Solution conformational study of Scyliorhinin I analogues with conformational constraints by two-dimensional NMR and theoretical conformational analysis.

Two analogues of Scyliorhinin I (Scyl), a tachykinin with N-MeLeu in position 8 and a 1,5-disubstituted tetrazole ring between positions 7 and 8, introduced in order to generate local conformational constraints, were synthesized using the solid-phase method. Conformational studies in water and DMSO-d6 were performed on these peptides using a combination of the two-dimensional NMR technique and theoretical conformational analysis. The algorithm of conformational search consisted of the following three stages: (i) extensive global conformational analysis in order to find all low-energy conformations; (ii) calculation of the NOE effects and vicinal coupling constants for each of the low energy conformations; (iii) determining the statistical weights of these conformations by means of a nonlinear least-squares procedure, in order to obtain the best fit of the averaged simulated spectrum to the experimental one. In both solvents the three-dimensional structure of the analogues studied can be interpreted only in terms of an ensemble of multiple conformations. For [MeLeu8]Scyl, the C-terminal 6-10 fragment adopts more rigid structure than the N-terminal one. In the case of the analogue with the tetrazole ring in DMSO-d6 the three-dimensional structure is characterized by two dominant conformers with similar geometry of their backbones. They superimpose especially well (RMSD = 0.28 A) in the 6-9 fragments. All conformers calculated in both solvents superimpose in their C-terminal fragments much better than those of the first analogue. The results obtained indicate that the introduction of the tetrazole ring into the Scyl molecule rigidifies its structure significantly more than that of MeLeu.     

Conformational behavior of cyclic CCK-related peptides determined by 400-MHz 1H-NMR: relationships with affinity and selectivity for brain receptors

The conformational study of a homogenous series of cyclic analogues of CCK8, selective for central receptors, such as Boc-X-Tyr(SO3H)-Nle-D-Lys-Trp-Nle-Asp-Phe-NH2, where X = L-Glu, D-Glu, or gamma-D-Glu, was performed by 400-MHz 1H-nmr. The regular increase in affinity for central receptors when going from [L-Glu] to [gamma-D-Glu] is correlated to (a) an enhancement in internal flexibility of the cyclic moiety, (b) an external orientation of the tyrosine side chain, and (c) a restructuring of the C-terminal part of the peptide. All these results could permit a modeling of biologically active conformation of CCK8 for both receptors types to be performed.     

Structural features of linear (alphaMe)Val-based peptides in solution by photophysical and theoretical conformational studies

In continuation of our studies on the determination of the structural features of functionalized peptides in solution by combining time-resolved fluorescence data and molecular mechanics results, the conformational features of a series of linear, L-(alphaMe)Val-based peptides have been investigated in methanol. These foldamers have the general formula F[(alphaMe)Val](r)-T-[(alphaMe)Val](2)NHtBu, where (alphaMe)Val = C(alpha)-methylvaline and r = 0-3, while F [= fluoren-9-ylmethoxycarbonyl (Fmoc)] and T [= 2,2,6,6-tetramethylpiperidine-1-oxyl-4-amino-carboxylic (Toac)] are a fluorophoric N(alpha)-protecting group and a nitroxide-based alpha-amino acid quencher, respectively. According to ir and CD spectra, the longest term of the series (r = 3) attains a 3(10)-helical structure, while the other peptides populate an intramolecularly H-bonded, 3(10)-helix-like conformation affected by dynamic helical distortions, which are enhanced by the shortness of the backbone chain. Such distortions are reflected in both the energy of the stretching mode and the molar extinction coefficient of the H-bonded N-H groups, the former being higher and the latter smaller than those of a stable 3(10)-helix. Steady-state and time-resolved fluorescence measurements in methanol show a strong quenching of Fmoc by the Toac residue, located at different helix positions, depending on the r value. Comparison of quenching efficiencies and lifetime preexponents with those theoretically obtained from the deepest energy minimum conformers, assuming a F?rster mechanism, is satisfactory. The computed structures exhibit a rather compact arrangement, which accounts for the few sterically favored conformations for each peptide, in full agreement with the time-resolved fluorescence data. Orientational effects between the probes must be taken into account for a correct interpretation of the fluorescence decay results, implying that interconversion among conformational substates involving the probes is slower than the energy transfer rate.     

Determination of conformational equilibrium of peptides in solution by NMR spectroscopy and theoretical conformational analysis: application to the calibration of mean-field solvation models.

