Rice proteins that bind single-stranded G-rich telomere DNA

In this work, we have identified and characterized proteins in rice nuclear extracts that specifically bind the single-stranded G-rich telomere sequence. Three types of specific DNA-protein complexes (I, II, and III) were identified by gel retardation assays using synthetic telomere substrates consisting of two or more single-stranded TTTAGGG repeats and rice nuclear extracts. Since each complex has a unique biochemical property and differs in electrophoretic mobility, at least three different proteins interact with the G-rich telomere sequences. These proteins are called rice G-rich telomere binding protein (RGBP) and none of them show binding affinity to double-stranded telomere repeats or single-stranded C-rich sequence. Changing one or two G's to C's in the TTTAGGG repeats abolishes binding activity. RGBPs have a greatly reduced affinity for human and Tetrahymena telomeric sequence and do not efficiently bind the cognate G-rich telomere RNA sequence UUUAGGG. Like other telomere binding proteins, RGBPs are resistant to high salt concentrations. RNase sensitivity of the DNA-protein interactions was tested to investigate whether an RNA component mediates the telomeric DNA-protein interaction. In this assay, we observed a novel complex (complex III) in gel retardation assays which did not alter the mobilities or the band intensities of the two pre-existing complexes (I and II). The complex III, in addition to binding to telomeric sequences, has a binding affinity to rice nuclear RNA, whereas two other complexes have a binding affinity to only single-stranded G-rich telomere DNA. Taken together, these studies suggest that RGBPs are new types of telomere-binding proteins that bind in vitro to single-stranded G-rich telomere DNA in the angiosperms.     

Interaction of an Arabidopsis RNA-binding protein with plant single-stranded telomeric DNA modulates telomerase activity

Telomeres are the specialized structures at the end of linear chromosomes and terminate with a single-stranded 3' overhang of the G-rich strand. The primary role of telomeres is to protect chromosome ends from recombination and fusion and from being recognized as broken DNA ends. This protective function can be achieved through association with specific telomere-binding proteins. Although proteins that bind single-stranded G-rich overhang regulate telomere length and telomerase activity in mammals and lower eukaryotes, equivalent factors have yet to be identified in plants. Here we have identified proteins capable of interacting with the G-rich single-stranded telomeric repeat from the Arabidopsis extracts by affinity chromatography. Matrix-assisted laser desorption ionization time-of-flight mass spectrometry analysis indicates that the isolated protein is a chloroplast RNA-binding protein (and a truncated derivative). The truncated derivative, which we refer to as STEP1 (single-stranded telomere-binding protein 1), binds specifically the single-stranded G-rich plant telomeric DNA sequences but not double-stranded telomeric DNA. Unlike the chloroplast-localized full-length RNA-binding protein, STEP1 localizes exclusively to the nucleus, suggesting that it plays a role in plant telomere biogenesis. We also demonstrated that the specific binding of STEP1 to single-stranded telomeric DNA inhibits telomerase-mediated telomere extension. The evidence presented here suggests that STEP1 is a telomere-end binding protein that may contribute to telomere length regulation by capping the ends of chromosomes and thereby repressing telomerase activity in plants.     

Characterization of nucleoprotein complexes in plants with human-type telomere motifs.

