Recognition of 5-aminouracil (U(#)) in the central strand of a DNA triplex: orientation selective binding of different third strand bases

A necessary feature of the natural base triads for triplex formation is the requirement of a purine (A or G) in the central position, since only these provide sets of two hydrogen bond donors/acceptors in the major groove of the double helix. Pyrimidine bases devoid of this feature have incompatible complementarity and lead to triplexes with lower stability. This paper demonstrates that 5-aminouracil (U^#) (I), a pyrimidine nucleobase analogue of T in which 5-methyl is replaced by 5-amino group, with hydrogen bonding sites on both sides, is compatible in the central position of triplex triad X*U^#·A, where X = A/G/C/T/2-aminopurine (AP), and * and · represent Hoogsteen and Watson–Crick hydrogen bonding patterns respectively. A novel recognition selectivity based on the orientation (parallel/antiparallel) of the third strand purines A, G or AP with A in the parallel motif (A_p*U^#·A), and G/AP in the antiparallel motif (G_ap/AP_ap*U^#·A) is observed. Similarly for pyrimidines in the third strand, C is accepted only in a parallel mode (C_p*U^#·A). Significantly, T is recognised in both parallel and antiparallel modes (T_p/T_ap*U^#·A), with the antiparallel mode being stable compared to the parallel one. The ‘U^#’ triplexes are also more stable than the corresponding control ‘T’ triplexes. The results expand the lexicon of triplex triads with a recognition motif consisting of pyrimidine in the central strand.     

Selective Preference of Parallel DNA Triplexes Is Due to the Disruption of Hoogsteen Hydrogen Bonds Caused by the Severe Nonisostericity between the G*GC and T*AT Triplets

Implications of DNA, RNA and RNA.DNA hybrid triplexes in diverse biological functions, diseases and therapeutic applications call for a thorough understanding of their structure-function relationships. Despite exhaustive studies mechanistic rationale for the discriminatory preference of parallel DNA triplexes with G_*GC & T_*AT triplets still remains elusive. Here, we show that the highest nonisostericity between the G_*GC & T_*AT triplets imposes extensive stereochemical rearrangements contributing to context dependent triplex destabilisation through selective disruption of Hoogsteen scheme of hydrogen bonds. MD simulations of nineteen DNA triplexes with an assortment of sequence milieu reveal for the first time fresh insights into the nature and extent of destabilization from a single (non-overlapping), double (overlapping) and multiple pairs of nonisosteric base triplets (NIBTs). It is found that a solitary pair of NIBTs, feasible either at a G_*GC/T_*AT or T_*AT/G_*GC triplex junction, does not impinge significantly on triplex stability. But two overlapping pairs of NIBTs resulting from either a T_*AT or a G_*GC interruption disrupt Hoogsteen pair to a noncanonical mismatch destabilizing the triplex by ~10 to 14 kcal/mol, implying that their frequent incidence in multiples, especially, in short sequences could even hinder triplex formation. The results provide (i) an unambiguous and generalised mechanistic rationale for the discriminatory trait of parallel triplexes, including those studied experimentally (ii) clarity for the prevalence of antiparallel triplexes and (iii) comprehensive perspectives on the sequence dependent influence of nonisosteric base triplets useful in the rational design of TFO’s against potential triplex target sites.     

New insights into DNA triplexes: residual twist and radial difference as measures of base triplet non-isomorphism and their implication to sequence-dependent non-uniform DNA triplex

DNA triplexes are formed by both isomorphic (structurally alike) and non-isomorphic (structurally dissimilar) base triplets. It is espoused here that (i) the base triplet non-isomorphism may be articulated in structural terms by a residual twist (Δt°), the angle formed by line joining the C1′…C1′ atoms of the adjacent Hoogsteen or reverse Hoogsteen (RH) base pairs and the difference in base triplet radius (Δr Å), and (ii) their influence on DNA triplex is largely mechanistic, leading to the prediction of a high (t + Δt)° and low (t − Δt)° twist at the successive steps of Hoogsteen or RH duplex of a parallel or antiparallel triplex. Efficacy of this concept is corroborated by molecular dynamics (MD) simulation of an antiparallel DNA triplex comprising alternating non-isomorphic G*GC and T*AT triplets. Conformational changes necessitated by base triplet non-isomorphism are found to induce an alternating (i) high anti and anti glycosyl and (ii) BII and an unusual BIII conformation resulting in a zigzag backbone for the RH strand. Thus, base triplet non-isomorphism causes DNA triplexes into exhibiting sequence-dependent non-uniform conformation. Such structural variations may be relevant in deciphering the specificity of interaction with DNA triplex binding proteins. Seemingly then, residual twist (Δt°) and radial difference (Δr Å) suffice as indices to define and monitor the effect of base triplet non-isomorphism in nucleic acid triplexes.     

