Interaction of antioxidant flavonoids with tRNA: intercalation or external binding and comparison with flavonoid-DNA adducts

Antioxidants are essential to good health. Flavonoids are powerful antioxidants, and prevent DNA damage. The antioxidative protections are related to their binding modes to a DNA duplex and complexation with free radicals in vivo. Recently we reported the interaction of flavonoids with DNA in vitro (Kanakis et al., J. Biomol. Struct. Dyn. 22, 719-724, 2005), where polyphenol different binding modes were discussed. The aim of this study was to examine the interaction of transfer RNA with quercetin (que), kaempferol (kae), and delphinidin (del) in aqueous solution at physiological conditions and to make a comparison with the corresponding pigment-DNA adducts. Constant tRNA concentration (6.25 mM) and various drug/RNA(phosphate) molar ratios of 1/48 to 1/8 were used. FTIR and UV-visible difference spectroscopic methods have been applied to determine the drug binding mode, the binding constants, and the effects of drug complexation on the stability and conformation of tRNA duplex. Both intercalative and external binding modes were observed. Structural analysis showed que, kae, and a del intercalate tRNA duplex with minor external binding to the major or minor groove and the backbone phosphate group with overall binding constants K (que) = 4.80 x 10(4) M(1), K (kae) = 4.65 x 10(4) M(1), and K (del) = 9.47 x 10(4) M(1). The stability of adduct formation is in the order of del > que > kae. A comparison with flavonoids-DNA adducts showed both intercalation and external bindings with the stability order K (que) = 7.25 x 10(4) M(1), K (kae) = 3.60 x 10(4) M(1), and K (del) = 1.66 x 10(4) M(1). Low flavonoid concentration induces helical stabilization, whereas high pigment content causes helix opening. A partial Bto A-DNA transition occurs at high drug concentration, while tRNA remains in the A-family structure.     

DNA Interaction with Naturally Occurring Antioxidant Flavonoids Quercetin,Kaempferol, and Delphinidin

Abstract

Flavonoids are strong antioxidants that prevent DNA damage. The anticancer and antiviral activities of these natural products are implicated in their mechanism of actions. However, there has been no information on the interactions of these antioxidants with individual DNA at molecular level. This study was designed to examine the interaction of quercetin (que), kaempferol (kae), and delphinidin (del) with calf-thymus DNA in aqueous solution at physiological conditions, using constant DNA concentration (6.5 mmol) and various drug/DNA(phosphate) ratios of 1/65 to 1. FTIR and UV-Visible difference spectroscopic methods are used to determine the drug binding sites, the binding constants and the effects of drug complexation on the stability and conformation of DNA duplex.

Structural analysis showed quercetin, kaempferol, and delphinidin bind weakly to adenine, guanine (major groove), and thymine (minor groove) bases, as well as to the backbone phosphate group with overall binding constants Kque = 7.25 × 10⁴M^?1, Kkae = 3.60 × 10⁴M^?1, and Kdel = 1.66 × 10⁴M^?1. The stability of adduct formation is in the order of que>kae>del. Delphinidin with a positive charge induces more stabilizing effect on DNA duplex than quercetin and kaempferol. A partial B to A-DNA transition occurs at high drug concentrations.     

An Overview of DNA and RNA Bindings to Antioxidant Flavonoids

In this report we are examining how the antioxidant flavonoids can prevent DNA damage and what mechanism of action is involved in the process. Flavonoids are strong antioxidants that prevent DNA damage. The anticancer and antiviral activities of these natural products are implicated in their mechanism of actions. We study the interactions of quercetin (que), kaempferol (kae), and delphinidin (del) with DNA and transfer RNA in aqueous solution at physiological conditions, using constant DNA or RNA concentration 6.25 mmol (phosphate) and various pigment/polynucleotide(phosphate) ratios of 1/65 to 1 (DNA) and 1/48 to 1/8 (tRNA). The structural analysis showed quercetin, kaempferol, and delphinidin intercalate DNA and RNA duplexes with minor external binding to the major or minor groove and the backbone phosphate group with overall binding constants for DNA adducts K _que = 7.25 (±0.65) × 10⁴ M⁻¹, K _kae = 3.60 (±0.33) × 10⁴ M^−1, and K _del = 1.66 (±0.25) × 10⁴ M⁻¹ and for tRNA adducts K _que = 4.80 (±0.50) × 10⁴ M⁻¹, K _kae = 4.65 (±0.45) × 10⁴ M^−1, and K _del = 9.47 (±0.70) × 10⁴ M⁻¹. The stability of adduct formation is in the order of del>que>kae for tRNA and que>kae>del for DNA. Low flavonoid concentration induces helical stabilization, whereas high pigment content causes helix opening. A partial B to A-DNA transition occurs at high drug concentration, while tRNA remains in A-family structure. The antioxidant activity of flavonoids changes in order delphinidin>quercetin>kaempferol. The results show intercalated flavonoids can make them strong antioxidants to protect DNA from harmful free radical reactions.     