A conserved feature of telomeres is the 3'-overhang of their G-rich strand. These G-overhangs function as substrates for telomerase-mediated strand extension, and are critical for end-protection of telomeres. These functions and their regulations are mediated by specific G-overhang binding proteins. In species of the plant order Asparagales, telomere motifs have diverged from a type typical of the plant Arabidopsis thaliana (TTTAGGG)(n) to a type typical of human (TTAGGG)(n). Presumably, this change in motif had an impact on the structure of the telomere and/or the binding of telomeric proteins, including the G-overhang binding proteins. Therefore, we analyse here nucleoprotein complexes formed by protein extracts from plants possessing human-type telomeres (Muscari armeniacum and Scilla peruviana). Proteins were characterized that bind to the G-rich strand of both telomere motifs, or to the ancestral Arabidopsis-type motif alone, but none bound to double-stranded or C-rich complementary strand telomere motifs. We demonstrate the size, sequence-specificity and thermostability of these DNA-binding proteins. We also analysed the formation of complexes from renatured protein fractions after SDS-PAGE (sodium-dodecyl-sulphate polyacrylamide-gel-electrophoresis). We discuss the evolutionary consequences of protein binding flexibility, to act on both ancestral and present telomeric sequences. Of particular interest is that the ancestral repeat, which is thought not to form the telomere, binds the proteins most strongly. These data are discussed in line with other known plant telomere-binding proteins and with the complex nature of the telomere in Asparagales carrying a human-type motif.     

Sequence-specific DNA recognition by the Myb-like domain of plant telomeric protein RTBP1

We have identified a rice gene encoding a DNA-binding protein that specifically recognizes the telomeric repeat sequence TTTAGGG found in plants. This gene, which we refer to as RTBP1 (rice telomere-binding protein 1), encodes a polypeptide with a predicted molecular mass of 70 kDa. RTBP1 is ubiquitously expressed in various organs and binds DNA with two or more duplex TTTAGGG repeats. The predicted protein sequence includes a single domain at the C terminus with extensive homology to Myb-like DNA binding motif. The Myb-like domain of RTBP1 is very closely related to that of other telomere-binding proteins, including TRF1, TRF2, Taz1p, and Tbf1p, indicating that DNA-binding domains of telomere-binding proteins are well conserved among evolutionarily distant species. To obtain precise information on the sequence of the DNA binding site recognized by RTBP1, we analyzed the sequence-specific binding properties of the isolated Myb-like domain of RTBP1. The isolated Myb-like domain was capable of sequence-specific DNA binding as a homodimer. Gel retardation analysis with a series of mutated telomere probes revealed that the internal GGGTTT sequence in the two-telomere repeats is critical for binding of Myb-like domain of RTBP1, which is consistent with the model of the TRF1.DNA complex showing that base-specific contacts are made within the sequence GGGTTA. To the best of our knowledge, RTBP1 is the first cloned gene in which the product is able to bind double-stranded telomeric DNA in plants. Because the Myb-like domain appears to be a significant motif for a large class of proteins that bind the duplex telomeric DNA, RTBP1 may play important roles in plant telomere function in vivo.     

Plant telomere-binding proteins

Telomere-binding proteins have recently been recognised not only as necessary building blocks of telomere structure, but namely as components which are of central importance to telomere metabolism being involved in regulation of telomere length as well as in protective (capping) function of telomeres. Although the knowledge on plant telomeric DNA-binding proteins lags behind that in human and yeast, recent data show both analogies and plant-specific features in the composition and interactions of telomeric proteins. This review focuses primarily on proteins with known amino acid sequence. These can be classified into following groups: 1) the family of proteins with Myb domain at C-terminus, 2) proteins with Myb domain at N-terminus, both binding double-stranded DNA of telomeric repeats TTTAGGG, 3) the single-stranded DNA-binding proteins, and 4) other proteins that act also in non-telomeric chromatin regions. Proteins with C-terminal Myb domain reported as IBP family were previously found in human, whereas Smh family representing proteins with Myb domain at N-terminus was identified only in plants. Also RRM family of the single-stranded DNA-binding proteins is likely to be plant specific.     

