G Protein–Coupled Receptor-Type G Proteins Are Required for Light-Dependent Seedling Growth and Fertility in Arabidopsis

G protein–coupled receptor-type G proteins (GTGs) are highly conserved membrane proteins in plants, animals, and fungi that have eight to nine predicted transmembrane domains. They have been classified as G protein–coupled receptor-type G proteins that function as abscisic acid (ABA) receptors in Arabidopsis thaliana. We cloned Arabidopsis GTG1 and GTG2 and isolated new T-DNA insertion alleles of GTG1 and GTG2 in both Wassilewskija and Columbia backgrounds. These gtg1 gtg2 double mutants show defects in fertility, hypocotyl and root growth, and responses to light and sugars. Histological studies of shoot tissue reveal cellular distortions that are particularly evident in the epidermal layer. Stable expression of GTG1_pro:GTG1-GFP (for green fluorescent protein) in Arabidopsis and transient expression in tobacco (Nicotiana tabacum) indicate that GTG1 is localized primarily to Golgi bodies and to the endoplasmic reticulum. Microarray analysis comparing gene expression profiles in the wild type and double mutant revealed differences in expression of genes important for cell wall function, hormone response, and amino acid metabolism. The double mutants isolated here respond normally to ABA in seed germination assays, root growth inhibition, and gene expression analysis. These results are inconsistent with their proposed role as ABA receptors but demonstrate that GTGs are fundamentally important for plant growth and development.     

A GxxxG-like Motif within HIV-1 Fusion Peptide Is Critical to Its Immunosuppressant Activity,Structure, and Interaction with the Transmembrane Domain of the T-cell Receptor

To thrive in the human body, HIV fuses to its target cell and evades the immune response via several mechanisms. The fusion cascade is initiated by the fusion peptide (FP), which is located at the N-terminal of gp41, the transmembrane protein of HIV. Recently, it has been shown that the HIV-1 FP, particularly its 5–13 amino acid region (FP_5–13), suppresses T-cell activation and interacts with the transmembrane domain (TMD) of the T-cell receptor (TCR) complex. Specific amino acid motifs often contribute to such interactions in TMDs of membrane proteins. Using bioinformatics and experimental studies, we report on a GxxxG-like motif (AxxxG), which is conserved in the FP throughout different clades and strains of HIV-1. Biological activity studies and FTIR spectroscopy revealed that HIV FP_5–13-derived peptides, in which the motif was altered either by randomization or by a single amino acid shift, lost their immunosuppressive activity concomitant with a loss of the β-sheet structure in a membranous environment. Furthermore, fluorescence studies revealed that the inactive mutants lost their ability to interact with their target site, namely, the TMD of TCRα, designated CP. Importantly, lipotechoic acid activated macrophages (lacking TCR) were not affected by FP, further demonstrating the specificity of the immunosuppressant activity of CP. Finally, although the AxxxG WT and the GxxxG analog both associated with the CP and immunosuppressed T-cells, the AxxxG WT but not the GxxxG analog induced lipid mixing. Overall, the data support an important role for the AxxxG motif in the function of FP and might explain the natural selection of the AxxxG motif rather than the classical GxxxG motif in FP.     

An Evolutionarily Conserved Arginine Is Essential for Tre1 G Protein-Coupled Receptor Function During Germ Cell Migration in Drosophila melanogaster

Background

G protein-coupled receptors (GPCRs) play central roles in mediating cellular responses to environmental signals leading to changes in cell physiology and behaviors, including cell migration. Numerous clinical pathologies including metastasis, an invasive form of cell migration, have been linked to abnormal GPCR signaling. While the structures of some GPCRs have been defined, the in vivo roles of conserved amino acid residues and their relationships to receptor function are not fully understood. Trapped in endoderm 1 (Tre1) is an orphan receptor of the rhodopsin class that is necessary for primordial germ cell migration in Drosophila melanogaster embryos. In this study, we employ molecular genetic approaches to identify residues in Tre1 that are critical to its functions in germ cell migration.