DNA interaction with saffron's secondary metabolites safranal, crocetin, and dimethylcrocetin

Saffron comes from the dried red stigmas of the Crocus sativus L. flower. Except for its use in cooking and in traditional medicine, it has numerous applications as an antitoxic, antioxidant, and anticancer agent due to its secondary metabolites and their derivatives (safranal, crocins, crocetin, dimethylcrocetin). However, there has been no information on the interactions of these secondary metabolites with individual DNA at molecular level. This study was designed to examine the interaction of safranal, crocetin (CRT), and dimethylcrocetin (DMCRT) with calf-thymus DNA in aqueous solution at physiological conditions, using constant DNA concentration (6.25 mM) and various drug/DNA(phosphate) molar ratios from 1/48 to 1/2. FTIR and UV-visible difference spectroscopic methods are used to determine the drug binding sites, the binding constants, and the effects of carotenoids and safranal complexation on the stability and conformation of DNA duplex. Both intercalative and external binding modes were observed, with overall binding constants K(safranal) = 1.24 x 10(3) M(-1), K(CRT) = 6.2 x 10(3) M(-1) and K(DMCRT) = 1.85 x 10(5) M(-1) A partial B- to A-DNA transition occurs at high carotenoids and safranal concentrations.     

Structural analysis of DNA interactions with biogenic polyamines and cobalt(III)hexamine studied by Fourier transform infrared and capillary electrophoresis

Biogenic polyamines, such as putrescine, spermidine, and spermine are small organic polycations involved in numerous diverse biological processes. These compounds play an important role in nucleic acid function due to their binding to DNA and RNA. It has been shown that biogenic polyamines cause DNA condensation and aggregation similar to that of inorganic cobalt(III)hexamine cation, which has the ability to induce DNA conformational changes. However, the nature of the polyamine.DNA binding at the molecular level is not clearly established and is the subject of much controversy. In the present study the effects of spermine, spermidine, putrescine, and cobalt(III)hexamine on the solution structure of calf-thymus DNA were investigated using affinity capillary electrophoresis, Fourier transform infrared, and circular dichroism spectroscopic methods. At low polycation concentrations, putrescine binds preferentially through the minor and major grooves of double strand DNA, whereas spermine, spermidine, and cobalt(III)hexamine bind to the major groove. At high polycation concentrations, putrescine interaction with the bases is weak, whereas strong base binding occurred for spermidine in the major and minor grooves of DNA duplex. However, major groove binding is preferred by spermine and cobalt(III)hexamine cations. Electrostatic attractions between polycation and the backbone phosphate group were also observed. No major alterations of B-DNA were observed for biogenic polyamines, whereas cobalt(III)hexamine induced a partial B --> A transition. DNA condensation was also observed for cobalt(III)hexamine cation, whereas organic polyamines induced duplex stabilization. The binding constants calculated for biogenic polyamines are K(Spm) = 2.3 x 10(5) M(-1), K(Spd) = 1.4 x 10(5) M(-1), and K(Put) = 1.02 x 10(5) M(-1). Two binding constants have been found for cobalt(III)hexamine with K(1) = 1.8 x 10(5) M(-1) and K(2) = 9.2 x 10(4) M(-1). The Hill coefficients indicate a positive cooperativity binding for biogenic polyamines and a negative cooperativity for cobalt(III)hexamine.     

