Mutational analysis of the Myxococcus xanthus Omega4400 promoter region provides insight into developmental gene regulation by C signaling

Myxococcus xanthus utilizes extracellular signals during development to coordinate cell movement, differentiation, and changes in gene expression. One of these signals, the C signal, regulates the expression of many genes, including Omega4400, a gene identified by an insertion of Tn5 lac into the chromosome. Expression of Tn5 lac Omega4400 is reduced in csgA mutant cells, which fail to perform C signaling, and the promoter region has several sequences similar to sequences found in the regulatory regions of other C-signal-dependent genes. One such gene, Omega4403, depends absolutely on the C signal for expression, and its promoter region has been characterized previously by mutational analysis. To determine if the similar sequences within the Omega4400 and Omega4403 regulatory regions function in the same way, deletion analysis and site-directed mutagenesis of the Omega4400 promoter region were performed. A 7-bp sequence centered at -49 bp, termed a C box, is identical in the Omega4400 and Omega4403 promoter regions, yet mutations in the individual base pairs affected expression from the two promoters very differently. Also, a single-base-pair change within a similar 5-bp element, which is centered at -61 bp in both promoter regions, had very different effects on the activities of the two promoters. Further mutational analysis showed that two regions are important for Omega4400 expression; one region, from -63 to -31 bp, is required for Omega4400 expression, and the other, from -86 to -81 bp, exerts a two- to fourfold effect on expression and is at least partially responsible for the C signal dependence of the Omega4400 promoter. Mutations in sigD and sigE, which are genes that encode sigma factors, abolished and reduced Omega4400 expression, respectively. Expression of Omega4400 in actB or actC mutants correlated well with the altered levels of C signal produced in these mutants. Our results provide the first detailed analysis of an M. xanthus regulatory region that depends partially on C signaling for expression and indicate that similar DNA sequences in the Omega4400 and Omega4403 promoter regions function differently.     

Mutational analysis of the Myxococcus xanthus Omicron4499 promoter region reveals shared and unique properties in comparison with other C-signal-dependent promoters

The bacterium Myxococcus xanthus undergoes multicellular development during times of nutritional stress and uses extracellular signals to coordinate cell behavior. C-signal affects gene expression late in development, including that of Omega4499, an operon identified by insertion of Tn5 lac into the M. xanthus chromosome. The Omega4499 promoter region has several sequences in common with those found previously to be important for expression of other C-signal-dependent promoters. To determine if these sequences are important for Omega4499 promoter activity, the effects of mutations on expression of a downstream reporter gene were tested in M. xanthus. Although the promoter resembles those recognized by Escherichia coli sigma(54), mutational analysis implied that a sigma(70)-type sigma factor likely recognizes the promoter. A 7-bp sequence known as a C box and a 5-bp element located 6 bp upstream of the C box have been shown to be important for expression of other C-signal-dependent promoters. The Omega4499 promoter region has C boxes centered at -33 and -55 bp, with 5-bp elements located 7 and 8 bp upstream, respectively. A multiple-base-pair mutation in any of these sequences reduced Omega4499 promoter activity more than twofold. Single base-pair mutations in the C box centered at -33 bp yielded a different pattern of effects on expression than similar mutations in other C boxes, indicating that each functions somewhat differently. An element from about -81 to -77 bp exerted a twofold positive effect on expression but did not appear to be responsible for the C-signal dependence of the Omega4499 promoter. Mutations in sigD and sigE, which are genes that encode sigma factors, reduced expression from the Omega4499 promoter. The results provide further insight into the regulation of C-signal-dependent genes, demonstrating both shared and unique properties among the promoter regions so far examined.     

Mutational analysis of the fruA promoter region demonstrates that C-Box and 5-base-pair elements are important for expression of an essential developmental gene of Myxococcus xanthus

Myxococcus xanthus uses extracellular signals during development to regulate gene expression. C-signaling regulates the expression of many genes induced after 6 h into development. FruA is a protein that is necessary for cells to respond to C-signaling, but expression of the fruA gene does not depend on C-signaling. Yet the fruA promoter region has a C box and a 5-bp element, similar to the promoter regions of several C-signal-dependent genes, where these sequences are crucial. Here, we show that the C box and 5-bp elements are important for expression of fruA, demonstrating for the first time that these sequences play a role in the expression of a gene that does not depend on C-signaling and is required for M. xanthus development.     