Methodology/Principal Findings

First, we show that the previously reported scattershot mutation is an allele of tre1. The scattershot allele results in an in-frame deletion of 8 amino acids at the junction of the third transmembrane domain and the second intracellular loop of Tre1 that dramatically impairs the function of this GPCR in germ cell migration. To further refine the molecular basis for this phenotype, we assayed the effects of single amino acid substitutions in transgenic animals and determined that the arginine within the evolutionarily conserved E/N/DRY motif is critical for receptor function in mediating germ cell migration within an intact developing embryo.

Conclusions/Significance

These structure-function studies of GPCR signaling in native contexts will inform future studies into the basic biology of this large and clinically important family of receptors.     

Isolation and Characterization of a Ferredoxin Gene from Arabidopsis thaliana

We report the cloning and characterization of an Arabidopsis thaliana (L.) Heynh. (Columbia ecotype) ferredoxin gene (Fed A). Sequence analysis of a genomic clone shows an intron-free, 444-base pair open reading frame which encodes a 96 amino acid mature ferredoxin polypeptide preceded by a 52 amino acid transit peptide. Comparison with other plant ferredoxin proteins suggests that Fed A encodes a leaf ferredoxin. Genomic Southern blot analysis indicates the presence of a second, weakly related gene, consistent with other reports of at least two ferredoxins in plants. The Fed A gene promoter contains two regions, ACGCCACGTGGTAGATAGGATT (G-I box) and CCACGCCATTTCCACAAGC (CCAC box), which are strongly conserved in both sequence and position between the Arabidopsis and pea ferredoxin genes. Similarities with other better characterized plant promoter elements are also discussed.     

Identification and sequence analysis of a rap gene from the true slime mold Physarum polycephalum

A member of the ras gene superfamily, belonging to the rap family and designated Pprap1, was isolated from a cDNA library from the true slime mold Physarum polycephalum by plaque hybridization in combination with 5′-RACE. The assembled nucleotide sequence of Pprap1 (1062 bp) has an open reading frame coding for a protein of 188 amino acids of a calculated M_r of 21035. This protein exhibits: (i) a highly conserved GTP binding domain containing a putative effector domain, with the threonine-for-glutamine substitution characteristic of rap proteins, (ii) a hypervariable domain, and (iii) the CAAX motif. Analysis of the C-terminal amino acid sequence of Pprap1 shows that it presumably undergoes geranylgeranylation but is not palmitoylated; however, it contains a lysine-rich domain which might serve as the second membrane localization signal. Pprap1 exhibits significantly high amino acid homology within the GTP binding domain with its homologues: Ddrap1 from Dictyostelium discoideum (92%) and human Rap1A (83%), and relatively low homology (59%) with the Saccharomyces cerevisiae homologue, RSR1. It has also 59% and 61% homology with the P. polycephalum Ppras1 and Ppras2 proteins, respectively. This gene is the third member of the ras gene superfamily identified in P. polycephalum so far.     

Regulation of G protein signaling by the 70 kDa heat shock protein

G protein-coupled receptors (GPCRs) transduce extracellular signals to the interior of the cell by activating membrane-bound guanine nucleotide-binding regulatory proteins (G proteins). An increasing number of proteins have been reported to bind to and regulate GPCRs. We report a novel regulation of the alpha_2A adrenergic receptor (α_2A-R) by the ubiquitous stress-inducible 70 kDa heat shock protein, hsp70. Hsp70, but not hsp90, attenuated G protein-dependent high affinity agonist binding to the α_2A-R in Sf9 membranes. Antagonist binding was unchanged, suggesting that hsp70 uncouples G proteins from the receptor. As hsp70 did not bind G proteins but complexed with the α_2A-R in intact cells, a direct interaction with the receptor seems likely. In the presence of hsp70, α_2A-R-catalyzed [³⁵S]GTPγS binding was reduced by approximately 70%. In contrast, approximately 50-fold higher concentrations of hsp70 were required to reduce agonist binding to the stress-inducible 5-hydroxytryptamine_1A receptor (5-HT_1A-R). In heat-stressed CHO cells, the α_2A-R was significantly uncoupled from G proteins, coincident with an increased localization of hsp70 at the membrane. The contrasting effect of hsp70 on the α_2A-R compared to the 5-HT_1A-R suggests that during stress, upregulation of hsp70 may attenuate signaling from specific GPCRs as part of the stress response to foster survival.     