Binding of netropsin and 4,6-diamidino-2-phenylindole to an A2T2 DNA hairpin: a comparison of biophysical techniques

Isothermal titration calorimetry (ITC), differential scanning calorimetry (DSC), and biosensor-surface plasmon resonance (SPR) are evaluated for their accuracy in determining equilibrium constants, ease of use, and range of application. Systems chosen for comparison of the three techniques were the formation of complexes between two minor groove binding compounds, netropsin and 4,6-diamidino-2-phenylindole (DAPI), and a DNA hairpin having the sequence 5'-d(CGAATTCGTCTCCGAATTCG)-3'. These systems were chosen for their structural differences, simplicity (1:1 binding), and binding affinity in the range of interest (K approximately 10(8) M(-1)). The binding affinities determined from all three techniques were in excellent agreement; for example, netropsin/DNA formation constants were determined to be K = 1.7x10(8) M(-1) (ITC), K = 2.4x10(8) M(-1) (DSC), and K = 2.9x10(8) M(-1) (SPR). DSC and SPR techniques have an advantage over ITC in studies of ligands that bind with affinities greater than 10(8) M(-1). The ITC technique has the advantage of determining a full set of thermodynamic parameters, including deltaH, TdeltaS, and deltaC(p) in addition to deltaG (or K). The ITC data revealed complex binding behavior in these minor groove binding systems not detected in the other methods. All three techniques provide accurate estimates of binding affinity, and each has unique benefits for drug binding studies.     

DNA adducts with antioxidant flavonoids: morin, apigenin, and naringin

Flavonoids have recently attracted a great interest as potential therapeutic drugs against a wide range of free-radical-mediated diseases. The anticancer and antiviral activities of these natural products are implicated in their mechanism of actions. While the antioxidant activity of these natural polyphenolic compounds is well known, their bindings to DNA are not fully investigated. This study was designed to examine the interactions of morin (Mor), naringin (Nar), and apigenin (Api) with calf thymus DNA in aqueous solution at physiological conditions, using constant DNA concentration (6.25 mM) and various drug/DNA(phosphate) ratios of 1/40 to 1. FTIR and UV-Vis spectroscopic methods were used to determine the ligand binding modes, the binding constant, and the stability of DNA in flavonoid-DNA complexes in aqueous solution. Spectroscopic evidence shows both intercalation and external binding of flavonoids to DNA duplex with overall binding constants of K(morin) = 5.99 x 10(3) M(-1), K(apigenin) = 7.10 x 10(4) M(-1), and K(naringin) = 3.10 x 10(3) M(-1). The affinity of ligand-DNA binding is in the order of apigenin > morin > naringin. DNA aggregation and a partial B- to A-DNA transition occurs upon morin, apigenin, and naringin complexation.     

Interaction of tRNA with Safranal, Crocetin, and Dimethylcrocetin

Saffron is the red dried stigmas of Crocus sativus L. flowers and used both as a spice and as a drug in traditional therapeutic. The biological activity of saffron in modern medicine is in development. Its numerous applications as an anti-oxidant and anti-cancer agent are due to its secondary metabolites and their derivatives (safranal, crocins, crocetin, dimethylcrocetin). The aim of this study was to examine the interaction of transfer RNA with safranal, crocetin, and dimethylcrocetin in aqueous solution at physiological conditions. Constant tRNA concentration (6.25 mM) and various drug/tRNA (phosphate) molar ratios of 1/48 to 1/8 were used. FT-IR and UV-Visible difference spectroscopic methods have been applied to determine the drug binding mode, the binding constants and the effects of drug complexation on the stability and conformation of tRNA duplex. External binding mode was observed for safranal crocetin and dimethylcrocetin, with overall binding constants K(safranal) = 6.8 (+/- 0.34) x 10(3) M(-1), K(CRT) = 1.4 (+/- 0.31) x 10(4) M(-1), and K(DMCRT) = 3.4 (+/- 0.30) x 10(4) M(-1). Transfer RNA remains in the A-family structure, upon safranal, crocetin and dimethylcrocetin complexation.     

