Phased psoralen cross-links do not bend the DNA double helix

Although the chemical reaction of psoralens with nucleic acids is well understood, the structure of psoralen-DNA cross-linked products is still not clear. Model building studies base on the crystal structure of the psoralen-thymine monoadduct suggest that each cross-link bends the DNA double helix by 46.5 degrees [Pearlman, D. A., Holbrook, S. R., Pirkle, D. H., & Kim, S.-H. (1985) Science (Washington, D.C.) 227, 1304-1308]. On the other hand, Sinden and Hagerman [Sinden, R. R., & Hagerman, P. J. (1984) Biochemistry 23, 6299-6303] find that, in solution, psoralen cross-linked DNA is not bent. Here we use gel electrophoresis to test the validity of the current models. We have synthesized a series of DNA fragments (21-24 base pairs in length), each containing one unique T-A site for 4'-(hydroxymethyl)-4,5',8-trimethylpsoralen (HMT) cross-linking. Because of an estimated 28 degrees unwinding of the helix by HMT [Wiesehahn, G., & Hearst, J. E. (1978) Proc. Natl. Acad. Sci. U.S.A. 75, 2703-2707], one expects that the 22-bp cross-linked fragment will be repeated nearly in phase with the average helical screw when multimerized. In that sequence ligation will maximally amplify any deformation to the double helix. We find that the ligated multimers of cross-linked DNA migrate close to the multimers of non-cross-linked DNA on polyacrylamide gels. Our observations place an upper limit of 10 degrees on DNA bending induced by psoralen cross-linking and indicate unwinding by about 1 bp, as well as stiffening of the double helix. These properties are not unexpected for classical intercalators.     

Triple helix formation by oligopurine-oligopyrimidine DNA fragments. Electrophoretic and thermodynamic behavior

The 26mer oligodeoxynucleotide d(GAAGGAGGAGATTTTTCTCCTCCTTC) adopts in solution a unimolecular hairpin structure (h), with an oligopurine-oligopyrimidine (Pu-Py) stem. When h is mixed with d(CTTCCTCCTCT) (s1) the two strands co-migrate in polyacrylamide gel electrophoresis at pH 5. If s1 is substituted with d(TCTCCTCCTTC) (s2), such behavior is not observed and the two strands migrate separately. This supports the suggestion of the formation of a triple-stranded structure by h and s1 (h:s1) but not by h and s2, and confirms the strand polarity requirement of the third pyrimidine strand, which is necessary for this type of structure. The formation of a triple helix by h:s1 is supported by electrophoretic mobility data (Ferguson plot) and by enzymatic assay with DNase I. Circular dichroism measurements show that, upon triple helix formation, there are two negative ellipticities: a weaker one (delta epsilon = 80 M-1 cm-1) at 242 nm and a stronger one (delta epsilon = 210 M-1 cm-1) at 212 nm. The latter has been observed also in triple-stranded polynucleotides, and can be considered as the trademark for a Py:Pu:Py DNA triplex. Comparison of ultraviolet absorption at 270 nm and temperature measurements shows that the triple-stranded structure melts with a biphasic profile. The lower temperature transition is bimolecular and is attributable to the breakdown of the triplex to give h and s1, while the higher temperature transition is monomolecular and is due to the transition of hairpin to coil structure. The duplex-to-triplex transition is co-operative, fully reversible and with a hyperchromism of about 10%. The analysis of the melting curves, with a three-state model, allows estimation of the thermodynamic parameters of triple helix formation. We found that the duplex-to-triplex transition of h: s1 is accompanied by an average change in enthalpy (less the protonation contribution) of -73(+/- 5) kcal/mol of triplex, which corresponds to -6.6(+/- 0.4) kcal/mol of binding pyrimidine, attributable to stacking and hydrogen bonding interactions.     

Preference of the recombination sites involved in the formation of extrachromosomal copies of the human alphoid Sau3A repeat family.