Peptides occur in solution as ensembles of conformations rather than in a fixed conformation. The existing energy functions are usually inadequate to predict the conformational equilibrium in solution, because of failure to account properly for solvation, if the solvent is not considered explicitly (which is usually prohibitively expensive). NMR data are therefore widely incorporated into theoretical conformational analysis. Because of conformational flexibility, restrained molecular dynamics (with restraints derived from NMR data), which is usually applied to determine protein conformation is of limited use in the case of peptides. Instead, (a) the restraints are averaged within predefined time windows during molecular dynamics (MD) simulations (time averaging), (b) multiple-copy MD simulations are carried out and the restraints are averaged over the copies (ensemble averaging), or (c) a representative ensemble of sterically feasible conformations is generated and the weights of the conformations are then fitted so that the computed average observables match the experimental data (weight fitting). All these approaches are briefly discussed in this article. If an adequate force field is used, conformations with large statistical weights obtained from the weight-fitting procedure should also have low energies, which can be implemented in force field calibration. Such a procedure is particularly attractive regarding the parameterization of the solvation energy in nonaqueous solvents, e.g., dimethyl sulfoxide, for which thermodynamic solvation data are scarce. A method for calibration of solvation parameters in dimethyl sulfoxide, which is based on this principle was recently proposed by C. Baysal and H. Meirovitch (Journal of the American Chemical Society, 1998, Vol. 120, pp. 800--812), in which the energy gap between the conformations compatible with NMR data and the alternative conformations is maximized. In this work we propose an alternative method based on the principle that the best-fitting statistical weights of conformations should match the Boltzmann weights computed with the force field applied. Preliminary results obtained using three test peptides of varying conformational mobility: H-Ser(1)-Pro(2)-Lys(3)-Leu(4)-OH, Ac-Tyr(1)-D-Phe(2)-Ser(3)-Pro(4)-Lys(5)-Leu(6)-NH(2), and cyclo(Tyr(1)-D-Phe(2)-Ser(3)-Pro(4)-Lys(5)-Leu(6)) are presented.     

Intramolecular microdynamical and conformational parameters of peptides from 1H and 13C NMR spin-lattice relaxation. Tetragastrin.

Measurements of 1H and 13C spin-lattice relaxation and 13C nuclear Overhauser enhancement factors are reported for dimethyl sulfoxide solutions of tetragastrin, a pharmacologically active tetrapeptide. The use of the dipolar formalism for predicting 1H and quaternary 13C relaxation rates is discussed. Furthermore, the prospect is opened for the use of quaternary 13C and 1H relaxation times to obtain information on the peptide torsion angles phi, psi, and chi in a way supplementing NMR coupling constant methods presently in use.     

High field NMR study of antibiotic peptides: 1H assignment of trichorzianine A1 spectra by 2D experiments

A new antibiotic peptide, trichorzianine A1, was isolated from a culture of Trichoderma harzianum. It contains 19 residues, the N terminus is blocked by an acetyl group and the C terminus is tryptophanol. As a first part of the structural study of this new peptide, we here present the analysis of the 1H NMR spectrum accomplished by 2 DJ resolved and spin echo correlated spectroscopy.     

Insights into the determinants of beta-sheet stability: 1H and 13C NMR conformational investigation of three-stranded antiparallel beta-sheet-forming peptides.

In a previous study we designed a 20-residue peptide able to adopt a significant population of a three-stranded antiparallel beta-sheet in aqueous solution (de Alba et al. [1999]Protein Sci.8, 854-865). In order to better understand the factors contributing to beta-sheet folding and stability we designed and prepared nine variants of the parent peptide by substituting residues at selected positions in its strands. The ability of these peptides to form the target motif was assessed on the basis of NMR parameters, in particular NOE data and 13Calpha conformational shifts. The populations of the target beta-sheet motif were lower in the variants than in the parent peptide. Comparative analysis of the conformational behavior of the peptides showed that, as expected, strand residues with low intrinsic beta-sheet propensities greatly disfavor beta-sheet folding and that, as already found in other beta-sheet models, specific cross-strand side chain-side chain interactions contribute to beta-sheet stability. More interestingly, the performed analysis indicated that the destabilization effect of the unfavorable strand residues depends on their location at inner or edge strands, being larger at the latter. Moreover, in all the cases examined, favorable cross-strand side chain-side chain interactions were not strong enough to counterbalance the disfavoring effect of a poor beta-sheet-forming residue, such as Gly.     