Study of DNA interactions with steroidal and nonsteroidal estrogen-platinum (II)-based anticancer drugs

The interactions of the steroidal and nonsteroidal estrogen-platinum (Pt) (II)-based anticancer drugs 16beta-hydroxymethyl-16alpha-[8-(2-pyridin-2-yl-ethylamino)-3,6-dioxaoctyl]-1,3,5(10)-estratrien-3,17betadiol dichloroplatinum (II) (JPM-39), 4-[6-(2'-pyridylethylamino)-butyloxy)-phenyl]-7-methoxy-2,2-dimethyl-3-phenyl-chroman dichloroplatinum (II) (ATG-99), and 1-[(2-aminoethyl)amino]-9,10,10-tris(4-hydroxyphenyl)-9-decene dichloroplatinum (II) (GEB-28) with calf-thymus DNA in vitro using constant DNA concentration and various drug levels were studied. Fourier transform infrared (FTIR) and circular dichroism (CD) were studied with calf-thymus DNA in vitro using constant DNA concentration and various drug levels. FTIR, UV-visible, and CD spectroscopic methods were used to characterize the drug binding mode, the binding constant, and structural variations of DNA in aqueous solution. Spectroscopic evidence showed that the various Pt-based drugs bind indirectly to the major and minor grooves of DNA duplex with some degree of drug-phosphate interaction. The overall binding constants for JPM-39, GEB-28, and ATG-99 are K(JPM-39) = 4.2 (+/-0.75) x 10(3) M(-1), K(GEB-28) = 3.4 (+/-0.65) x 10(3) M(-1), and K(ATG-99) = 2.1 (+/-0.45) x 10(3) M(-1). DNA aggregation occurs at high drug concentration, while DNA remains in the B-family structure.     

Electrochemical investigation on interaction between DNA with quercetin and Eu-Qu3 complex

The interactions of quercetin (Qu) and Eu-Qu3 complex with calf thymus DNA were studied using cyclic voltammetry (CV) and double potential step chronocoulometry (DPSCC) at glass carbon electrode (GCE) for the surface method. The method is simple, convenient, reliable, reagent saving. Information such as intrinsic binding constant (K), and binding numbers (n) of bound species per DNA (bp), ratio (K(Ox)/K(Red)) of the binding constants for the oxidized and reduced forms of a bound species and interaction mode was obtained using dsDNA-modified GCE. Quercetin and Eu-Qu3 can both bind to DNA, but quercetin binds to DNA mainly by electrostatic attraction and the complex bind to DNA by both intercalation and electrostatic attraction. For the quercetin/dsDNA-modified GCE systems, a K of (3.80+/-0.3) x 10(4) M(-1), saturation coverage value (Gammas) of (2.28+/-0.2) x 10(-10) mol/cm2 and n of 1.2 were obtained. For the complex system, a saturation coverage value (Gammas) of 1.65 x 10(-10) mol/cm2 and n of 1.8 were obtained.     

Minor groove binding DNA ligands with expanded A/T sequence length recognition, selective binding to bent DNA regions and enhanced fluorescent properties

DNA minor groove ligands provide a paradigm for double-stranded DNA recognition, where common structural motifs provide a crescent shape that matches the helix turn. Since minor groove ligands are useful in medicine, new ligands with improved binding properties based on the structural information about DNA-ligand complexes could be useful in developing new drugs. Here, two new synthetic analogues of AT specific Hoechst 33258 5-(4-methylpiperazin-1-yl)-2-[2'-(3,4-dimethoxyphenyl)-5'-benzimidazolyl] benzimidazole (DMA) and 5-(4-methylpiperazin-1-yl)-2-[2'[2'-(4-hydroxy-3-methoxyphenyl)-5' '-benzimidazolyl]-5'-benzimidazolyl] benzimidazole (TBZ) were evaluated for their DNA binding properties. Both analogues are bisubstituted on the phenyl ring. DMA contains two ortho positioned methoxy groups, and TBZ contains a phenolic group at C-4 and a methoxy group at C-3. Fluorescence yield upon DNA binding increased 100-fold for TBZ and 16-fold for DMA. Like the parent compound, the new ligands showed low affinity to GC-rich (K approximately 4 x 10(7) M(-1)) relative to AT-rich sequences (K approximately 5 x 10(8) M(-1)), and fluorescence lifetime and anisotropy studies suggest two distinct DNA-ligand complexes. Binding studies indicate expanded sequence recognition for TBZ (8-10 AT base pairs) and tighter binding (DeltaT(m) of 23 degrees C for d (GA(5)T(5)C). Finally, EMSA and equilibrium binding titration studies indicate that TBZ preferentially binds highly hydrated duplex domains with altered A-tract conformations d (GA(4)T(4)C)(2) (K= 3.55 x 10(9) M(-1)) and alters its structure over d (GT(4)A(4)C)(2) (K = 3.3 x 10(8) M(-1)) sequences. Altered DNA structure and higher fluorescence output for the bound fluorophore are consistent with adaptive binding and a constrained final complex. Therefore, the new ligands provide increased sequence and structure selective recognition and enhanced fluorescence upon minor groove binding, features that can be useful for further development as probes for chromatin structure stability.     