The human alphoid Sau3A repetitive family DNA is one of the DNA species that are actively amplified to form extrachromosomal circular DNA in several cell lines. The circularization takes place between two of the five approximately 170 bp subunits with an average of 73.1% homology as well as between identical subunits. To investigate the nature of the recombination reaction, we cloned and analyzed the subunits containing recombination junctions. Analysis of a total of 68 junctions revealed that recombination had occurred preferentially at four positions 10-25 (A), 40-50 (B), 85-90 (C) and 135-160 (D) in the 170bp subunit structure. Two regions (B and C) were overlapped with the regions with higher homology between subunits, while other two regions (A and D) cannot be explained solely by the regional homology between the subunits. These regions were located at both junctions of the nucleosomal and the linker region, and overlapped with the binding motifs for alpha protein and CENP-B. Approximately 90% of the recombination occurred between the subunits located next but one (+/- 2 shift), although the frequency of recombination between the adjoining subunits (+/- 1 shift) was approximately 10%.     

Circular dichroism and DNA secondary structure.

The change in average rotation of the DNA helix has been determined for the transfer from 0.05 M NaCl to 3.0 M CsCl, 6.2 M LiCl and 5.4 M NH4Cl. This work, combined with data at lower salt from other laboratories, allows us to relate the intensity of the CD of DNA at 275 nm directly to the change in the number of base pairs per turn. The change in secondary structure for the transfer of DNA from 0.05 M NaCl (where it is presumably in the B-form) to high salt (where the characteristic CD has been interpreted as corresponding to C-form geometry) is found to be -0.22 (+/- 0.02) base pairs per turn. In the case of mononucleosomes, where the CD indicates the "C-form", the change in secondary structure (including temperature effects) would add -0.31 (+/- 0.03) turns about the histone core to the -1.25 turns estimated from work on SV40 chromatin. Accurate winding angles and molar extinction coefficients were determined for ethidium.     

Experimentally based orientational refinement of membrane protein models: A structure for the Influenza A M2 H+ channel

The 97-residue M2 protein from Influenza A virus forms H+-selective ion channels which can be attributed solely to the homo-tetrameric alpha-helical transmembrane domain. Site-directed infrared dichroism spectra were obtained for the transmembrane domain of M2, reconstituted in lipid vesicles. Data analysis yielded the helix tilt angle beta=31.6(+/-6.2) degrees and the rotational pitch angle about the helix axis for residue Ala29 omegaAla29=-59.8(+/-9.9) degrees, whereby omega is defined as zero for a residue located in the direction of the helix tilt. A structure was obtained from an exhaustive molecular dynamics global search protocol in which the orientational data are utilised directly as an unbiased refinement energy term. Orientational refinement not only allowed selection of a unique structure but could also be shown to increase the convergence towards that structure during the molecular dynamics procedure. Encouragingly, the structure obtained is highly consistent with all available mutagenesis and conductivity data and offers a direct chemical insight that relates the altered functionality of the channel to its structure.     

Ca2+ - and cross-bridge-dependent changes in N- and C-terminal structure of troponin C in rat cardiac muscle

Linear dichroism of 5'-tetramethylrhodamine (5'ATR)-labeled cardiac troponin C (cTnC) was measured to monitor cTnC structure during Ca2+-activation of force in rat skinned myocardium. Mono-cysteine mutants allowed labeling at Cys-84 (cTnC(C84), near the D/E helix linker); Cys-35 (cTnC(C35), at nonfunctional site I); or near the C-terminus with a cysteine inserted at site 98 (cTnC-C35S,C84S,S98C, cTnC(C98)). With 5'ATR-labeled cTnC(C84) and cTnC(C98) dichroism increased with increasing [Ca2+], while rigor cross-bridges caused dichroism to increase more with 5'ATR-labeled cTnC(C84) than cTnC(C98). The pCa50 values and n(H) from Hill analysis of the Ca2+-dependence of force and dichroism were 6.4 (+/-0.02) and 1.08 (+/-0.04) for force and 6.3 (+/-0.04) and 1.02 (+/-0.09) (n = 5) for dichroism in cTnC(C84) reconstituted trabeculae. Corresponding data from cTnC(C98) reconstituted trabeculae were 5.53 (+/-0.03) and 3.1 (+/-0.17) for force, and 5.39 (+/-0.03) and 1.87 (+/-0.17) (n = 5) for dichroism. The contribution of active cycling cross-bridges to changes in cTnC structure was determined by inhibition of force to 6% of pCa 4.0 controls with 1.0 mM sodium vanadate (Vi). With 5'ATR-labeled cTnC(C84) Vi caused both the pCa50)of dichroism and the maximum value at pCa 4.0 to decrease, while with 5'ATR-labeled cTnC(C98) the pCa50 of dichroism decreased with no change of dichroism at pCa 4.0. The dichroism of 5'ATR-labeled cTnC(C35) was insensitive to either Ca2+ or strong cross-bridges. These data suggest that both Ca2+ and cycling cross-bridges perturb the N-terminal structure of cTnC at Cys-84, while C-terminal structure is altered by site II Ca2+-binding, but not cross-bridges.     