Hydrostatic pressure-induced conformational changes in phosphatidylcholine headgroups: a 2H NMR study.

The effects of pressure and temperature on 1,2-dipalmitoyl-sn-glycero-3-phosphocholine and 1,2-dimyristoyl-sn-glycero-3-phosphocholine headgroup conformations were examined using deuterium nuclear magnetic resonance. Isothermal compression was found to produce a decrease in the choline alpha deuteron quadrupole splitting and increases in the choline beta and gamma deuteron quadrupole splittings. A similar counterdirectional change, seen in the presence of positive surface charge, has been attributed to tilting of the headgroup away from the bilayer surface in response to the torque exerted on the phosphocholine dipole by positive surface charges. The direction of the change in headgroup deuteron quadrupole splitting is consistent with the pressure-induced reduction in area per lipid in the liquid crystalline phase, which can be inferred from the ordering of phospholipid acyl chains under comparable conditions. The temperature dependences of the headgroup deuteron quadrupole splittings were also examined. It was found that at elevated pressure, the alpha splitting was insensitive to temperature, whereas the beta and gamma splittings decreased. The response of the beta deuteron splitting to temperature was found to be weaker at elevated pressure than at ambient pressure.     

1H NMR study of rabbit skeletal muscle troponin C: Mg2(+)-induced conformational change

Binding of Mg2+ to rabbit skeletal muscle troponin C (TnC) is studied by means of two-dimensional (2D) 1H NMR spectroscopy. Using the sequence-specific resonance assignment method we assign several resonances of TnC in the Mg2(+)-saturated state. Assigned resonances are used as probes of the following titration experiments: (1) Mg2+ titration of apo-TnC, (2) Mg2+ titration of Ca2TnC, and (3) Mg2+ titration of Ca4TnC. In experiment 1, the slow-exchange behavior is observed for resonances of Phe99, Asp107, Gly108, Tyr109, Ile110, Asp111, His125, Gly144, Arg145, Ile146, Asp147, and Phe148 located at the high-affinity Ca2(+)-binding sites in the C-terminal-half domain. In experiments 1 and 2, the fast-exchange behavior is observed for resonances of Gly32, Asp33, Ser35, Gly68, Thr69, and Asp71 located at the low-affinity Ca2(+)-binding sites in the N-terminal-half domain. These results suggest that Mg2+ ions bind to the N domain as well as the C domain. In experiment 3, no spectral change is observed for all above-mentioned residues in the C domain and also for Gly32 and Gly68 in the N domain. It can be concluded that all Ca2(+)-binding sites in both the N and C domains can bind Mg2+ ions. No significant change is observed for resonances of Phe23, Ile34, Val68, and Phe72 in experiments 1 and 2. These results suggest that Mg2+ binding to the N domain does not induce conformational change in the hydrophobic region of the N domain. 2D-NMR spectra and Mg2(+)-titration data suggest that the antiparallel beta-sheet conformation is formed in both the N and C domains when Mg2+ ions bind to the two domains.     

The cytoplasmic helix of cannabinoid receptor CB2, a conformational study by circular dichroism and (1)H NMR spectroscopy in aqueous and membrane-like environments.

The cytoplasmic helix domain (fourth cytoplasmic loop, helix 8) of numerous G protein-coupled receptors (GPCRs) such as rhodopsin and the beta-adrenergic receptor exhibit unique structural and functional characteristics. Computer models also predict this structure for the cannabinoid CB2 receptor, another member of the GPCR superfamily. In our study, a peptide corresponding to helix 8 of the CB2 receptor was synthesized chemically and its secondary structure determined by circular dichroism (CD) and (1)H NMR spectroscopy. NMR and CD revealed an alpha-helical structure in this region in both dodecylphosphocholine micelles and dimethylsulfoxide, in contrast to a random coil configuration found in aqueous solvent. This finding is in good agreement with other previous GPCR structural studies including X-ray crystallography. By combining our finding with other studies, we further hypothesize that the amphipathic nature of helix 8 can play a significant role in the function and regulation of CB receptors as well as other GPCRs in general.     

