PrP decreases incubation period for this disease. Therefore, studying the expression of the cellular PrP or at least the messenger RNA might be used in selection for preventing the propagation of BSE and other prion diseases. Two insertion/deletion (indel) variations have been tentatively associated with susceptibility/resistance of cattle to classical BSE.

Methodology/Principal Findings

We studied the expression of each genotype at the two indel sites in Japanese Black (JB) and Japanese Brown (JBr) cattle breeds by a standard curve method of real-time PCR. Five diplotypes subdivided into two categories were selected from each breed. The two cattle breeds were considered differently. Expression of PRNP was significantly (p<0.0001) greater in the homozygous deletion genotype at the 23-bp locus in JB breed. Compared to the homozygous genotypes, the expression of PRNP was significantly greater in the heterozygous genotype at the 12-bp locus in JB (p<0.0001) and in JBr (p = 0.0394) breeds. In addition, there was a statistical significance in the PRNP levels between the insertion and the deletion alleles of the 23-bp locus in JB (p = 0.0003) as well as in JBr (p = 0.0032). There was no significance in relation to sex, age, geographical location or due to their interactions (p>0.05).

Conclusion

Our results suggest that the del/del genotype or at least its del allele may modulate the expression of PRNP at the 23-bp locus in the medulla oblongata of these cattle breeds.     

Deletion/insertion polymorphism of the prion protein gene (<Emphasis Type="Italic">PRNP</Emphasis>) in Polish Red cattle,Polish White-backed cattle and European bison (<Emphasis Type="Italic">Bison bonasus</Emphasis> L., 1758)

The aim of the present study was to identify deletion/insertion polymorphism of the bovine prion protein (PRNP) gene within the promoter sequence (23 bp indel), intron 1 (12 bp indel) and the 3′ end untranslated region (14 bp indel). The experiment was performed on three groups of animals protected under a genetic resources conservation program: 139 Polish Red (PR) cows, 79 Polish White-backed cows and 50 European bison (Bison bonasus L., 1758). White-backed cattle were characterized by a higher frequency of ins/del heterozygotes and a relatively lower frequency of ins/ins homozygotes within the promoter sequence region (23 bp indel), compared to Polish Red cattle. At the polymorphic locus of intron 1 (12 bp indel) the genetic structure of both cattle populations was similar. Monomorphism, expressed by the occurrence of one genotype variant in each of the analyzed sequence regions, was observed in European bison. Five haplotypes were found in Polish White-backed cows, four haplotypes in Polish Red cows and only one in analyzed group of bison. Differences between the observed and expected number of PRNP haplotypes were recorded in Polish Red cattle. The article is published in the original.     

Indels within promoter and intron 1 of bovine prion protein gene modulate the gene expression levels in the medulla oblongata of two Japanese cattle breeds

Genetic differences which exist in the prion protein gene (PRNP) have been reported to influence susceptibility of humans, sheep and goats to prion diseases. In cattle, however, none of the known coding polymorphisms has a direct effect on bovine spongiform encephalopathy (BSE). It has been reported that 23‐bp insertion/deletion (indel) polymorphisms within the promoter region have a tentative association to BSE susceptibility in German cattle, and a lower number of 24‐bp repeat units in the open reading frame (ORF) was reported to reduce BSE susceptibility in transgenic mice. In this study, because of the hypothesis that bovine PRNP promoter polymorphisms cause changes in PRNP expression, we genotyped PRNP polymorphisms in the promoter and intron 1 using 218 genomic DNA samples from two Japanese cattle breeds. We also analysed the expression levels of prion in 40 animals by quantification of real‐time PCR using mRNAs extracted from the medulla oblongata to study the relationship between PRNP genotypes and PRNP expression. We found a significant correlation between promoter indel polymorphisms and PRNP‐mRNA expression (P_0.0413) and therefore hypothesize that differences in polymorphisms could be one of the causes of differences in PRNP expression levels. We also report a novel difference in PRNP expression (P < 0.0001) between Japanese Black and Japanese Brown cattle breeds. There was no significant difference based on age and sex of the animals.     

