Target sequences for hunchback in a control region conferring Ultrabithorax expression boundaries.

Boundaries of Ultrabithorax expression are mediated by long-range repression acting through the PBX or ABX control region. We show here that either of these control regions confers an early band of beta-galactosidase expression which is restricted along the anteroposterior axis of the blastoderm embryo. This band is succeeded by a stripe pattern with very similar anteroposterior limits. Dissection of the PBX control region demonstrates that the two patterns are conferred by distinct cis-regulatory sequences contained within separate PBX subfragments. We find several binding sites for hunchback protein within both PBX subfragments. Zygotic hunchback function is required to prevent ectopic PBX expression. Moreover, the PBX pattern is completely suppressed in embryos containing uniformly distributed maternal hunchback protein. Our results strongly suggest that hunchback protein directly binds to the PBX control region and acts as a repressor to specify the boundary positions of the PBX pattern.     

Motifs and cis-regulatory modules mediating the expression of genes co-expressed in presynaptic neurons

Background  

Hundreds of proteins modulate neurotransmitter release and synaptic plasticity during neuronal development and in response to synaptic activity. The expression of genes in the pre- and post-synaptic neurons is under stringent spatio-temporal control, but the mechanism underlying the neuronal expression of these genes remains largely unknown.     

Identification of pTi-SAKURA DNA region conferring enhancement of plasmid incompatibility and stability

In Agrobacterium tumefaciens, the stability of Ti plasmids differs depending on the strain. So far, little is known about genes that cause the difference in stability. The repABC operon is responsible for replication and incompatibility of Ti plasmids. We constructed recombinant plasmids carrying the repABC operon and different portions of pTi-SAKURA. Cells having the recombinant plasmids that harbored a 2.6-kbp NheI fragment of pTi-SAKURA were found to be transformed via conjugation 100-fold less frequently with a small incompatible repABC plasmid than cells having the recombinant plasmids lacking the 2.6-kbp NheI fragment. Since the phenomenon occurred only when the resident and incoming plasmids belonged to the same incompatibility group, it was suggested that the 2.6-kbp NheI fragment bears the potential enhancing incompatibility. The fragment contained an operon consisting of two open reading frames, tiorf24 and tiorf25. tiorf24 is an orphan gene, whereas tiorf25 is a homologue of a group of plasmid stability genes. Removal of the 2.6-kbp fragment from the resident pTi-SAKURA increased the resident plasmid ejection ratio by the incoming repABC plasmid, whereas addition of the fragment to pTiC58 decreased the ejection ratio, and the loss ratio during growth at 37 degrees C. These data suggest that tiorf24 and tiorf25 are responsible for the stability of pTi-SAKURA, and reduce, in the host bacterium, the frequency of ejection of the resident plasmid, presumably through an incompatibility mechanism.     

Identification of cis-elements conferring high levels of gene expression in non-green plastids

Although our knowledge about the mechanisms of gene expression in chloroplasts has increased substantially over the past decades, next to nothing is known about the signals and factors that govern expression of the plastid genome in non-green tissues. Here we report the development of a quantitative method suitable for determining the activity of cis-acting elements for gene expression in non-green plastids. The in vivo assay is based on stable transformation of the plastid genome and the discovery that root length upon seedling growth in the presence of the plastid translational inhibitor kanamycin is directly proportional to the expression strength of the resistance gene nptII in transgenic tobacco plastids. By testing various combinations of promoters and translation initiation signals, we have used this experimental system to identify cis-elements that are highly active in non-green plastids. Surprisingly, heterologous expression elements from maize plastids were significantly more efficient in conferring high expression levels in root plastids than homologous expression elements from tobacco. Our work has established a quantitative method for characterization of gene expression in non-green plastid types, and has led to identification of cis-elements for efficient plastid transgene expression in non-green tissues, which are valuable tools for future transplastomic studies in basic and applied research.     

Histone H1 subtype synthesis in neurons and neuroblasts.