Local interactions in peptides. 1H-1H, 13C-H coupling constants and calculations for the conformational analysis of N-acetyl-N'-methylamides of aliphatic amino acids

We report the results of a joint NMR and theoretical investigation devoted to the conformational properties of N-acetyl-N'-methylamides of aliphatic amino acids with side chains of increasing bulkiness: Gly, Ala, Leu, Ile, and tert.Leu. In this series, determination of the coupling constants 3JHNC alpha H together with the coupling constants 3JC'NC alpha H (thanks to specific carbon-13 labeling of the N-acetyl carbonyl group) led to the derivation of alternative A, B, and C parameters in a Karplus-type relation expressing the dependence of 3JC'NC alpha H upon the phi dihedral angle. The value of the latter is found to increase regularly following the increase of the side-chain bulkiness. The theoretical conformational analysis is performed by applying the SIBFA procedure, which uses empirical formulas based on ab initio SCF computations. The conformational energy maps illustrate the progressive distortion of the backbone conformation incurred in the series Gly to tert.Leu. Theoretical values computed for 3JHNC alpha H and 3JC'NC alpha H are found to be in a good quantitative agreement with the experimental ones.     

Solution conformational study of nociceptin an(d its 1-13 and 1-11 fragments using circular dichroism and two-dimensional NMR in conjunction with theoretical conformational analysis.

Conformational studies of nociceptin (NC-NH2), its fully active fragment, NC(1-13)-NH2, and two significantly less potent fragments, NC(1-13)-OH and NC(1-11)-OH, were conducted in water and TFE solutions by the employment of circular dichroism, and in DMSO-d6 by 2DNMR spectroscopy in conjunction with theoretical conformational analysis. The conformations of all thepeptides studied were calculated taking two approaches. The first assumes multiconformational equilibrium of the peptide studied, which is characterized by a set of conformations (and their statistical weight values)obtained from a global conformational analysis using three methods: the electrostatically driven Monte-Carlo (EDMC) with the ECEPP/3 force field, the simulated annealing (SA) protocols in the AMBER and CHARMM force fields. The second approach incorporates the interproton distance and dihedral angle constraints into the starting conformation. Calculations were performed using the distance geometry and SA protocol in the CHARMM force field implemented in the X-PLOR program. The CD experiments indicated that for the active peptides, hydrophobic solvents induced a significantly higher (compared with those remaining)content order, probably a helical structure. Unfortunately, as a result of the conformational flexibility of thepeptides, the analysis of conformations obtained with both approaches and different force fields did not alllow the selection of any structural elements of the NC peptides that might be connected with their bioactivity. The only common element found in most conformations of the active peptides was a helical character of fragment 8-13, which allowed the side chains of basic amino acid residues to be exposed to the outside of the molecule and probably to interact with the ORL1 receptor.     

Peptide secondary structure induced by a micellar phospholipidic interface: proton NMR conformational study of a lipopeptide.

The conformational change of the model peptide Ac-K-G-R-G-D-G-amide induced by a phospholipidic interface was investigated by proton nuclear magnetic resonance (1H NMR). In aqueous solution, the free peptide is highly flexible and disordered, even in the presence of deuterated dodecyl-phosphocholine (DPC-d38) micelles which mimic a membrane interface. The lipopeptide, obtained by grafting a lipid anchor [2,3-dipalmitoyl-D-(+)-glyceric acid] to the lysine side chain of the peptide, was studied by standard 2D 1H NMR spectroscopy combined with distance geometry and simulated annealing calculations. When anchored to a micelle interface, the peptide acquires a definite turn (II/I') conformation. We were also able to describe precisely the conformation of the diacylglyceric fragment of the lipopeptide in a lipid environment and to establish the average orientation of the peptide segment with respect to the micelle surface.     

A theoretical study on H-bonding interactions in maleic acid: calculated 17O, 1H NMR parameters and QTAIM analysis

A theoretical study was carried out to examine intra- and intermolecular hydrogen bond (HB) properties in crystalline maleic acid (MA). We investigated geometries, ¹⁷O and ¹H nuclear magnetic resonance parameters of various MA clusters by means of M06 and B3LYP functionals using recently developed Jensen's polarisation-consistent basis sets, pcJ-n (n = 0, 1, 2, 3). Our results reveal that the calculated chemical shift isotropy, δ_iso, at the sites of ¹⁷O and ¹H nuclei depends markedly on the size of the basis set. Overall, convergence of the pcJ-n series is rather similar for both B3LYP and M06 functionals. An increase of δ_iso(¹⁷O) and δ_iso(¹H) in going from the pcJ-1 to the pcJ-3 basis set is a typical feature of the (MA)_1–3 clusters. The quantum theory of atoms in molecules (QTAIM) and energy decomposition analyses were also used to elucidate the interaction characteristics in the MA H-bonded network. According to QTAIM results obtained, it is concluded that strong HBs are more covalent in nature and weak HBs are mainly electrostatic interactions.     