Polymorphism of the prion protein gene (<Emphasis Type="Italic">PRNP</Emphasis>) in Polish cattle affected by classical bovine spongiform encephalopathy

Recent attempts to discover genetic factors affecting cattle resistance/susceptibility to bovine spongiform encephalopathy (BSE) have led to the identification of two insertion/deletion (indel) polymorphisms, located within the promoter and intron 1 of the prion protein gene PRNP, showing a significant association with the occurrence of classical form of the disease. Because the effect of the polymorphisms was studied only in few populations, in this study we investigated whether previously described association of PRNP indel polymorphisms with BSE susceptibility in cattle is also present in Polish cattle population. We found a significant relation between the investigated PRNP indel polymorphisms (23 and 12 bp indels), and susceptibility of Polish Holstein-Friesian cattle to classical BSE (P < 0.05). The deletion variants of both polymorphisms were related to increased susceptibility, whereas insertion variants were protective against BSE.     

Bovine spongiform encephalopathy associated insertion/deletion polymorphisms of the prion protein gene in the four beef cattle breeds from North China

Two insertion/deletion (indel) polymorphisms of the prion protein gene (PRNP), a 23-bp indel in the putative promoter region and a 12-bp indel within intron I, are associated with the susceptibility to bovine spongiform encephalopathy (BSE) in cattle. In the present study, the polymorphism frequencies of the two indels in four main beef cattle breeds (Hereford, Simmental, Black Angus, and Mongolian) from North China were studied. The results showed that the frequencies of deletion genotypes and alleles of 23- and 12-bp indels were lower, whereas the frequencies of insertion genotypes and alleles of the two indels were higher in Mongolian cattle than in the other three cattle breeds. In Mongolian cattle, the 23-bp insertion / 12-bp insertion was the major haplotype, whereas in Hereford, Simmental, and Black Angus cattle, the 23-bp deletion / 12-bp deletion was the major haplotype. These results demonstrated that Mongolian cattle could be more resistant to BSE, compared with the other three cattle breeds, because of its relatively low frequencies of deletion genotypes and alleles of 23- and 12-bp indel polymorphisms. Thus, this race could be important for selective breeding to improve resistance against BSE in this area.     

Deletion / insertion polymorphisms of the prion protein gene (<Emphasis Type="BoldItalic">PRNP</Emphasis>) in gayal (<Emphasis Type="BoldItalic">Bos frontalis</Emphasis>)

Resistance to fatal disease bovine spongiform encephalopathy (BSE), due to misfolded prion protein in cattle, is associated with a 23-bp indel polymorphism in the putative promoter and a 12-bp indel in intron 1 of the PRNP gene. Gayal (Bos frontalis) is an important semiwild bovid species and of great conservation concern, but till today these indel polymorphisms have not been evaluated in gayals. Therefore, we collected 225 samples of gayals and evaluated the genetic indel polymorphism in the two regions of this PRNP gene. The results revealed high allelic frequencies of insertions at these indel sites: 0.909 and 0.667 for, respectively, the 23 bp and 12 bp indels, both also with significant genotype frequencies (\(\chi ^{2}\): 9.81; 23 bp and \(\chi ^{2}\): 43.56; 12 bp). At the same time, the haplotype data showed indel polymorphisms with extremely low deletion (0.01) in both regions of the PRNP gene. We compared these data with those reported for healthy and BSE-affected cattle (Bos taurus) breeds from two European countries, Germany and Switzerland, and significant difference (\(P\,{<}\,0.001\)) was observed between BSE-affected as well as the healthy cattle. Further, our data were also extensively compared with previous reports on BSE and highly significant (\(P\,{<}\,0.001\)) outcomes were observed. This result suggested negligible genetic susceptibility to BSE in gayals. To the best of our knowledge, this study is the first comprehensive deciphering information about the PRNP indel polymorphisms of 23 bp and 12 bp in gayals, a semiwild species of China.     