Relevance of UP elements for three strong Bacillus subtilis phage phi29 promoters

Various Escherichia coli promoters contain, in addition to the classical -35 and -10 hexamers, a third recognition element, named the UP element. Located upstream of the -35 box, UP elements stimulate promoter activity by forming a docking site for the C-terminal domain of the RNA polymerase alpha subunit (alphaCTD). Accumulating genetic, biochemical and structural information has provided a detailed picture on the molecular mechanism underlying UP element-dependent promoter stimulation in E.coli. However, far less is known about functional UP elements of Bacillus subtilis promoters. Here we analyse the strong early sigma(A)-RNA polymerase-dependent promoters C2, A2c and A2b of the lytic B.subtilis phage phi29. We demonstrate that the phage promoters contain functional UP elements although their contribution to promoter strength is very different. Moreover, we show that the UP element of the A2b promoter, being critical for its activity, is located further upstream of the -35 box than most E.coli UP elements. The importance of the UP elements for the phage promoters and how they relate to other UP elements are discussed.     

Identification of basal and cyclic AMP regulatory elements in the promoter of the phosphoenolpyruvate carboxykinase gene.

Promoter elements important for basal and cyclic AMP (cAMP)-regulated expression of the phosphoenolpyruvate carboxykinase (PEPCK) gene have been identified by analysis of a series of PEPCK promoter mutations in transfection experiments. Fusion genes containing wild-type and mutated PEPCK promoter sequences from -600 to +69 base pairs (bp) fused to the coding sequence for chloramphenicol acetyltransferase were studied. Internal deletion mutations that replaced specific bases with a 10-bp linker within the region from -129 bp to -18 bp of the PEPCK promoter were examined. In addition, wild-type and mutated DNA templates were used as probes in DNase I protection experiments to determine sites of protein-DNA interaction. The PEPCK promoter contains a binding site for nuclear factor 1-CAAT. Deletion of the 5' end of this binding site reduced the size of the DNase I footprint in this region but had no effect on promoter activity. In contrast, deletion or disruption of the 3' end of this binding site completely eliminated protein binding and reduced promoter activity by 50%. Deletion of core sequences of the cAMP regulatory element (CRE) resulted in loss of cAMP responsiveness and an 85% decrease in basal promoter activity, indicating that the CRE also functions as a basal stimulatory element. Mutation of the core sequence of the CRE resulted in loss of the DNase I footprint over the CRE. Internal deletions flanking the CRE showed no loss of induction by cAMP but did have reduced promoter activity. This delimits the CRE to an 18-bp region between nucleotides -100 and -82. Analysis of mutations that disrupted bases between the CRE and the initiation site identified a basal inhibitory element adjacent to a basal stimulatory element, both located just 3' of the CRE, as well as a basal stimulatory element coincident with the TATA consensus sequence centered at -27. These data demonstrate that several cis-acting elements are located within 130 nucleotides of the initiation site of the PEPCK gene and that the CRE is essential for both basal promoter activity and cAMP-regulated expression of this gene.     

The vitamin D-responsive element in the rat bone Gla protein gene is an imperfect direct repeat that cooperates with other cis-elements in 1,25-dihydroxyvitamin D3- mediated transcriptional activation.