Determination of conformational transition rates in the trp promoter by 1H NMR rotating-frame T1 and cross-relaxation rate measurements

Rotating-frame relaxation measurements have been used in conjunction with spin-spin relaxation rate constants to investigate a conformational transition previously observed in the -10 region of the trp promoter d(CGTACTAGTTAACTAGTACG)2 (Lefèvre, Lane, Jardetzky 1987). The transition is localised to the sub-sequence TAAC, and is in fast exchange on the chemical shift time-scale. The rate constant for the exchange process has been determined from measurements of the rotating-frame relaxation rate constant as a function of the spin-lock field strength, and is approximately 5000 s^–1 at 30 °C. Measurements have also been made as a function of temperature and in two different magnetic fields: the results are fully consistent with those expected for the exchange contribution in a two-site system. A similar transition has been observed in d(GTGATTGACAATTA).d(CACTAACTGTTAAT), which contains the –35 region of the trp promoter. This has been investigated in the same way, and has been found to undergo exchange at a faster rate under comparable conditions. In addition, the cross-relaxation rate constants for Ade C2H-Ade C2H pairs have been measured as a function of temperature, and these indicate that certain internuclear distances in YAAY subsequences increase with increasing temperature. These changes in distance are consistent with a flattening of propellor twist of the AT base-pairs. The occurrence of conformational transitions in YAAY subsequences depends on the flanking sequence. Correspondence to: A. N. Lane     

Improved tumor selectivity of radiolabeled peptides by receptor and antigen dual targeting in the neurotensin receptor model

Radiolabeled peptides are emerging tools for diagnosis and therapy of tumors overexpressing receptors. However, binding to receptors expressed by nontumor tissues may cause toxicity. The objective of this study was to specifically enhance the binding affinity of labeled peptides to tumor cells, as opposed to receptor-positive nontumor cells, to ensure targeting selectivity. This was achieved by the simultaneous binding of hapten-bearing peptides to their receptor and to a tumor-associated antigen, mediated by a bispecific antibody directed to the tumor antigen and to the hapten. Binding of labeled neurotensin analogues bearing the DTPA(indium) hapten (NT-DTPA(111In)) to human colorectal carcinoma cells (HT29), which express the neurotensin receptor (NTR1) and carcinoembryonic antigen (CEA), was studied in the presence of a bispecific antibody (BsmAb) directed to CEA and to DTPA(indium). In vitro dual binding of NT-DTPA in the presence of BsmAb was about 6.5-fold higher than monovalent binding to NTR1 and 3.5-fold higher than the sum of the monovalent bindings to NTR1 or to CEA, suggesting cooperativity. Increased binding under bivalent conditions translated into increased internalization. In vivo pretargeting with BsmAb enhanced tumor uptake and tumor retention. Hapten bearing peptides binding simultaneously an overexpressed cell-surface receptor and a tumor antigen show increased selectivity to target tumor cells as compared to cells only expressing the cell surface receptor. Better resistance to enzymatic degradation and optimized administration protocols should further enhance in vivo targeting selectivity and may allow the development of radiopharmaceuticals labeled with isotopes suitable for radiotherapy such as 131I or 90Y.     

A conformational study of alpha-D-Manp-(1-->2)-alpha-D-Manp-(1-->O)-L-Ser by NMR 1H,1H T-ROESY experiments and molecular-dynamics simulations

The conformational preference of alpha-D-Manp-(1-->2)-alpha-D-Manp-(1-->O)-L-Ser has been investigated by one-dimensional (1)H,(1)H T-ROESY experiments and molecular-dynamics simulations with CHARMM22 type of force fields and water as explicit solvent. Proton-proton distances were obtained from the simulations and subsequently experimentally determined distances could be derived. Measurements were performed on the title compound as well as on selectively deuterium-substituted analogues synthesized as part of this study to alleviate possible NMR spectroscopic difficulties. A very good agreement was present between the separate NMR experiments. In the subsequent analysis a key nuclear Overhauser effect between the anomeric protons in the two sugar residues was used to assess the conformational dynamics revealed by the molecular simulations. The combined results support a model in which two states are significantly populated as a result of flexibility around the bond defined by the glycosidic torsion angle psi.     