A machine learning based method for the prediction of G protein-coupled receptor-binding PDZ domain proteins

G protein-coupled receptors (GPCRs) are part of multi-protein networks called ‘receptosomes’. These GPCR interacting proteins (GIPs) in the receptosomes control the targeting, trafficking and signaling of GPCRs. PDZ domain proteins constitute the largest protein family among the GIPs, and the predominant function of the PDZ domain proteins is to assemble signaling pathway components into close proximity by recognition of the last four C-terminal amino acids of GPCRs. We present here a machine learning based approach for the identification of GPCR-binding PDZ domain proteins. In order to characterize the network of interactions between amino acid residues that contribute to the stability of the PDZ domain-ligand complex and to encode the complex into a feature vector, amino acid contact matrices and physicochemical distance matrix were constructed and adopted. This novel machine learning based method displayed high performance for the identification of PDZ domain-ligand interactions and allowed the identification of novel GPCR-PDZ domain protein interactions.     

Genome-wide identification and abiotic stress responses of <Emphasis Type="Italic">DGK</Emphasis> gene family in maize

Diacylglycerol kinase (DGK) is a kind of phosphokinase that catalyzes the formation of signaling molecule phosphatidic acid. In this study, seven maize (Zea mays) DGK gene family members were identified by an exploration of maize genome via multiple online databases, and designated as ZmDGK1-7, respectively. The proteins encoded by ZmDGKs ranged from 487 to 716 amino acids, and had a molecular weight (MWs) between 54.6 and 80.2 kDa. Phylogenetic analysis revealed that ZmDGKs grouped into three clusters as described for known plant DGK families: Cluster I was composed of three maize DGKs, ZmDGK1, ZmDGK4 and ZmDGK5, cluster II contained ZmDGK6, and the isoforms ZmDGK2, ZmDGK3 and ZmDGK7 fell into cluster III. ZmDGK proteins featured the typical functional domains, while all seven ZmDGKs have a conserved catalytic domain DGKc, only the cluster I ZmDGKs have the DAG/PE binding domain. Most ZmDGK genes showed ubiquitous expression profiles at various developmental stages, while a high relative expression was observed at the tasseling stage. ZmDGK genes exhibited differential expression patterns in response to abiotic stresses including cold, salinity and drought, and all ZmDGK genes were found obviously up-regulated by cold. The distinct roles of ZmDGKs in cold response was also supported by the finding that an accumulation of DGK products–PA under low temperature. This study will help to better understand the roles of DGKs in the development and abiotic stress responses in major crops.     

A role for G proteins in plant hormone signalling?

The G protein signalling pathway is one of the most highly conserved mechanisms that enables cells to sense and respond to changes in their environment. Essential components of this are cell surface G protein-coupled receptors (GPCRs) that perceive extracellular ligands, and heterotrimeric G proteins (G proteins) that transduce information from activated GPCRs to down-stream effectors such as enzymes or ion channels. It is now clear from a range of biochemical and molecular studies that some potential G protein signalling components exist in plants. The best examples of these are the seven transmembrane receptor homologue GCR1 and the G_α (GPA1) and G_β (Gβ1) subunit homologues of heterotrimeric G proteins. G protein agonists and antagonists are known to influence a variety of signalling events in plants and have been used to implicate G proteins in a range of signalling pathways that include the plant hormones gibberellin and auxin. Furthermore, antisense suppression of GCR1 expression in Arabidopsis leads to a phenotype that supports a role for this receptor in cytokinin signalling. This review considers the current evidence for and against functional G protein signalling pathways in higher plants and questions whether or not these might be involved in the action of certain plant hormones.     