POT1 proteins in green algae and land plants: DNA-binding properties and evidence of co-evolution with telomeric DNA

Telomeric DNA terminates with a single-stranded 3′ G-overhang that in vertebrates and fission yeast is bound by POT1 (Protection Of Telomeres). However, no in vitro telomeric DNA binding is associated with Arabidopsis POT1 paralogs. To further investigate POT1–DNA interaction in plants, we cloned POT1 genes from 11 plant species representing major branches of plant kingdom. Telomeric DNA binding was associated with POT1 proteins from the green alga Ostreococcus lucimarinus and two flowering plants, maize and Asparagus. Site-directed mutagenesis revealed that several residues critical for telomeric DNA recognition in vertebrates are functionally conserved in plant POT1 proteins. However, the plant proteins varied in their minimal DNA-binding sites and nucleotide recognition properties. Green alga POT1 exhibited a strong preference for the canonical plant telomere repeat sequence TTTAGGG with no detectable binding to hexanucleotide telomere repeat TTAGGG found in vertebrates and some plants, including Asparagus. In contrast, POT1 proteins from maize and Asparagus bound TTAGGG repeats with only slightly reduced affinity relative to the TTTAGGG sequence. We conclude that the nucleic acid binding site in plant POT1 proteins is evolving rapidly, and that the recent acquisition of TTAGGG telomere repeats in Asparagus appears to have co-evolved with changes in POT1 DNA sequence recognition.     

Sequence-specific binding property of Arabidopsis thaliana telomeric DNA binding protein 1 (AtTBP1)

We have identified an Arabidopsis thaliana cDNA, designated as AtTBP1, encoding a protein with a predicted size of 70.6 kDa that specifically binds to the plant telomeric repeat sequence TTTAGGG. AtTBP1 is present as a single-copy gene in Arabidopsis genome and is expressed ubiquitously in various organs. AtTBP1 has a single Myb telomeric DNA binding domain at the C-terminus and an extensive homology with other known telomere-binding proteins. The isolated C-terminus of AtTBP1 is capable of sequence-specific DNA binding to plant duplex telomeric DNA. These results suggest that AtTBP1 may play important roles in plant telomere function in vivo.     

DNA-induced dimerization of the single-stranded DNA binding telomeric protein Pot1 from Schizosaccharomyces pombe

Eukaryotic chromosome ends are protected from illicit DNA joining by protein-DNA complexes called telomeres. In most studied organisms, telomeric DNA is composed of multiple short G-rich repeats that end in a single-stranded tail that is protected by the protein POT1. Mammalian POT1 binds two telomeric repeats as a monomer in a sequence-specific manner, and discriminates against RNA of telomeric sequence. While addressing the RNA discrimination properties of SpPot1, the POT1 homolog in Schizosaccharomyces pombe, we found an unanticipated ssDNA-binding mode in which two SpPot1 molecules bind an oligonucleotide containing two telomeric repeats. DNA binding seems to be achieved via binding of the most N-terminal OB domain of each monomer to each telomeric repeat. The SpPot1 dimer may have evolved to accommodate the heterogeneous spacers that occur between S. pombe telomeric repeats, and it also has implications for telomere architecture. We further show that the S. pombe telomeric protein Tpz1, like its mammalian homolog TPP1, increases the affinity of Pot1 for telomeric single-stranded DNA and enhances the discrimination of Pot1 against RNA.     

Characterization of single stranded telomeric DNA-binding proteins in cultured soybean (Glycine max) cells

We have identified and characterized a protein factor in soybean (Glycine max) nuclear extracts that binds to plant single stranded telomeric DNA repeats. A single DNA-protein complex was detected in gel retardation assays using synthetic telomeres and nuclear extracts. The protein forming this complex was designated soy-bean (Glycine max) single stranded telomeric DNA-binding protein (Gm-STBP). Gm-STBP binds to single stranded telomeric DNA containing more than two repeats. It does not bind to Tetrahymena, human or mutated plant telomere sequences, and its binding activity is not affected by RNase treatment. Gm-STBP activity gradually decreased after suspension cultures entered stationary phase. A slower migrating band was formed with extracts of earlier and later phases of soybean suspension cultures. Our findings suggest that binding of Gm-STBP to plant single stranded telomeric DNA may play a role in the proper functioning of telomeres during development.     