500-MHz 1H NMR study of poly(dG).poly(dC) in solution using one-dimensional nuclear Overhauser effect

Secondary structures of poly(dG).poly(dC) and poly(dG).poly(dm5C) in solution are determined by nuclear Overhauser effect (NOE) measurements on GH8-deuterated and -nondeuterated DNAs with low presaturation pulse lengths (10-25 ms) and low-power and prolonged accumulations in the range of 50,000-72,000 scans. Under these conditions, the NOE difference spectra were free from diffusion. Primary NOEs between base protons GH8/CH6 and sugar protons H1', H2'/H2', and H3' suggest that in poly(dG).poly(dC) both guanine and cytosine nucleotides adopt a C3'-endo, low anti X = 200-220 degrees conformation. Computer modeling of the NOE data enable identification for the first time, in terms of the geometry of the nucleotide repeat, handedness, and helix geometry, of the structure of poly(dG).poly(dC) to be the A form, and the derived structure for the polymer duplex is very close to the single crystal structure of the double-helical d-GGGGCCCC [McCall, M., Brown, T., & Kennard, O. (1985) J. Mol. Biol. 183, 385-396]. Similar nuclear Overhauser effect data on poly(dG).poly(dm5C) revealed that G and m5C adopt a C2'endo, anti X = 240-260 degrees conformation, which indicates that this DNA exhibits the B form in solution. In summary, the results presented in this paper demonstrate that methylation of cytosines in poly(dG).poly(dC) causes A----B transition in the molecule.     

1H NMR conformational study of antiherpetic C5-substituted 2'-deoxyuridines: insight into the nature of structure-activity relationships

1H NMR study and conformational analysis of a broad series of biologically important C5-substituted 2'-deoxyuridines, including alkyl, halogen, vinyl, hydroxymethyl, and hydroxy derivatives as well as nitro, formyl, trifluoromethyl, and dimethylamino substituents, is presented. A thorough analysis of chemical shifts in correlation with C5-substituent electronegativity as well as calculations by SCF semi-empirical method of the formal charge localized on C6 carbon is discussed in terms of charge distribution for electron attracting and electron donating groups. Conformation of the sugar ring is determined from proton-proton coupling constants and described in terms of pseudorotation between two main puckering domains C2'endo (S) and C3'endo (N). Generally, electron donating groups destabilise the N conformation, simultaneously decreasing the mean pseudorotation amplitude. Absolute assignments of the H5' and H5' methylene protons in 1H NMR spectra permitted the unequivocal determination of molar fractions of the three classical exocyclic C4'-C5' rotamers gauche+, trans, and gauche-, and correlation of them with the sugar ring puckering domains. Conformation about the glycosidic bond is described in terms of equilibrium between two conformational regions, anti and syn. Finally, the role of the C5-substituent in the creation of cytotoxic activity is considered on the basis of a simplified model assuming that compound activity is a function of substituent polar surface, its molecular volume, and its molecule polarity defined at the relative partition of the polar atoms.     

1H NMR conformational study on n-terminal nonapeptide sequences of HIV-1 Tat protein: a contribution to structure–activity relationships

On the basis of our recent results, the N-terminal sequence of HIV-1 Tat protein as a natural competitive inhibitor of dipeptidyl peptidase IV (DP IV) is supposed to interact directly with the active site of DP IV hence mediating its immunosuppressive effects via specific DP IV interactions. Of special interest is the finding that amino acid substitutions of the Tat(1–9) peptide (MDPVDPNIE) in position 5 with S-isoleucine and in position 6 with S-leucine led to peptides with strongly reduced inhibitory activity suggesting differences in the solution conformation of the three analogues. Therefore, ¹H NMR techniques in conjunction with molecular modelling have been used here to determine the solution structure of Tat(1–9), I⁵-Tat(1–9) and L⁶-Tat(1–9) and to examine the influence of amino acid exchanges on structural features of these peptides. The defined structures revealed differences in the conformations what might be the reason for different interactions of these Tat(1–9) analogues with certain amino acids of the active site of DP IV. © 1998 European Peptide Society and John Wiley & Sons, Ltd.