Rat cerebral cortex neurons contain the five histone H1 subtypes H1a-e and the subtype H1 zero present in other mammalian somatic tissues. The four subtypes H1a-d decay exponentially during postnatal development and are partially or totally replaced by H1e that becomes the major H1 subtype in adults. H1 zero accumulates in a period restricted to neuronal terminal differentiation. Here we study the synthesis of the H1 subtypes in cortical neurons and their neuroblasts by in vivo labeling with [14C]lysine. The subtype synthesis pattern of neuroblasts has been determined by labeling gravid rats during the period of proliferation of cortical neurons and synthesis in neurons has been studied by postnatal labeling. The subtype H1a is synthesized in neuroblasts but not in neurons and is therefore rapidly removed from neuronal chromatin. The synthesis of H1b and H1d is much lower in neurons than in neuroblasts so that these subtypes are replaced to a large extent during postnatal development. H1c is synthesized at levels much higher than the other subtypes both in neurons and neuroblasts, but its very high turnover, about one order of magnitude faster than that of H1e in neurons, favors its partial replacement during postnatal development. Comparison of the synthesis rates of H1 zero in newborn and 30-day-old rats shows that the accumulation of H1 zero in differentiating neurons is due to an increased level of synthesis.     

Identification of an Rts1 DNA fragment conferring temperature-dependent instability to vector plasmids

The multiphenotypic drug resistance factor Rts1 expresses a temperature-dependent instability characteristic. This plasmid was digested with the restriction enzyme BamHI. A DNA fragment with a molecular weight of 5.6 MDa (the H fragment) was inserted into plasmid pBR322 (pFK896) or into pSC105 (pYH156) at the BamHI site. These plasmids were unstable at 42 degrees C but stable at 32 degrees C. A restriction-enzyme map of the H fragment was constructed and the instability phenotype (Tdi) was localized to a DNA fragment with 0.5 MDa molecular weight. The temperature-dependent loss of the unstable plasmid pFK896 is abrupt and no gradual plasmid loss of this multicopy recombinant plasmid is observed. The possibility that the Tdi phenotype is due to overgrowth of R- cells was eliminated.     

Precise cis-regulatory control of spatial and temporal expression of the alx-1 gene in the skeletogenic lineage of s. purpuratus

Deployment of the gene-regulatory network (GRN) responsible for skeletogenesis in the embryo of the sea urchin Strongylocentrotus purpuratus is restricted to the large micromere lineage by a double negative regulatory gate. The gate consists of a GRN subcircuit composed of the pmar1 and hesC genes, which encode repressors and are wired in tandem, plus a set of target regulatory genes under hesC control. The skeletogenic cell state is specified initially by micromere-specific expression of these regulatory genes, viz. alx1, ets1, tbrain and tel, plus the gene encoding the Notch ligand Delta. Here we use a recently developed high throughput methodology for experimental cis-regulatory analysis to elucidate the genomic regulatory system controlling alx1 expression in time and embryonic space. The results entirely confirm the double negative gate control system at the cis-regulatory level, including definition of the functional HesC target sites, and add the crucial new information that the drivers of alx1 expression are initially Ets1, and then Alx1 itself plus Ets1. Cis-regulatory analysis demonstrates that these inputs quantitatively account for the magnitude of alx1 expression. Furthermore, the Alx1 gene product not only performs an auto-regulatory role, promoting a fast rise in alx1 expression, but also, when at high levels, it behaves as an auto-repressor. A synthetic experiment indicates that this behavior is probably due to dimerization. In summary, the results we report provide the sequence level basis for control of alx1 spatial expression by the double negative gate GRN architecture, and explain the rising, then falling temporal expression profile of the alx1 gene in terms of its auto-regulatory genetic wiring.     

Identification of Simian virus 40 promoter DNA sequences capable of conferring restriction endonuclease hypersensitivity.