Alanine scanning and Fe-BABE probing of the bacteriophage ø29 prohead RNA-connector interaction

The DNA packaging motor of the Bacillus subtilis bacteriophage ?29 prohead is comprised in part of an oligomeric ring of 174 base RNA molecules (pRNA) positioned near the N termini of subunits of the dodecameric head-tail connector. Deletion and alanine substitution mutants in the connector protein (gp10) N terminus were assembled into proheads in Escherichia coli and the particles tested for pRNA binding and DNA-gp3 packaging in vitro. The basic amino acid residues RKR at positions 3-5 of the gp10 N terminus were central to pRNA binding during assembly of an active DNA packaging motor. Conjugation of iron(S)-1-(p-bromoacetamidobenzyl) ethylenediaminetetraacetate (Fe-BABE) to residue S170C in the narrow end of the connector, near the N terminus, permitted hydroxyl radical probing of bound [(32)P]pRNA and identified two discrete sites proximal to this residue: the C-helix at the junction of the A, C and D helices, and the E helix and the CE loop/D loop of the intermolecular base pairing site.     

The design and production of semisynthetic ribonucleases with increased thermostability by incorporation of S-peptide analogues with enhanced helical stability

Recent work has shown that, with synthetic analogues of C-peptide (residues 1-13 of ribonuclease A), the stability of the peptide helix in H2O depends strongly on the charge on the N-terminal residue. We have asked whether, in semisynthetic ribonuclease S reconstituted from S-protein plus an analogue of S-peptide (1-15), the stability of the peptide helix is correlated with the Tm of the reconstituted ribonuclease S. Six peptides have been made, which contain Glu9----Leu, a blocked alpha-COO- group (-CONH2), and either Gln11 or Glu11. The N-terminal residue has been varied; its charge varies from +2 (Lys) to -1 (succinyl-Ala). We have measured the stability of the peptide helix, the affinity of the peptide for S-protein (by C.D. titration), and the thermal stability of the reconstituted ribonuclease S. All six peptide analogues show strongly enhanced helix formation compared to either S-peptide (1-15) or (1-19), and the helix content increases as the charge on the N-terminal residue changes from +2 to -1. All six peptides show increased affinity for S-protein compared to S-peptide (1-19), and all six reconstituted ribonucleases S show an increase in Tm compared to the protein with S-peptide (1-19). The Tm increases as the charge on residue 1 changes from +2 to -1. The largest increment in Tm is 6 degrees. The results suggest that the stability of a protein can be increased by enhancing the stability of its secondary structure.     