Roles of NtGTBP1 in telomere stability

Telomeres are protective nucleoprotein structures at the ends of linear eukaryotic chromosomes. In contrast to double-stranded-specific telomere-binding proteins, the cellular roles of single-stranded-specific telomeric proteins are not well understood in higher plants. Three highly conserved tobacco G-strand-specific telomere-binding protein paralogs (NtGTBP1, NtGTBP2 and NtGTBP3) were identified and characterized. All three NtGTBPs were able to bind specifically to the plant single-stranded telomeric repeat elements in vitro with similar affinities. Suppression of NtGTBP1 by means of the RNAi-mediated gene knock-down method resulted in developmental defects in transgenic tobacco plants accompanied by lengthened telomeres, extra-chromosomal telomeric circles and abnormal anaphase bridges. These results suggest that the downregulation of NtGTBP1 results in genome instability. NtGTBP1 prevented in vitro strand invasion, a prerequisite process for inter-chromosomal telomeric recombination. Therefore, tobacco NtGTBP1 is one of the essential factors for telomere stability. Because abnormal telomeric elongation and recombination due to the suppression of NtGTBP1 are reminiscent of the recombinational telomere lengthening mechanism that purportedly operates in telomerase negative cancer cells, it is of interest to investigate whether telomeric recombination is associated with cell death in animal systems.Key words: genome stability, inter-chromosomal recombination, single-stranded telomere-binding proteinsExtreme ends of linear eukaryotic chromosomes maintain telomeres, which contain protective complexes of proteins and DNA repeats.^1,2 Telomeric DNA repeats consist of two parts: double-stranded and single-stranded DNA sequence elements. Telomere sequences are protected by specialized sequence-specific non-histone DNA binding proteins. In higher plants, Myb domain-containing double-stranded DNA binding proteins (TRFs) are relatively well characterized and appear to be functionally conserved with mammalian TRFs.^3–5 However, situation of single-stranded telomeric binding proteins is complicated. Pot1, a well-known shelterin complex protein, has single-stranded telomere repeat binding activity in yeasts and mammals but no DNA binding activity in Arabidopsis, despite the fact that it is necessary for the proper maintenance of telomere integrity.^6–8 These results led us to investigate other proteins that potentially bind to single-stranded telomeric ends. Because some reports have found that human heterogeneous nuclear ribonucleoproteins (HnRNP) homologs contain sequence-specific telomere repeat binding activity in higher plants,^9,10 we characterized tobacco NtGTBP1, a homolog of human HnRNPs, by performing in vitro gel retardation assays and phenotypic analyses of RNAi-mediated knockdown transgenic tobacco plants, in which NtGTBP1 was downregulated.¹¹     

Identification and characterization of a putative telomere end-binding protein from Tetrahymena thermophila.

Telomeric DNA of Tetrahymena thermophila consists of a long stretch of (TTGGGG)n double-stranded repeats with a single-stranded (TTGGGG)2 3' overhang at the end of the chromosome. We have identified and characterized a protein that specifically binds to a synthetic telomeric substrate consisting of duplex DNA and the 3' telomeric repeat overhang. This protein is called TEP (telomere end-binding protein). A change from G to A in the third position of the TTGGGG overhang repeat converts the substrate to a human telomere analog and reduces the binding affinity approximately threefold. Changing two G's to C's in the TTGGGG repeats totally abolishes binding. However, permutation of the Tetrahymena repeat sequence has only a minor effect on binding. A duplex structure adjacent to the 3' overhang is required for binding, although the duplex need not contain telomeric repeats. TEP does not bind to G-quartet DNA, which is formed by many G-rich sequences. TEP has a greatly reduced affinity for RNA substrates. The copy number of TEP is at least 2 x 10(4) per cell, and it is present under different conditions of cell growth and development, although its level varies. UV cross-linking experiments show that TEP has an apparent molecular mass of approximately 65 kDa. Unlike other telomere end-binding proteins, TEP is sensitive to high salt concentrations.     