Adhesion GPCRs as a paradigm for understanding polycystin-1 G protein regulation

Polycystin-1, whose mutation is the most frequent cause of autosomal dominant polycystic kidney disease, is an extremely large and multi-faceted membrane protein whose primary or proximal cyst-preventing function remains undetermined. Accumulating evidence supports the idea that modulation of cellular signaling by heterotrimeric G proteins is a critical function of polycystin-1. The presence of a cis-autocatalyzed, G protein-coupled receptor (GPCR) proteolytic cleavage site, or GPS, in its extracellular N-terminal domain immediately preceding the first transmembrane domain is one of the notable conserved features of the polycystin-1-like protein family, and also of the family of cell adhesion GPCRs. Adhesion GPCRs are one of five families within the GPCR superfamily and are distinguished by a large N-terminal extracellular region consisting of multiple adhesion modules with a GPS-containing GAIN domain and bimodal functions in cell adhesion and signal transduction. Recent advances from studies of adhesion GPCRs provide a new paradigm for unraveling the mechanisms by which polycystin-1-associated G protein signaling contributes to the pathogenesis of polycystic kidney disease. This review highlights the structural and functional features shared by polycystin-1 and the adhesion GPCRs and discusses the implications of such similarities for our further understanding of the functions of this complicated protein.     

PH Domain-Arf G Protein Interactions Localize the Arf-GEF Steppke for Cleavage Furrow Regulation in Drosophila

The recruitment of GDP/GTP exchange factors (GEFs) to specific subcellular sites dictates where they activate small G proteins for the regulation of various cellular processes. Cytohesins are a conserved family of plasma membrane GEFs for Arf small G proteins that regulate endocytosis. Analyses of mammalian cytohesins have identified a number of recruitment mechanisms for these multi-domain proteins, but the conservation and developmental roles for these mechanisms are unclear. Here, we report how the pleckstrin homology (PH) domain of the Drosophila cytohesin Steppke affects its localization and activity at cleavage furrows of the early embryo. We found that the PH domain is necessary for Steppke furrow localization, and for it to regulate furrow structure. However, the PH domain was not sufficient for the localization. Next, we examined the role of conserved PH domain amino acid residues that are required for mammalian cytohesins to bind PIP3 or GTP-bound Arf G proteins. We confirmed that the Steppke PH domain preferentially binds PIP3 in vitro through a conserved mechanism. However, disruption of residues for PIP3 binding had no apparent effect on GFP-Steppke localization and effects. Rather, residues for binding to GTP-bound Arf G proteins made major contributions to this Steppke localization and activity. By analyzing GFP-tagged Arf and Arf-like small G proteins, we found that Arf1-GFP, Arf6-GFP and Arl4-GFP, but not Arf4-GFP, localized to furrows. However, analyses of embryos depleted of Arf1, Arf6 or Arl4 revealed either earlier defects than occur in embryos depleted of Steppke, or no detectable furrow defects, possibly because of redundancies, and thus it was difficult to assess how individual Arf small G proteins affect Steppke. Nonetheless, our data show that the Steppke PH domain and its conserved residues for binding to GTP-bound Arf G proteins have substantial effects on Steppke localization and activity in early Drosophila embryos.     

A leucine-rich repeat region is conserved in pollen extensin-like (Pex) proteins in monocots and dicots

We previously isolated a pollen-specific gene encoding a pollen tube wall-associated glycoprotein with a globular domain and an extensin domain from maize (mPex1). To evaluate which protein domains might be important for function, we isolated a second monocot gene (mPex2) and a dicot gene (tPex). Each gene encodes a signal sequence, an N-terminal globular domain comprised of a variable region, a leucine-rich repeat (LRR) with an adjacent cysteine-rich region, a transition region and an extensin-like C-terminal domain. The LRRs of the maize and tomato Pex proteins are highly conserved. Although the extensin domains in the maize and tomato proteins vary in length and in amino acid sequence, they are likely to be structurally conserved. Additional putative Pex gene sequences were identified by either GenBank search (Arabidopsis) or PCR (sorghum and potato); all encode conserved LRRs. The presence of a conserved LRR in the known and potential Pex proteins strongly suggests that this motif is involved in the binding of a specific ligand during pollen tube growth. Gene expression studies using RNA and protein blotting as well as promoter-reporter gene fusions in transient and stable transformation indicate that the tomato Pex gene is pollen-specific.     