Structural model for an oligonucleotide containing a bulged guanosine by NMR and energy minimization

We present three-dimensional structural models for a DNA oligomer containing a bulged guanosine based on proton NMR data and energy minimization computations. The nonexchangeable proton resonances of the duplex 5'd(GATGGGCAG).d(CTGCGCCATC) are assigned by nuclear Overhauser effect spectroscopy (NOESY) and correlated spectroscopy connectivities, and the NMR spectrum is compared with that of a regular 8-mer of similar sequence, 5'd(GATGGCAG).d(CTGCCATC). Experimental proton-proton distances are obtained from NOESY spectra acquired with mixing times of 100, 150, and 200 ms. A refined three-dimensional structure for the bulge-containing duplex is calculated from regular B DNA starting coordinates by using the AMBER molecular mechanics program [Weiner, S. J., Kollman, P. A., Case, D. A., Singh, U. C., Ghio, C., Alagona, G., Profeta, S., & Weiner, P. (1984) J. Am. Chem. Soc. 106, 765-784]. We compare structures obtained by building the helix in three and four base pair increments with structures obtained by direct minimization of the entire nine base sequence, with and without experimental distance constraints. The general features of all the calculated structures are very similar. The helix is of the B family, with the extra guanine stacked into the helix, and the helix axis is bent by 18-23 degrees, in agreement with gel mobility data for bulge-containing sequences [Rice, J. A. (1987) Ph.D. Thesis, Yale University].     

Structure of a beta-alanine-linked polyamide bound to a full helical turn of purine tract DNA in the 1:1 motif

Polyamides composed of N-methylpyrrole (Py), N-methylimidazole (Im) and N-methylhydroxypyrrole (Hp) amino acids linked by beta-alanine (beta) bind the minor groove of DNA in 1:1 and 2:1 ligand to DNA stoichiometries. Although the energetics and structure of the 2:1 complex has been explored extensively, there is remarkably less understood about 1:1 recognition beyond the initial studies on netropsin and distamycin. We present here the 1:1 solution structure of ImPy-beta-Im-beta-ImPy-beta-Dp bound in a single orientation to its match site within the DNA duplex 5'-CCAAAGAGAAGCG-3'.5'-CGCTTCTCTTTGG-3' (match site in bold), as determined by 2D (1)H NMR methods. The representative ensemble of 12 conformers has no distance constraint violations greater than 0.13 A and a pairwise RMSD over the binding site of 0.80 A. Intermolecular NOEs place the polyamide deep inside the minor groove, and oriented N-C with the 3'-5' direction of the purine-rich strand. Analysis of the high-resolution structure reveals the ligand bound 1:1 completely within the minor groove for a full turn of the DNA helix. The DNA is B-form (average rise=3.3 A, twist=38 degrees ) with a narrow minor groove closing down to 3.0-4.5 A in the binding site. The ligand and DNA are aligned in register, with each polyamide NH group forming bifurcated hydrogen bonds of similar length to purine N3 and pyrimidine O2 atoms on the floor of the minor groove. Each imidazole group is hydrogen bonded via its N3 atom to its proximal guanine's exocyclic amino group. The important roles of beta-alanine and imidazole for 1:1 binding are discussed.     

Effects of single-base bulges on intercalator binding to small RNA and DNA hairpins and a ribosomal RNA fragment

The way in which a single-base bulge might affect the structure of an RNA helix has been examined by preparing a series of six RNA hairpins, all with seven base pairs and a four-nucleotide loop. Five of the hairpins have single-base bulges at different positions. The intercalating cleavage reagent (methidiumpropyl)-EDTA-Fe(II) [MPE-Fe(II)] binds preferentially at a CpG sequence in the helix lacking a bulge and in four of the five hairpins with bulges. Hairpins with a bulge one or two bases to the 3' side of the CpG sequence bind ethidium 4-5-fold more strongly than the others. V1 RNase, which is sensitive to RNA backbone conformation in helices, detects a conformational change in all of the helices when ethidium binds; the most dramatic changes, involving the entire hairpin stem, are in one of the two hairpins with enhanced ethidium affinity. Only a slight conformational change is detected in the hairpin lacking a bulge. A bulge adjacent to a CpG sequence in a 100-nucleotide ribosomal RNA fragment enhances MPE-Fe(II) binding by an order of magnitude. These results extend our previous observations of bulges at a single position in an RNA hairpin [White, S. A., & Draper, D.E. (1987) Nucleic Acids Res. 15, 4049] and show that (1) a structural change in an RNA helix may be propagated for several base pairs, (2) bulges tend to increase the number of conformations available to a helix, and (3) the effects observed in small RNA hairpins are relevant to larger RNAs with more extensive structure. A bulge in a DNA hairpin identical in sequence with the RNA hairpins does not enhance MPE-Fe(II) binding affinity, relative to a control DNA hairpin. The effects of bulges on ethidium intercalation are evidently modulated by helix structure.     