The role of polyamines, Na(+) and K(+) in the formation of triple helices between purine oligonucleotides and the promoter region of the human c-src proto-oncogene

Binding constants for triplex formation between purine-rich oligonucleotides and a pyrimidine·purine tract of the human c-src proto-oncogene were measured by fluorescence polarization in the presence of polyamines, Na⁺ and K⁺. In both the hexamine and tetramine series, the longer polyamines had the larger binding constants for triplex formation at low concentrations of polyamine. At higher concentrations all values tended to plateau in the 10⁹/M range. In contrast to previous reports, K⁺ did not inhibit triplex formation and at 150 mM the binding constants were again in the 10⁹/M range for both an 11mer and 22mer oligonucleotide. At 150 mM K⁺ the addition of polyamines did not lead to any significant increase in the binding constants. It was determined that the lack of inhibition by K⁺ was due to the low concentration (1 nM) of purine oligonucleotide required for the fluorescence polarization technique. At higher concentrations (1 µM) self-association of the oligonucleotide was observed. These results suggest that in vivo, at least for the c-src promoter, the inhibition of triplex formation by K⁺ may not be detrimental. However, it may be difficult to achieve binding constants above ~10⁹/M even in the presence of polycations.     

Relative stability of triplexes containing different numbers of T.AT and C+.GC triplets.

We have used DNase I footprinting to compare the stability of parallel triple helices containing different numbers of T.AT and C+. GC triplets. We have targeted a fragment containing the 17mer sequence 5'-AGGAAGAGAAAAAAGAA with the 9mer oligonucleotides 5'-TCCTTCTCT, 5'-TTCTCTTTT and 5'-TTTTTTCTT, which form triplexes at the 5'-end, centre and 3'-end of the target site respectively. Quantitative DNase I footprinting has shown that at pH 5.0 the dissociation constants of these oligonucleotides are 0.13, 4.7 and >30 microM respectively, revealing that increasing the proportion of C+.GC triplets increases triplex stability. The results suggest that the positive charge on the protonated cytosine contributes to triplex stability, either by a favourable interaction with the stacked pisystem or by screening the charge on the phosphate groups. In the presence of a naphthylquinoline triplex binding ligand all three oligonucleotides bind with similar affinities. At pH 6.0 these triplexes only form in the presence of the triplex binding ligand, while at pH 7.5 footprints are only seen with the oligonucleotide which generates the fewest number of C+.GC triplets (TTTTTTCTT) in the presence of the ligand.     

Length-dependent structure formation in Friedreich ataxia (GAA)n*(TTC)n repeats at neutral pH

More than 15 human genetic diseases have been associated with the expansion of trinucleotide DNA repeats, which may involve the formation of non-duplex DNA structures. The slipped-strand nucleation of duplex DNA within GC-rich trinucleotide repeats may result in the changes of repeat length; however, such a mechanism seems less likely for the AT-rich (GAA)_n·(TTC)_n repeats. Using two-dimensional agarose gels, chemical probing and atomic force microscopy, we characterized the formation of non-B-DNA structures in the Friedreich ataxia-associated (GAA)_n·(TTC)_n repeats from the FRDA gene that were cloned with flanking genomic sequences into plasmids. For the normal genomic repeat length (n = 9) our data are consistent with the formation of a very stable protonated intramolecular triplex (H-DNA). Its stability at pH 7.4 is likely due to the high proportion of the T·A·T triads which form within the repeats as well as in the immediately adjacent AT-rich sequences with a homopurine· homopyrimidine bias. At the long normal repeat length (n = 23), a family of H-DNAs of slightly different sizes has been detected. At the premutation repeat length (n = 42) and higher negative supercoiling, the formation of a single H-DNA structure becomes less favorable and the data are consistent with the formation of a bi-triplex structure.     

Base triplet nonisomorphism strongly influences DNA triplex conformation: effect of nonisomorphic G* GC and A* AT triplets and bending of DNA triplexes

Structural understanding of DNA triplexes is grossly inadequate despite their efficacy as therapeutic agents. Lack of structural similarity (isomorphism) of base triplets that figure in different DNA triplexes brings in an added complexity. Recently, we have shown that the residual twist (Deltat degrees ) and the radial difference (Deltar A) adequately define base triplet nonisomorphism in structural terms and allow assessment of their role in conferring stability as well as sequence-dependent structural variations in DNA triplexes. To further corroborate these, molecular dynamics (MD) simulations are carried out on DNA triplexes comprising nonisomorphic G* GC and A* AT base triplets under different sequential contexts. Base triplet nonisomorphism between G* GC and A* AT triplets is dominated by Deltat degrees (9.8 degrees ), in view of small Deltar (0.2 A), and is in contrast to G* GC and T* AT triplets where both Deltat degrees (10.6 degrees ) and Deltar (1.1A) are prominent. Results show that Deltat degrees alone enforces mechanistic influence on the triplex-forming purine strand so as to favor a zigzag conformation with alternating conformational features that include high (40 degrees ) and low (20 degrees ) helical twists, and high anti(G) and anti(A) glycosyl conformation. Higher thermal stability of this triplex compared to that formed with G* GC and T* AT triplets can be traced to enhanced base-stacking and counterion interactions. Surprisingly, it is found for the first time that the presence of a nonisomorphic G* GC or A* AT base triplet interrupting an otherwise mini A* AT or G* GC isomorphic triplex can induce a bend/curvature in a DNA triplex. These observations should prove useful in the design of triplex-forming oligonucleotides and in the understanding the binding affinities of this triplex with proteins.     