Sensing and transduction of nutritional and chemical signals in filamentous fungi: Impact on cell development and secondary metabolites biosynthesis

Filamentous fungi respond to hundreds of nutritional, chemical and environmental signals that affect expression of primary metabolism and biosynthesis of secondary metabolites. These signals are sensed at the membrane level by G protein coupled receptors (GPCRs). GPCRs contain usually seven transmembrane domains, an external amino terminal fragment that interacts with the ligand, and an internal carboxy terminal end interacting with the intracellular G protein. There is a great variety of GPCRs in filamentous fungi involved in sensing of sugars, amino acids, cellulose, cell-wall components, sex pheromones, oxylipins, calcium ions and other ligands. Mechanisms of signal transduction at the membrane level by GPCRs are discussed, including the internalization and compartmentalisation of these sensor proteins. We have identified and analysed the GPCRs in the genome of Penicillium chrysogenum and compared them with GPCRs of several other filamentous fungi. We have found 66 GPCRs classified into 14 classes, depending on the ligand recognized by these proteins, including most previously proposed classes of GPCRs. We have found 66 putative GPCRs, representatives of twelve of the fourteen previously proposed classes of GPCRs, depending on the ligand recognized by these proteins. A staggering fortytwo putative members of the new GPCR class XIV, the so-called Pth11 sensors of cellulosic material as reported for Neurospora crassa and some other fungi, were identified. Several GPCRs sensing sex pheromones, known in yeast and in several fungi, were also identified in P. chrysogenum, confirming the recent unravelling of the hidden sexual capacity of this species. Other sensing mechanisms do not involve GPCRs, including the two-component systems (HKRR), the HOG signalling system and the PalH mediated pH transduction sensor. GPCR sensor proteins transmit their signals by interacting with intracellular heterotrimeric G proteins, that are well known in several fungi, including P. chrysogenum. These G proteins are inactive in the GDP containing heterotrimeric state, and become active by nucleotide exchange, allowing the separation of the heterotrimeric protein in active Gα and Gβγ dimer subunits. The conversion of GTP in GDP is mediated by the endogenous GTPase activity of the G proteins. Downstream of the ligand interaction, the activated Gα protein and also the Gβ/Gγ dimer, transduce the signals through at least three different cascades: adenylate cyclase/cAMP, MAPK kinase, and phospholipase C mediated pathways.     

Characterization of a Gene Coding for the Complement System Component FB from Loxosceles laeta Spider Venom Glands

The human complement system is composed of more than 30 proteins and many of these have conserved domains that allow tracing the phylogenetic evolution. The complement system seems to be initiated with the appearance of C3 and factor B (FB), the only components found in some protostomes and cnidarians, suggesting that the alternative pathway is the most ancient. Here, we present the characterization of an arachnid homologue of the human complement component FB from the spider Loxosceles laeta. This homologue, named Lox-FB, was identified from a total RNA L. laeta spider venom gland library and was amplified using RACE-PCR techniques and specific primers. Analysis of the deduced amino acid sequence and the domain structure showed significant similarity to the vertebrate and invertebrate FB/C2 family proteins. Lox-FB has a classical domain organization composed of a control complement protein domain (CCP), a von Willebrand Factor domain (vWFA), and a serine protease domain (SP). The amino acids involved in Mg²⁺ metal ion dependent adhesion site (MIDAS) found in the vWFA domain in the vertebrate C2/FB proteins are well conserved; however, the classic catalytic triad present in the serine protease domain is not conserved in Lox-FB. Similarity and phylogenetic analyses indicated that Lox-FB shares a major identity (43%) and has a close evolutionary relationship with the third isoform of FB-like protein (FB-3) from the jumping spider Hasarius adansoni belonging to the Family Salcitidae.     