Crystal structure of the 2:1 complex between d(GAAGCTTC) and the anticancer drug actinomycin D.

The crystal structures of the 2:1 complex of the self-complementary DNA octamer d(GAAGCTTC) with actinomycin D has been determined at 3.0 A resolution. This is the first example of a crystal structure of a DNA-drug complex in which the drug intercalates into the middle of a relatively long DNA segment. The results finally confirmed the DNA-actinomycin intercalation model proposed by Sobell & co-workers in 1971. The DNA molecule adopts a severely distorted and slightly kinked B-DNA-like structure with an actinomycin D molecule intercalated in the middle sequence, GC. The two cyclic depsipeptides, which differ from each other in overall conformation, lie in the minor groove. The complex is further stabilized by forming base-peptide and chromophore-backbone hydrogen bonds. The DNA helix appears to be unwound by rotating one of the base-pairs at the intercalation site. This single base-pair unwinding motion generates a unique asymmetrically wound helix at the binding site of the drug, i.e. the helix is loosened at one end of the intercalation site and tightened at the other end. The large unwinding of the DNA by the drug intercalation is absorbed mostly in a few residues adjacent to the intercalation site. The asymmetrical twist of the DNA helix, the overall conformation of the two cyclic depsipeptides and their interaction mode with DNA are correlated to each other and rationally explained.     

Mechanism of ATP-dependent translocation of E.coli UvrD monomers along single-stranded DNA

Escherichia coli UvrD protein is a 3' to 5' SF1 DNA helicase involved in methyl-directed mismatch repair and nucleotide excision repair of DNA. Using stopped-flow methods we have examined the kinetic mechanism of translocation of UvrD monomers along single-stranded DNA (ssDNA) in vitro by monitoring the transient kinetics of arrival of protein at the 5'-end of the ssDNA. Arrival at the 5'-end was monitored by the effect of protein on the fluorescence intensity of fluorophores (Cy3 or fluorescein) attached to the 5'-end of a series of oligodeoxythymidylates varying in length from 16 to 124 nt. We find that UvrD monomers are capable of ATP-dependent translocation along ssDNA with a biased 3' to 5' directionality. Global non-linear least-squares analysis of the full kinetic time-courses in the presence of a protein trap to prevent rebinding of free protein to the DNA using the methods described in the accompanying paper enabled us to obtain quantitative estimates of the kinetic parameters for translocation. We find that UvrD monomers translocate in discrete steps with an average kinetic step-size, m=3.68(+/-0.03) nt step(-1), a translocation rate constant, kt=51.3(+/-0.6) steps s(-1), (macroscopic translocation rate, mkt=189.0(+/-0.7) nt s(-1)), with a processivity corresponding to an average translocation distance of 2400(+/-600) nt before dissociation (10 mM Tris-HCl (pH 8.3), 20 mM NaCl, 20% (v/v) glycerol, 25 degrees C). However, in spite of its ability to translocate rapidly and efficiently along ssDNA, a UvrD monomer is unable to unwind even an 18 bp duplex in vitro. DNA helicase activity in vitro requires a UvrD dimer that unwinds DNA with a similar kinetic step-size of 4-5 bp step(-1), but an approximately threefold slower unwinding rate of 68(+/-9) bp s(-1) under the same solution conditions, indicating that DNA unwinding activity requires more than the ability to simply translocate directionally along ss-DNA.     