The simian virus 40 (SV40) DNA sequences found in the enhancer domain, nucleotides (nt) 103 to 177, and the early domain, nt 5149 to 5232, of the SV40 promoter have been analyzed for their ability to confer restriction endonuclease hypersensitivity in SV40 chromatin by using an SV40-based recombinant reporter system. The reporter system consists of a polylinker of various unique restriction endonuclease recognition sequences introduced into SV40 at nt 2666. We observed that the introduction of the enhancer domain at one end of the reporter and the early domain at the other end of the reporter resulted in a 20% increase in nuclease sensitivity within the reporter. In the enhancer domain, an element capable of conferring hypersensitivity was found between nt 114 and 124 with the sequence 5'CTGACTAATTG3', which has previously been shown to be the SV40 AP-1 binding site. In the early domain, an element capable of conferring hypersensitivity was localized to nt 5164 to 5187 and had the sequence 5'CATTTGCAAAGCTTTTTGCAAAAGC3'.     

Analysis of CD4 gene expression in human fetal brain and neuroblasts

1. The expression of the gene codifying for CD4, the most important human immunodeficiency virus type 1 (HIV-1) receptor molecule, was analyzed in 11 fetal brains at various gestational ages and in 9 human neuroblastoma (NB) cell lines. CD4 gene expression in fetal and malignant neural cells was then compared with that observed in a hematopoietic cell line and adult hippocampus. 2. In addition, CD4 mRNA was evaluated in two NB cell lines induced to differentiate in vitro with retinoic acid (RA) or 1-(5-isoquinolinyl-sulfonyl)-2-methyl piperazine (H7), a protein kinase C inhibitor. 3. All fetal brains and NB cell lines express a 1.8-kb signal when hybridized with pT4BcDNA probe, while a 3.0-kb signal such as observed in hematopoietic human cells was found in 1 of 11 fetal brains and in 0 of 9 NB cell lines. The 1.8-kb signal was lost in all analyzed poly(A)+ mRNA samples. 4. Moreover, CD4 gene expression was not induced in either RA- or H7-treated NB cells at any tested time and dose. The analysis of NB cells by polymerase chain reaction failed to demonstrate CD4 expression in either poly(A)+ or poly(A)- RNA. 5. In conclusion, the results show that the 1.8-kb signal observed in RNA extracted from fetal or transformed human neural cells is probably due to an aspecific hybridization. However, the gene codifying for CD4 can rarely be expressed by fetal brain cells early during gestation, in still unclear circumstances.     

Targeted ablation and reorganization of the principal preplate neurons and their neuroblasts identified by golli promoter transgene expression in the neocortex of mice

The present study delineates the cellular responses of dorsal pallium to targeted genetic ablation of the principal preplate neurons of the neocortex. Ganciclovir treatment during prenatal development (E11–E13; where E is embryonic day) of mice selectively killed cells with shared S-phase vulnerability and targeted expression of a GPT [golli promoter transgene, linked to HSV-TK (herpes simplex virus-thymidine kinase), τ-eGFP (τ-enhanced green fluorescent protein) and lacZ (lacZ galactosidase) reporters] localized in preplate neurons. Morphogenetic fates of attacked neurons and neuroblasts, and their successors, were assessed by multiple labelling in time-series comparisons between ablated (HSV-TK^+/0) and control (HSV-TK^0/0) littermates. During ablation generation, neocortical growth was suppressed, and compensatory reorganization of non-GPT ventricular zone progenitors of dorsal pallium produced replacements for killed GPT neuroblasts. Replacement and surviving GPT neuroblasts then produced replacements for killed GPT neurons. Near-normal restoration of their complement delayed the settlement of GPT neurons into the reconstituted preplate, which curtailed the outgrowth of pioneer corticofugal axons. Based on this evidence, we conclude that specific cell killing in ablated mice can eliminate a major fraction of GPT neurons, with insignificant bystander killing. Also, replacement GPT neurons in ablated mice originate exclusively by proliferation from intermediate progenitor GPT neuroblasts, whose complement is maintained by non-GPT progenitors for inductive regulation of the total complement of GPT neurons. Finally, GPT neurons in both normal and ablated mice meet all morphogenetic criteria, including the ‘outside-in’ vertical gradient of settlement, presently used to identify principal preplate neurons. In ablated mice, delayed organization of these neurons desynchronizes and isolates developing neocortex from the rest of the brain, and permanently impairs its connectivity.