A GAIN in understanding autoproteolytic G protein-coupled receptors and polycystic kidney disease proteins

EMBO J 31 6, 1364–1378 (2012); published online January142012A large and poorly understood class of G protein-coupled receptors (GPCRs) are involved in cell adhesion and contain an autoproteolytic site known as the GPCR proteolysis site (GPS) located immediately N-terminal to the first transmembrane span. This motif of ∼50 amino acids is also found juxtaposed to the first transmembrane span of an unrelated family of proteins associated with polycystic kidney disease (PKD), but its structural and functional roles were not clear. In this issue of The EMBO Journal, Arac et al use X-ray crystallography to show that the GPS motif is merely the C-terminal end of a much larger GPCR autoproteolysis inducing (GAIN) domain. Atomic models for two of these ancient domains allow one to map the sites of mutations associated with cancer or PKD, and hint at functional roles other than autoproteolysis.Autoproteolysis occurs in a wide variety of proteins where it typically leads to an essential structural reorganization or the release of an activated fragment. One such autoproteolytic site, called the GPS motif, is found in cell-adhesion GPCRs (Ichtchenko et al, 1999). Like other GPCRs, cell-adhesion GPCRs contain a heptahelical transmembrane domain that is expected to couple with heterotrimeric G proteins inside the cell. However, they also have unusually complex and diverse extracellular regions that contain domains homologous to those typically involved in cell adhesion (Yona et al, 2008).The extracellular regions of cell-adhesion GPCRs all contain a conserved stalk region that ends in the GPS motif, which is cleaved in the endoplasmic reticulum just after protein synthesis. Araç et al (2012) crystallized the stalk region (∼320 amino acids) along with the preceding HormR domain (∼70 amino acids) of two different cell-adhesion GPCRs: latrophilin (also called CIRL1 or CL1) and brain angiogenesis inhibitor 3 (BAI3). The resulting structures demonstrate that the stalk and GPS motif together form a large domain with α-helical and β-sandwich subdomains (Figure 1). The site of autoproteolysis, defined by the consensus sequence HL↓(T/S), occurs in a tight turn between the last two β strands of the domain. Because the entire domain was required for autoproteolysis, the authors renamed the stalk and GPS motif the GAIN domain. Sequence analysis supports the existence of a similar domain in all cell-adhesion GPCRs and homologues of polycystic kidney disease 1 (PKD1 or polycystin-1).Open in a separate windowFigure 1The conserved structural core of the extracellular regions of cell-adhesion GPCRs, as revealed by new structures of latrophilin and BAI3. Arac et al revealed that regions formerly known as the stalk and the GPCR autoproteolyic site (GPS) fold into a single GAIN domain that is conserved in all 33 mammalian cell-adhesion GPCRs and in proteins related to PKD1. The GAIN domain catalyses its own proteolysis in a tight turn between the last two strands of the domain. The α-helical subdomain of the GAIN domains of latrophilin and BAI3 interacts with a HormR domain, although this domain is not found in all cell-adhesion GPCRs. However, this interdomain contact, and/or a direct interaction with the transmembrane helical bundle, may allow the GAIN domain to autoinhibit transmembrane signalling to heterotrimeric G proteins or other factors inside the cell.For reasons that are not clear, the latrophilin GAIN domain used in this study was cleaved, whereas that of BAI3 was not. However, this allowed Araç et al to compare structures of wild-type GAIN domains before and after autoproteolysis. Before cleavage, the scissile bond exists in a strained conformation, and the position of adjacent catalytic residues is consistent with an Ntn hydrolase mechanism (Brannigan et al, 1995; Lin et al, 2004). After cleavage, the cleaved fragment (the β13 strand) appears firmly anchored within the GAIN domain by extensive backbone hydrogen bonds and hydrophobic interactions.But what is the functional role of autoproteolysis? Early work suggested that it may be required for efficient membrane transport because mutation of residues in the GPS motif were known to impair proper membrane trafficking (Krasnoperov et al, 2002). However, other studies, including that of Araç et al, have shown that this is not always the case (Qian et al, 2002). More likely, mutations in the core of the GAIN domain lead to protein folding defects, which would in turn impair trafficking (Lin et al, 2004). Autoproteolysis may therefore represent a mechanism by which the GAIN domain is locked into its functional and presumably more stable state after proper folding occurs. For this reason, it would be interesting to determine the relative thermostability of a GAIN domain before and after cleavage. Still, there remains evidence that GAIN domain autocleavage has functional consequences. Mice that express non-cleavable PKD1 exhibit abnormal kidney development (Yu et al, 2007). Comparison of the latrophilin and BAI3 GAIN domain structures also reveals a subtle conformational change in the β13 strand after cleavage that could, in principle, impact the ability of the domain to interact with other signalling domains. Finally, it has been reported that the cleaved extracellular region of latrophilin is dissociable from its transmembrane domain, and that ligand-induced reassociation may play a role in signalling (Silva and Ushkaryov, 2010).The GAIN domains of latrophilin and BAI homologues are mutated in human cancer, whereas the PKD1 GAIN domain is frequently mutated in autosomal dominant PKD (ADPKD). Most of the cancer-associated mutations map to the surface of the GAIN domain and did not affect autoproteolysis, implying that they disrupt the intermolecular contacts of the domain. In support of this idea, the authors showed that the latrophilin GAIN domain is the binding site for the black widow toxin α-latrotoxin. In contrast, most of the ADPKD mutations in the PKD1 GAIN domain interfered with autoproteolysis and/or protein folding, hinting at a different role for the domain in PKD1-related proteins. Furthermore, the GAIN domains of latrophilin and BAI3 interact with the preceding HormR domain in a manner that would block the interaction of homologous HormR domains with hormones. The GAIN domain may therefore serve to autoinhibit signalling activity, either by blocking the interactions of other extracellular domains or, in the case of cell-adhesion GPCRs, by modulating the activity of the adjacent seven transmembrane bundle (Figure 1). Indeed, truncation of the N-terminus of GPR56, including the bulk of the GAIN domain, leads to constitutive activation (Paavola et al, 2011). Thus, the structural stage is now set for studies aimed at understanding the molecular basis for signal transduction through cell-adhesion GPCRs and PKD1 proteins, and how defects in these proteins lead to disease.     