High-resolution three-dimensional structure of reduced recombinant human thioredoxin in solution

The solution structure of recombinant human thioredoxin (105 residues) has been determined by nuclear magnetic resonance (NMR) spectroscopy combined with hybrid distance geometry-dynamical simulated annealing calculations. Approximate interproton distance restraints were derived from nuclear Overhauser effect (NOE) measurements. In addition, a large number of stereospecific assignments for beta-methylene protons and torsion angle restraints for phi, psi, and chi 1 were obtained by using a conformational grid search on the basis of the intraresidue and sequential NOE data in conjunction with 3JHN alpha and 3J alpha beta coupling constants. The structure calculations were based on 1983 approximate interproton distance restraints, 52 hydrogen-bonding restraints for 26 hydrogen bonds, and 98 phi, 71 psi, and 72 chi 1 torsion angle restraints. The 33 final simulated annealing structures obtained had an average atomic rms distribution of the individual structures about the mean coordinate positions of 0.40 +/- 0.06 A for the backbone atoms and 0.78 +/- 0.05 A for all atoms. The solution structure of human thioredoxin consists of a five-stranded beta-sheet surrounded by four alpha-helices, with an active site protrusion containing the two redox-active cysteines. The overall structure is similar to the crystal and NMR structures of oxidized [Katti, S. K., LeMaster, D. M., & Eklund, H. (1990) J. Mol. Biol. 212, 167-184] and reduced [Dyson, J. H., Gippert, G. P., Case, D. A., Holmgren, A., & Wright, P. (1990) Biochemistry 29, 4129-4136] Escherichia coli thioredoxin, respectively, despite the moderate 25% amino acid sequence homology. Several differences, however, can be noted. The human alpha 1 helix is a full turn longer than the corresponding helix in E. coli thioredoxin and is characterized by a more regular helical geometry. The helix labeled alpha 3 in human thioredoxin has its counterpart in the 3(10) helix of the E. coli protein and is also longer in the human protein. In contrast to these structural differences, the conformation of the active site loop in both proteins is very similar, reflecting the perfect sequence identity for a stretch of eight amino acid residues around the redox-active cysteines.     

Physical characterization of a kinetoplast DNA fragment with unusual properties

A 414-base pair fragment from a Leishmania tarentolae kinetoplast DNA minicircle has unusual physical properties. We reported previously that in comparison to phi X174 and pBR322 control fragments, the kinetoplast fragment behaves in gel electrophoresis, gel filtration, and electric dichroism experiments as if it has an unusually compact conformation. We accounted for these unusual properties by proposing that the fragment is a systematically bent helix (Marini, J.C., Levene, S.D., Crothers, D.M., and Englund, P.T. (1982) Proc. Natl. Acad. Sci. U.S.A. 79, 7664-7668). In this paper, we further explore the properties of the kinetoplast fragment. Because of its compact conformation, the kinetoplast fragment has difficulty in snaking through polyacrylamide gels and therefore migrates unusually slowly in electrophoresis experiments. Warming (53 degrees C) and ethanol (5-20%) partially normalize gel migration; glyoxal treatment results in denatured strands with electrophoretic mobility close to that expected for their size. In vivo modification does not appear to be responsible for the fragment's properties; its anomalous electrophoretic behavior persists after proteinase K treatment, phenol extraction, or after cloning into pBR322 and reisolation. Velocity sedimentation experiments rule out fragment aggregation. Secondary structure, such as a cruciform, is not detectable by S1 or mung bean nuclease digestion. The kinetoplast fragment has circular dichroism spectra characteristic of a B-type helix. With increasing temperature, there is an increase in the 270/280 ellipticity ratio. Circular dichroism spectra taken in the presence of ethanol show a B to A helix transition at unusually low ethanol concentrations (between 44 and 54% (w/w]. Thermal denaturation reveals a triphasic melting curve.     

Molecular dynamics of an in vacuo model of duplex d(CGCGAATTCGCG) in the B-form based on the amber 3.0 force field.