An evolutionary change in telomere sequence motif within the plant section Asparagales had significance for telomere nucleoprotein complexes

In association with a phylogenetic tree of Asparagales, our previous results showed that a distinct clade included plant species where the ancestral, Arabidopsis-type of telomeric repeats (TTTAGGG)n had been partially, or fully, replaced by the human-type telomeric sequence (TTAGGG)n. Telomerases of these species synthesize human repeats with a high error rate in vitro. Here we further characterize the structure of telomeres in these plants by analyzing the overall arrangement of major and minor variants of telomeric repeats using fluorescence in situ hybridization on extended DNA strand(s). Whilst the telomeric array is predominantly composed of the human variant of the repeat, the ancestral, Arabidopsis-type of telomeric repeats was ubiquitously observed at one of the ends and/or at intercalary positions of extended telomeric DNAs. Another variant of the repeat typical of Tetrahymena was observed interspersed in about 20% of telomerics. Micrococcal nuclease digestions indicated that Asparagales plants with a human-type of telomere have telomeric DNA organised into nucleosomes. However, unexpectedly, the periodicity of the nucleosomes is not significantly shorter than bulk chromatin as is typical of telomeric chromatin. Using electrophoretic mobility shift assays we detected in Asparagales plants with a human type of telomere a 40-kDa protein that forms complexes with both Arabidopsis- and human-type G-rich telomeric strands. However, the protein shows a higher affinity to the ancestral Arabidopsis-type sequence. Two further proteins were found, a 25-kDa protein that binds specifically to the ancestral sequence and a 15-kDa protein that binds to the human-type telomeric repeat. We discuss how the organisation of the telomere repeats in Asparagales may have arisen and stabilised the new telomere at the point of mutation.     

Saccharomyces cerevisiae Mre11 is a high-affinity G4 DNA-binding protein and a G-rich DNA-specific endonuclease: implications for replication of telomeric DNA

In Saccharomyces cerevisiae, Mre11p/Rad50p/Xrs2p (MRX) complex plays a vital role in several nuclear processes including cellular response to DNA damage, telomere length maintenance, cell cycle checkpoint control and meiotic recombination. Telomeres are comprised of tandem repeats of G-rich DNA and are incorporated into non-nucleosomal chromatin. Although the structure of the yeast telomeric DNA is poorly understood, it has been suggested that the G-rich sequences can fold into G4 DNA, which has been shown to inhibit DNA synthesis by telomerase. However, little is known about the factors and mechanistic aspects of the generation of appropriate termini for DNA synthesis by telomerase. Here, we show that S.cerevisiae Mre11 protein (ScMre11p) possesses substantially higher binding affinity for G4 DNA, over single- or double-stranded DNA, and binding was inhibited by poly(dG) or porphyrin. Binding of ScMre11p to G4 DNA was most robust, compared with G2′ DNA and the resulting protein–DNA complexes were strikingly very resistant to dissociation by NaCl. Remarkably, binding of ScMre11p to G4 DNA and G-rich single-stranded DNA was accompanied by the endonucleolytic cleavage at sites flanking the array of G residues and G-quartets in Mn²⁺-dependent manner. Collectively, these results suggest that ScMre11p is likely to play a major role in generating appropriate substrates for DNA synthesis by telomerase and telomere-binding proteins. We discuss the implications of these findings with regard to telomere length maintenance by telomerase-dependent and independent mechanisms.     

Telomeric D-loops Containing 8-Oxo-2��-deoxyguanosine Are Preferred Substrates for Werner and Bloom Syndrome Helicases and Are Bound by POT1

8-Oxo-2′-deoxyguanosine (8-oxodG) is one of the most important oxidative DNA lesions, and G-rich telomeric DNA is especially susceptible to oxidative DNA damage. RecQ helicases WRN and BLM and telomere-binding protein POT1 are thought to play roles in telomere maintenance. This study examines the ability of WRN, BLM, and RecQ5 to unwind and POT1 to bind telomeric D-loops containing 8-oxodG. The results demonstrate that WRN and BLM preferentially unwind telomeric D-loops containing 8-oxodG and that POT1 binds with higher affinity to telomeric D-loops with 8-oxodG but shows no preference for telomeric single-stranded DNA with 8-oxodG. We speculate that telomeric D-loops with 8-oxodG may have a greater tendency to form G-quadruplex DNA structures than telomeric DNA lacking 8-oxodG.     