The gene for rat bone gla protein (BGP) was isolated and 1250 basepairs (bp), including 1100 bp of 5' flanking DNA, were placed up-stream of the human GH reporter gene. After transient transfection into the osteoblast-like rat osteosarcoma cell line ROS 17/2.8, the BGP promoter demonstrated a low level of basal activity that was increased approximately 10-fold by the addition of 10(-8) M 1,25-dihydroxyvitamin D3 [1,25-(OH)2D3]. A single 250-bp fragment (-523 to -274) was sufficient to confer hormone inducibility upon both heterologous and homologous promoters. Deletion studies, complemented by evaluation with synthetic oligomers, enabled localization of the 1,25-(OH)2D3 response element to within 19 bp (-456 to -438), containing an element with an imperfect direct repeat [GGTGA(N4)GGACA] and homology to other steroid-responsive elements. Gel retardation assays demonstrated that partially purified chick intestinal 1,25-(OH)2D3 receptor bound specifically and with high affinity to a DNA fragment containing the putative 1,25-(OH)2D3 response element, and this binding was perturbed by monoclonal antibodies to the 1,25-(OH)2D3 receptor. Surprisingly, the 250-bp fragment, when linked in an antisense orientation with respect to the BGP promoter, blocked basal and hormone-dependent gene expression. However, a 246-bp fragment 5' to the 250-bp element (-1100 to -855) restored 20-fold inducibility when linked to the first fragment in the same orientation, suggesting cooperativity between at least two elements to achieve the hormonal regulation observed in this gene.     

A jasmonate-responsive element within the A. thaliana vsp1 promoter

The vsp1 gene of Arabidopsis thaliana encodes a storage protein that accumulates in vegetative organs. Transgenic plants expressing a vsp1 promoter-gus (beta-glucuronidase) gene fusion were found to contain high GUS activity when challenged with jasmonate, a volatile plant hormone. The induction of vsp1-gus expression by jasmonate could be measured in tobacco mesophyll protoplasts, after transient expression. A number of deletions were operated in the vsp1 promoter in order to locate its jasmonate-responsive element. A 41 bp sequence taken approximately 150 bp upstream of the vsp1 TATA box could confer jasmonate responsiveness upon a short CaMV 35S promoter. Whereas the deletion of a CAAT box-like element within the 41 bp sequence did not affect promoter activity, mutation of a short palindromic motif completely abolished jasmonate responsiveness. This motif shows no homology with the jasmonate-responsive elements of other promoters.     

A negative regulatory element (base pairs -204 to -177) of the EICP0 promoter of equine herpesvirus 1 abolishes the EICP0 protein's trans-activation of its own promoter

The early EICP0 protein is a powerful trans-activator that activates all classes of equine herpesvirus 1 (EHV-1) promoters but, unexpectedly, trans-activates its own promoter very weakly. Transient transfection assays that employed constructs harboring deletions within the EICP0 promoter indicated that EICP0 cis-acting sequences within bp -224 to -158 relative to the first ATG abolished the EICP0 protein's trans-activation of its own promoter. When inserted into the promoters of other EHV-1 genes, this sequence also downregulated activation of the immediate-early IE(-169/+73), early thymidine kinase TK(-215/+97), and late glycoprotein K gK(-83/+14) promoters, indicating that the cis-acting sequence (-224 to -158) downregulated expression of representative promoters of all classes of EHV-1 genes and contains a negative regulatory element (NRE). To define the cis-acting element(s), three synthetic oligonucleotides (Na [bp -224 to -195], Nb [bp -204 to -177], and Nc [bp -185 to -156]) were synthesized and cloned upstream of the EICP0(-157/-21) promoter. Of the three synthetic sequences, only the Nb oligonucleotide caused the downregulation of the EICP0 promoter. The NRE was identified as a 28-bp element to lie at -204 to -177 that encompassed the sequence of ([-204]AGATACAGATGTTCGATAAATTGGAACC[-177]). Gel shift assays performed with mouse L-M, rabbit RK-13, and human HeLa cell nuclear extracts and gamma-(32)P-labeled wild-type and mutant NREs demonstrated that a ubiquitous nuclear protein(s) (NRE-binding protein, NREBP) binds specifically to a sequence (bp -193 to -183) in the NRE. The NREBP is also present in the nucleus of EHV-1-infected cells; however, the amount of NREBP in EHV-1-infected L-M cells that bound to the Nb oligonucleotide was reduced compared to that in uninfected L-M cells. Transient transfection assays showed that deletions or mutations within the NREBP-binding site abolished the NRE activity of the EICP0 promoter. These results suggested that the NREBP may mediate the NRE activity of the EICP0 promoter and may function in the coordinate expression of EHV-1 genes.