The characteristics of 100 ps of molecular dynamics (MD) on the DNA dodecamer d(CGCGAATTCGCG) at 300 K are described and investigated. The simulation is based on an in vacuo model of the oligomer and the AMBER 3.0 force field configured in the manner of Singh, U. C., S. J. Weiner, and P. A. Kollman, (1985, Proc. Natl. Acad. Sci. USA. 82:755-759). The analysis of the results was carried out using the "curves, dials, and windows" procedure (Ravishanker, G., S. Swaminathan, D. L. Beveridge, R. Lavery, and H. Sklenar. 1989. J. Biomol. Struct. Dyn. 6:669-699). The results indicate this dynamical model to be a provisionally stable double helix which lies at approximately 3.2 A rms deviation from the canonical B-form. There is, however, a persistent nonplanarity in the base pair orientations which resemble that observed in canonical A-DNA. The major groove width is seen to narrow during the course of the simulation and the minor groove expands, contravariant to the alterations in groove width seen in the crystal structure of the native dodecamer (Drew, H. R., R. M. Wing, T. Takano, C. Broka, S. Tanaka, I. Itakura, and R. E. Dickerson, 1981. Proc. Natl. Acad. Sci. USA. 78:2179-2183). The propeller twist in the bases, the sequence dependence of the base pair roll and aspects of bending in the helix axis are in some degree of agreement with the crystal structure. The patterns in DNA bending are observed to follow Zhurkin theory (Zhurkin, V. B. 1985. J. Biomol. Struct. Dyn. 2:785-804.). The relationship between the dynamical model and structure in solution is discussed.     

Solution structure of the catalytic domain of gammadelta resolvase. Implications for the mechanism of catalysis

The site-specific DNA recombinase, gammadelta resolvase, from Escherichia coli catalyzes recombination of res site-containing plasmid DNA to two catenated circular DNA products. The catalytic domain (residues 1-105), lacking a C-terminal dimerization interface, has been constructed and the NMR solution structure of the monomer determined. The RMSD of the NMR conformers for residues 2-92 excluding residues 37-45 and 64-73 is 0.41 A for backbone atoms and 0.88 A for all heavy atoms. The NMR solution structure of the monomeric catalytic domain (residues 1-105) was found to be formed by a four-stranded parallel beta-sheet surrounded by three helices. The catalytic domain (residues 1-105), deficient in the C-terminal dimerization domain, was monomeric at high salt concentration, but displayed unexpected dimerization at lower ionic strength. The unique solution dimerization interface at low ionic strength was mapped by NMR. With respect to previous crystal structures of the dimeric catalytic domain (residues 1-140), differences in the average conformation of active-site residues were found at loop 1 containing the catalytic S10 nucleophile, the beta1 strand containing R8, and at loop 3 containing D67, R68 and R71, which are required for catalysis. The active-site loops display high-frequency and conformational backbone dynamics and are less well defined than the secondary structures. In the solution structure, the D67 side-chain is proximal to the S10 side-chain making the D67 carboxylate group a candidate for activation of S10 through general base catalysis. Four conserved Arg residues can function in the activation of the phosphodiester for nucleophilic attack by the S10 hydroxyl group. A mechanism for covalent catalysis by this class of recombinases is proposed that may be related to dimer interface dissociation.     

Interactions between an anthracycline antibiotic and DNA: molecular structure of daunomycin complexed to d(CpGpTpApCpG) at 1.2-A resolution

The crystal structure of a daunomycin-d(CGTACG) complex has been solved by X-ray diffraction analysis and refined to a final R factor of 0.175 at 1.2-A resolution. The crystals are in a tetragonal crystal system with space group P4(1)2(1)2 and cell dimensions of a = b = 27.86 A and c = 52.72 A. The self-complementary DNA forms a six base pair right-handed double helix with two daunomycin molecules intercalated in the d(CpG) sequences at either end of the helix. Daunomycin in the complex has a conformation different from that of daunomycin alone. The daunomycin aglycon chromophore is oriented at right angles to the long dimension of the DNA base pairs, and the cyclohexene ring A rests in the minor groove of the double helix. Substituents on this ring have hydrogen-bonding interactions to the base pairs above and below the intercalation site. O9 hydroxyl group of the daunomycin forms two hydrogen bonds with N3 and N2 of an adjacent guanine base. Two bridging water molecules between the drug and DNA stabilize the complex in the minor groove. In the major groove, a hydrated sodium ion is coordinated to N7 of the terminal guanine and the O4 and O5 of daunomycin with a distorted octahedral geometry. The amino sugar lies in the minor groove without bonding to the DNA. The DNA double helix is distorted with an asymmetrical rearrangement of the backbone conformation surrounding the intercalator drug. The sugar puckers are C1,C2'-endo, G2,C1'-endo, C11,C1'-endo, and G12,C3'-exo. Only the C1 residue has a normal anti-glycosyl torsion angle (chi = -154 degrees), while the other three residues are all in the high anti range (average chi = -86 degrees). This structure allows us to identify three principal functional components of anthracycline antibiotics: the intercalator (rings B-D), the anchoring functions associated with ring A, and the amino sugar. The structure-function relationships of daunomycin binding to DNA as well as other related anticancer drugs are discussed.     