Solution structure of telomere binding domain of AtTRB2 derived from Arabidopsis thaliana

Telomere homeostasis is regulated by telomere-associated proteins, and the Myb domain is well conserved for telomere binding. AtTRB2 is a member of the SMH (Single-Myb-Histone)-like family in Arabidopsis thaliana, having an N-terminal Myb domain, which is responsible for DNA binding. The Myb domain of AtTRB2 contains three α-helices and loops for DNA binding, which is unusual given that other plant telomere-binding proteins have an additional fourth helix that is essential for DNA binding. To understand the structural role for telomeric DNA binding of AtTRB2, we determined the solution structure of the Myb domain of AtTRB2 (AtTRB2_1–64) using nuclear magnetic resonance (NMR) spectroscopy. In addition, the inter-molecular interaction between AtTRB2_1–64 and telomeric DNA has been characterized by the electrophoretic mobility shift assay (EMSA) and NMR titration analyses for both plant (TTTAGGG)n and human (TTAGGG)n telomere sequences. Data revealed that Trp28, Arg29, and Val47 residues located in Helix 2 and Helix 3 are crucial for DNA binding, which are well conserved among other plant telomere binding proteins. We concluded that although AtTRB2 is devoid of the additional fourth helix in the Myb-extension domain, it is able to bind to plant telomeric repeat sequences as well as human telomeric repeat sequences.     

ST-1, a 39-kilodalton protein in Trypanosoma brucei, exhibits a dual affinity for the duplex form of the 29-base-pair subtelomeric repeat and its C-rich strand.

In our attempt to identify telomere region-binding proteins in Trypanosoma brucei, we identified ST-1, a polypeptide with novel features. ST-1 was chromatographically purified from S-100 cell extracts and was renatured from a sodium dodecyl sulfate-protein gel as a 39-kDa polypeptide. It forms a specific complex with the trypanosome telomere repeats of TTAGGG, but more significantly, it shows a higher affinity for the 29-bp subtelomere repeats of T. brucei. These 29-mer boxes are a large tandem series of telomere-derived repeats which separate the simple telomere DNA from middle-repetitive telomere-associated sequences on many chromosomes. ST-1 is the first example of a protein binding within such large repetitive subtelomere elements in trypanosomes or other organisms. ST-1 is also novel in that it has a selective affinity for the C-rich strands of both the subtelomeric 29-mer and the telomere repeats, comparable to that for the duplex form of the respective repeats. All previously described telomere-binding proteins have affinity for only the duplex form or for the G-rich strand. This C-rich strand binding specificity of ST-1 may provide insight into this protein's mechanism of binding in vivo.     

Evidence for a HeLa nuclear protein that binds specifically to the single-stranded d(CCCTAA)n telomeric motif.

In recent years several telomere binding proteins from eukaryotic organisms have been identified that are able to recognise specifically the duplex telomeric DNA repeat or the G-rich 3'-ending single strand. In this paper we present experimental evidence that HeLa nuclear extracts contain a protein that binds with high specificity to the single-stranded complementary d(CCCTAA)n repeat. Electrophoretic mobility shift assays show that the oligonucleotide d(CCCTAACCCTAACCCTAACCCT) forms a stable complex with this protein in the presence of up to 1000-fold excesses of single-stranded DNA and RNA competitors, but is prevented from doing so in the presence of its complementary strand. SDS-PAGE experiments after UV cross-linking of the complex provide an estimate of 50 kDa for the molecular weight of this protein.