A comparative study of DNA complexation with Mg(II) and Ca(II) in aqueous solution: major and minor grooves bindings

Although structural differences for the Mg-DNA and Ca-DNA complexes are provided in the solid state, such comparative study in aqueous solution has been less investigated. The aim of this study was to examine the bindings of Mg and Ca cations with calf thymus DNA in aqueous solution at physiological pH, using constant concentration of DNA (1.25 or 12.5 mM) and various concentrations of metal ions (2 microM-650 microM). Capillary electrophoresis, UV-visible, and Fourier transform infrared spectroscopic methods were used to determine the cation-binding modes, the binding constants, and DNA structural variations in aqueous solution. Direct Ca-PO(2) binding was evident by major spectral changes (shifting and splitting) of the backbone PO(2) asymmetric stretching at 1222 cm(-1) with K = 4.80 x 10(5) M(-1), whereas an indirect Mg-phosphate interaction occurred (due to the lack of shifting and splitting of the phosphate band at 1222 cm(-1)) with K = 5.6 x 10(4) M(-1). The metal-base bindings were directly for the Mg with K = 3.20 x 10(5) M(-1) and indirectly for the Ca cation with K = 3.0 x 10(4) M(-1). Both major and minor groove bindings were observed with no alteration of the B-DNA conformation.     

Binding of 5,10,15,20-tetrakis(N-methylpyridinium-4-yl)-21H,23H-porphyrin to an AT-rich region of a duplex DNA

Characterization of the interaction between DNA and small organic compounds is of considerable importance for gaining insights into the mechanism underlying molecular recognition, which could be highly relevant to drug design. In the present study, the interaction of a water-soluble cationic porphyrin, 5,10,15,20-tetrakis(N-methylpyridinium-4-yl)-21H,23H-porphyrin, with a self-complementary duplex DNA, d(GCTTAAGC)2, has been investigated by means of absorption, circular dichroism, and NMR spectroscopies. The optical studies indicated that TMPyP binds to the TTAA region of d(GCTTAAGC)2 with a binding constant of 2.5 x 10(6) M(-1) and a stoichiometric ratio of 1:1. The observation of intermolecular nuclear Overhauser effect connectivities demonstrated that TMPyP binds in the major groove of d(GCTTAAGC)2. A model for the binding of TMPyP in the major groove of the AT-rich region of d(GCTTAAGC)2 is proposed.     

Cytotoxicity, DNA binding and localisation of novel bis-naphthalimidopropyl polyamine derivatives

Bis-naphthalimidopropyl spermidine (BNIPSpd), spermine (BNIPSpm) and oxa-spermine (BNIPOSpm) showed high in vitro cytotoxicity against human breast cancer MCF-7 cells with IC(50) values of 1.38, 2.91 and 8.45 microM, respectively. These compounds were found to effectively displace the intercalating agent ethidium bromide bound to the calf thymus DNA using fluorimetric methods (C(50) 0.08-0.12 microM) and their apparent equilibrium binding constants (K(app)) were calculated to be in the range of 10.5-18 x 10(7) M(-1). Furthermore, strong stabilisation of calf thymus DNA duplex in the presence of bis-naphthalimidopropyl polyamine derivatives (BNIPSpd, BNIPSpm and BNIPOSpm) was observed by UV spectrophotometric analysis (T(m)=93.3-97 degrees C compared with 75 degrees C for calf thymus DNA without drug). Because of their inherent fluorescence, these compounds were localised preferentially inside the nucleus as evidenced by their direct observation under the fluorescence microscope. The results obtained suggest that the cytotoxic activity of the bis-naphthalimidopropyl polyamines may be in part, caused by their effects on DNA.     