Isolation, molecular cloning and antimicrobial activity of novel defensins from common chickweed (Stellaria media L.) seeds

Two novel highly homologous defensins, Sm-AMP-D1 and Sm-AMP-D2, were isolated from seeds of common chickweed Stellaria media L. (family Cariophyllaceae). They show sequence homology to defensins of the Brassicaceae plants and display strong inhibitory activity against phytopathogenic fungi and oomycetes in the micromolar range (IC₅₀ ≤ 1 μM). The cDNA sequences coding for Sm-AMP-D1 and Sm-AMP-D2 were obtained. They code for highly homologous precursor proteins, consisting of a signal peptide of 32 amino acid residues and the mature peptide domain of 50 amino acid residues. The Sm-AMP-D1 and Sm-AMP-D2 precursors differ by two amino acids: one in the signal peptide region, and the other, in the mature peptide domain. Two Sm-D1-encoding genes were identified in S. media genome by PCR amplification from the genomic DNA using Sm-D1-specific primers. They contain a single 599-bp intron in the signal peptide domain and differ from each other by nucleotide substitutions in the intron and 3′-untranslated regions, while the coding sequences are well conserved. One of the genes matched perfectly the sm-D1 cDNA sequence. The sm-D genes show promise for engineering pathogen resistance in crops and expand our knowledge on weed genomics.