Identification of a novel 43-bp insertion in the heparan sulfate 6-O-sulfotransferase 3 (HS6ST3) gene and its associations with growth and carcass traits in chickens

Previous studies have revealed a significant association between SNPs found within the heparan sulfate 6-O-sulfotransferase 3 (HS6ST3) gene and obesity. This study identified a novel 43-bp indel polymorphism in intron 1 of HS6ST3 in 1963 chickens from nine different breeds, and three genotypes, designated II, ID and DD, were observed. The frequency of the ‘I’ (0.62–0.87) allele was higher than that of the ‘D’ (0.13–0.38) allele. A total of 777 individuals of the Gushi-Anka F₂ resource population were used for the analysis of associations according to growth traits, carcass traits, serum variables and meat quality traits. The results showed that the 43-bp indel polymorphism was significantly associated with the body weight at 4 and 6 weeks of age, chest depth at 4 and 12 weeks of age and shank girth at 12 weeks of age (P?<?0.05). In terms of the carcass traits, the indel polymorphism was significantly associated with breast muscle weight, heart weight and leg weight (P?<?0.05). These findings suggested that this indel polymorphism has the potential to become a new target for the marker-assisted selection of chicken growth and carcass traits.     

Development of a touch-down multiplex PCR method for simultaneously rapidly detecting three novel insertion/deletions (indels) within one gene: an example for goat GHR gene

Abstract

The multiplex polymerase chain reaction (PCR) method is fast and accuracy for screening several polymorphism loci in a single reaction in large samples. Therefore, this study aimed to identify three novel insertion/deletion (indel) loci in goat growth hormone receptor (GHR) gene by using multiplex PCR method and the genotypes in three indel loci are identified in 918 individuals from three Chinese goat breeds, as well as to evaluate its associations with growth traits. After validating the accuracy by taking the conventional PCR method, the concordance between these two methods was 100%. Moreover, P14 locus polymorphism was significantly associated with six growth traits of Hainan black goats. Briefly, an economic multiplex PCR method is presented to simultaneously and accurately detect three indel polymorphisms within goat GHR without the use of any special equipment, thus improving the experimental efficiency and fast obtaining the experimental result for indel genotyping.     

Detecting a deletion in the coding region of the bovine bone morphogenetic protein 15 gene (BMP15)

The aim of this study was to detect polymorphism in the bovine bone morphogenetic protein 15 (BMP 15) gene. On the basis of PCR-SSCP and DNA sequencing, a 4-bp deletion was identified in the coding region of the gene. Sequence analysis revealed that the deletion altered the reading frame and introduced a stop codon at position 264. Eight breeds (Luxi, Qinchuan, Nanyang, Jinnan, Bohai Black, Menggolian, Holstein, and Simmental) were genotyped by PCR-SSCP. No cows homozygous for this mutation were observed in these breeds. Heterozygous cows were detected in Luxi, Qinchuan, Nanyang, Jinnan and Bohai Black cattle. Fecundity was not increased in heterozygous individuals.     

Prion protein gene polymorphism in healthy and BSE-affected Slovak cattle

Variation of thePrP gene was examined in healthy and BSE-affected Slovak cattle. According to previous studies, the 23-bp indel polymorphism is supposed to be associated with higher susceptibility to BSE. We investigated 301 samples from healthy cattle of various Slovak breeds and 24 samples obtained from tissues of BSE-affected cattle in Slovakia. We examined thePrP gene for the 23-bp indel polymorphism in the putative promoter region, 12-bp indel polymorphism in the first intron of thePrP gene, variations in number of octapeptide repeat units, and presence of the silent AAC>AAT transition in codon 192 within the protein-coding region of thePrP gene. Altogether we found 23 different genotypes in the group of healthy cattle and only 6 genotypes in the group of BSE-affected cattle. Comparison of homozygotes for the 23-bp insertion and heterozygotes showed significant differences (P < 0.05) in genotype distribution between the examined groups. Thereby the homozygous insertion genotype at the 23-bp indel polymorphism site in the promoter region of the prion protein gene seems to have a protective effect against BSE.     