Chiral discrimination in binding of enantiomers of 2-(aminoalkoxy)-substituted 4-(2-thienyl)pyrimidines and 4,6-bis(2-thienyl)pyrimidines with duplex DNA

Thienylpyrimidines substituted at position 2 of the pyrimidine with a chiral aminoalkoxy group were synthesized. Upon interaction with duplex DNA, the unfused heteroaromatic system of these compounds intercalates with DNA base pairs and the protonated side chain is located in the major groove. The S-enantiomers bind more strongly than their R-counterparts with enantiomeric discrimination, as measured by a ratio of binding constants K(S)/K(R), ranging from 1.2 to 2.4.     

Relationship between the composition of flavonoids and flower colors variation in tropical water lily (Nymphaea) cultivars

Water lily, the member of the Nymphaeaceae family, is the symbol of Buddhism and Brahmanism in India. Despite its limited researches on flower color variations and formation mechanism, water lily has background of blue flowers and displays an exceptionally wide diversity of flower colors from purple, red, blue to yellow, in nature. In this study, 34 flavonoids were identified among 35 tropical cultivars by high-performance liquid chromatography (HPLC) with photodiode array detection (DAD) and electrospray ionization mass spectrometry (ESI-MS). Among them, four anthocyanins: delphinidin 3-O-rhamnosyl-5-O-galactoside (Dp3Rh5Ga), delphinidin 3-O-(2"-O-galloyl-6"-O-oxalyl-rhamnoside) (Dp3galloyl-oxalylRh), delphinidin 3-O-(6"-O-acetyl-β-glucopyranoside) (Dp3acetylG) and cyanidin 3- O-(2"-O-galloyl-galactopyranoside)-5-O-rhamnoside (Cy3galloylGa5Rh), one chalcone: chalcononaringenin 2'-O-galactoside (Chal2'Ga) and twelve flavonols: myricetin 7-O-rhamnosyl-(1 → 2)-rhamnoside (My7RhRh), quercetin 7-O-galactosyl-(1 → 2)-rhamnoside (Qu7GaRh), quercetin 7-O-galactoside (Qu7Ga), kaempferol 7-O-galactosyl-(1 → 2)-rhamnoside (Km7GaRh), myricetin 3-O-galactoside (My3Ga), kaempferol 7-O-galloylgalactosyl-(1 → 2)-rhamnoside (Km7galloylGaRh), myricetin 3-O-galloylrhamnoside (My3galloylRh), kaempferol 3-O-galactoside (Km3Ga), isorhamnetin 7-O-galactoside (Is7Ga), isorhamnetin 7-O-xyloside (Is7Xy), kaempferol 3-O-(3"-acetylrhamnoside) (Km3-3"acetylRh) and quercetin 3-O-acetylgalactoside (Qu3acetylGa) were identified in the petals of tropic water lily for the first time. Meanwhile a multivariate analysis was used to explore the relationship between pigments and flower color. By comparing, the cultivars which were detected delphinidin 3-galactoside (Dp3Ga) presented amaranth, and detected delphinidin 3'-galactoside (Dp3'Ga) presented blue. However, the derivatives of delphinidin and cyanidin were more complicated in red group. No anthocyanins were detected within white and yellow group. At the same time a possible flavonoid biosynthesis pathway of tropical water lily was presumed putatively. These studies will help to elucidate the evolution mechanism on the formation of flower colors and provide theoretical basis for outcross breeding and developing health care products from this plant.     

Metal ion-directed cooperative DNA binding of small molecules

Compound (1), which consists of an oxine and a pyridinium group, was synthesized as a metal-responsive DNA binding ligand. Two 1s coordinate to a Cu(II) to form a stable dimer (1(2)-Cu), even in the presence of DNA. The binding of 1 with sonicated calf thymus DNA was enhanced by ca. 10(3) times after forming the dimer; the binding constants were estimated to be 3.2 x 10(4)M(-1) and 2.4 x 10(7)M(-1) in the absence and the presence, respectively, of a half mole of Cu(II). The enormous acceleration of the binding is partly attributed to the generation of a dicationic charge by the formation of the dimer. High cooperativity between dimers could be also responsible; dimers would gather along the duplex as a template to form 1D spiral aggregates.