Kinetics of an individual transmembrane helix during bacteriorhodopsin folding

The kinetics of an individual helix of bacteriorhodopsin have been monitored during folding of the protein into lipid bilayer vesicles. A fluorescence probe was introduced at individual sites throughout helix D of bacteriorhodopsin and the changes in the fluorescence of the label were time-resolved. Partially denatured, labelled bacteriorhodopsin in SDS was folded directly into phosphatidylcholine lipid vesicles. Stopped-flow mixing of the reactants allowed the folding kinetics to be monitored with millisecond time resolution by time-resolving changes in the label fluorescence, intrinsic protein fluorescence as well as in the absorption of the retinal chromophore. Monitoring specific positions on helix D showed that two kinetic phases were altered compared to those determined by monitoring the average protein behaviour. These two phases, of 6.7 s(-1) and 0.33 s(-1), were previously assigned to formation of a key apoprotein intermediate during bacteriorhodopsin folding. The faster 6.7s(-1) phase was missing when time-resolving fluorescence changes of labels attached to the middle of helix D. The amplitude of the 0.33 s(-1) phase increased along the helix, as single labels were attached in turn from the cytoplasmic to the extracellular side. An interpretation of these results is that the 6.7 s(-1) phase involves partitioning of helix D within the lipid headgroups of the bilayer vesicle, while the 0.33 s(-1) phase could reflect transmembrane insertion of this helix. In addition, a single site on helix G was monitored during folding. The results indicate that, unlike helix D, the insertion of helix G cannot be differentiated from the average protein behaviour. The data show that, while folding of bacteriorhodopsin from SDS into lipids is a co-operative process, it is nevertheless possible to obtain information on specific regions of a membrane protein during folding in vitro.     

The Fbx4 tumor suppressor regulates cyclin D1 accumulation and prevents neoplastic transformation

Skp1-Cul1-F-box (SCF) E3 ubiquitin ligase complexes modulate the accumulation of key cell cycle regulatory proteins. Following the G(1)/S transition, SCF(Fbx4) targets cyclin D1 for proteasomal degradation, a critical event necessary for DNA replication fidelity. Deregulated cyclin D1 drives tumorigenesis, and inactivating mutations in Fbx4 have been identified in human cancer, suggesting that Fbx4 may function as a tumor suppressor. Fbx4(+/-) and Fbx4(-/-) mice succumb to multiple tumor phenotypes, including lymphomas, histiocytic sarcomas and, less frequently, mammary and hepatocellular carcinomas. Tumors and premalignant tissue from Fbx4(+/-) and Fbx4(-/-) mice exhibit elevated cyclin D1, an observation consistent with cyclin D1 as a target of Fbx4. Molecular dissection of the Fbx4 regulatory network in murine embryonic fibroblasts (MEFs) revealed that loss of Fbx4 results in cyclin D1 stabilization and nuclear accumulation throughout cell division. Increased proliferation in early passage primary MEFs is antagonized by DNA damage checkpoint activation, consistent with nuclear cyclin D1-driven genomic instability. Furthermore, Fbx4(-/-) MEFs exhibited increased susceptibility to Ras-dependent transformation in vitro, analogous to tumorigenesis observed in mice. Collectively, these data reveal a requisite role for the SCF(Fbx4) E3 ubiquitin ligase in regulating cyclin D1 accumulation, consistent with tumor suppressive function in vivo.