Prion gene sequence variation within diverse groups of U.S. sheep,beef cattle,and deer

Prions are proteins that play a central role in transmissible spongiform encephalopathies in a variety of mammals. Among the most notable prion disorders in ungulates are scrapie in sheep, bovine spongiform encephalopathy in cattle, and chronic wasting disease in deer. Single nucleotide polymorphisms in the sheep prion gene (PRNP) have been correlated with susceptibility to natural scrapie in some populations. Similar correlations have not been reported in cattle or deer; however, characterization of PRNP nucleotide diversity in those species is incomplete. This report describes nucleotide sequence variation and frequency estimates for the PRNP locus within diverse groups of U.S. sheep, U.S. beef cattle, and free-ranging deer (Odocoileus virginianus and O. hemionus from Wyoming). DNA segments corresponding to the complete prion coding sequence and a 596-bp portion of the PRNP promoter region were amplified and sequenced from DNA panels with 90 sheep, 96 cattle, and 94 deer. Each panel was designed to contain the most diverse germplasm available from their respective populations to facilitate polymorphism detection. Sequence comparisons identified a total of 86 polymorphisms. Previously unreported polymorphisms were identified in sheep (9), cattle (13), and deer (32). The number of individuals sampled within each population was sufficient to detect more than 95% of all alleles present at a frequency greater than 0.02. The estimation of PRNP allele and genotype frequencies within these diverse groups of sheep, cattle, and deer provides a framework for designing accurate genotype assays for use in genetic epidemiology, allele management, and disease control.     

Characterization of <Emphasis Type="Italic">PRNP</Emphasis> and <Emphasis Type="Italic">SPRN</Emphasis> coding regions from atypical scrapie cases diagnosed in Poland

Scrapie, a fatal transmissible spongiform encephalopathy (TSE) occurs in two phenotypes: classical and atypical. Many authors point out that the polymorphism of three codons (136, 154, 171) of the PRNP (PrP gene) is associated with a sheep susceptibility to classical scrapie. Until now, only one PRNP gene variant coding phenylalanine at codon 141 has been found to be associated with atypical scrapie. Another recently identified and interesting candidate gene for scrapie susceptibility in sheep is an SPRN gene coding for Shadoo protein (Sho). Sho is a highly interspecies conserved protein and an insertion/deletion (indel) found in a sheep Sho gene was associated with classical scrapie occurrence. Here we determined the polymorphism of PRNP and SPRN genes in nine atypical scrapie cases (six in native born sheep and three in imported sheep) and compared these results with a control group of healthy animals comprising six corresponding Polish sheep breeds. In atypical scrapie cases five PRNP diplotypes were identified: A₁₃₆R₁₅₄Q₁₇₁/ARQ, AHQ/ARQ, ARR/ARQ, ARR/AHQ and AHQ/AHQ. The ARR/AHQ diplotype was found only in imported sheep. A previously unobserved SNP in PRNP (E224K) was also found in both atypical scrapie and in a few control animals. In the ORF of the SPRN gene, six SNPs and one indel were identified. None of these variations was exclusive for scrapie animals and they were probably, naturally occurring polymorphisms. Special attention was given to the 6-bp indel SPRN polymorphism which was previously associated with classical scrapie occurrence.     

Y-SNPs Haplotype Diversity in Four Chinese Cattle Breeds

To investigate the genetic diversity of Chinese cattle, 96 male samples of 4 Chinese native cattle breeds were investigated using 5 single nucleotide polymorphisms specific to the bovine Y chromosome. Two previously described haplotypes (taurine Y2 and indicine Y3) were detected in 74 and 22 animals, respectively. The haplotype frequencies varied amongst the four native breeds. The taurine Y2 haplotype dominated in the Qinchuan, Dabieshan, and Yunba breeds. However, the indicine Y3 haplotype occurred in high frequency in the Enshi breed. Among the four native breeds, Yunba had the highest haplotype diversity (0.4330 ± 0.0750), followed by Qinchuan (0.2899 ± 0.1028) and Enshi (0.2222 ± 0.1662), Dabieshan was the least differentiated (0.1079 ± 0.0680). Compared with some foreign cattle breeds, the low level of haplotype diversity was detected in our breeds (0.2633 ± 0.1030).