Mg2+-induced triplex formation of an equimolar mixture of poly(rA) and poly(rU)

Magnesium ions strongly influence the structure and biochemical activity of RNA. The interaction of Mg²⁺ with an equimolar mixture of poly(rA) and poly(rU) has been investigated by UV spectroscopy, isothermal titration calorimetry, ultrasound velocimetry and densimetry. Measurements in dilute aqueous solutions at 20°C revealed two differ ent processes: (i) Mg²⁺ binding to unfolded poly(rA)·poly(rU) up to [Mg²⁺]/[phosphate] = 0.25; and (ii) poly(rA)·2poly(rU) triplex formation at [Mg²⁺]/[phosphate] between 0.25 and 0.5. The enthalpies of these two different processes are favorable and similar to each other, ~–1.6 kcal mol^–1 of base pairs. Volume and compressibility effects of the first process are positive, 8 cm³ mol^–1 and 24 × 10^–4 cm³ mol^–1 bar^–1, respectively, and correspond to the release of water molecules from the hydration shells of Mg²⁺ and the polynucleotides. The triplex formation is also accompanied by a positive change in compressibility, 14 × 10^–4 cm³ mol^–1 bar^–1, but only a small change in volume, 1 cm³ mol^–1. A phase diagram has been constructed from the melting experiments of poly(rA)·poly(rU) at a constant K⁺ concentration, 140 mM, and various amounts of Mg²⁺. Three discrete regions were observed, corresponding to single-, double- and triple-stranded complexes. The phase boundary corresponding to the transition between double and triple helical conformations lies near physiological salt concentrations and temperature.     

Parallel intramolecular DNA triple helix with G and T bases in the third strand stabilized by Zn(2+) ions

We present evidence of formation of an intramolecular parallel triple helix with T•A.T and G•G.C base triplets (where • represents the hydrogen bonding interaction between the third strand and the duplex while . represents the Watson–Crick interactions which stabilize the duplex). The third GT strand, containing seven GpT/TpG steps, targets the polypurine sequence 5′-AGG-AGG-GAG-GAG-3′. The triple helix is obtained by the folding back twice of a 36mer, formed by three dodecamers tethered by hydroxyalkyl linkers (-L-). Due to the design of the oligonucleotide, the third strand orientation is parallel with respect to the polypurine strand. Triple helical formation has been studied in concentration conditions in which native gel electrophoresis experiments showed the absence of intermolecular structures. Circular dichroism (CD) and UV spectroscopy have been used to evidence the triplex structure. A CD spectrum characteristic of triple helical formation as well as biphasic UV and CD melting curves have been obtained in high ionic strength NaCl solutions in the presence of Zn²⁺ ions. Specific interactions with Zn²⁺ ions in low water activity conditions are necessary to stabilize the parallel triplex.     

DNA sequence specificity of triplex-binding ligands.

We have examined the ability of naphthylquinoline, a 2,7-disubstituted anthraquinone and BePI, a benzo[e]pyridoindole derivative, to stabilize parallel DNA triplexes of different base composition. Fluorescence melting studies, with both inter- and intramolecular triplexes, show that all three ligands stabilize triplexes that contain blocks of TAT triplets. Naphthylquinoline has no effect on triplexes formed with third strands composed of (TC)n or (CCT)n, but stabilizes triplexes that contain (TTC)n. In contrast, BePI slightly destabilizes the triplexes that are formed at (TC)n (CCT)n and (TTC)n. 2,7-Anthraquinone stabilizes (TC)n (CCT)n and (TTC)n, although it has the greatest effect on the latter. DNase I footprinting studies confirm that triplexes formed with (CCT)n are stabilized by the 2,7-disubstituted amidoanthraquinone but not by naphthylquinoline. Both ligands stabilize the triplex formed with (CCTT)n and neither affects the complex with (CT)n. We suggest that BePI and naphthylquinoline can only bind between adjacent TAT triplets, while the anthraquinone has a broader sequence of selectivity. These differences may be attributed to the presence (naphthylquinoline and BePI) or absence (anthraquinone) of a positive charge on the aromatic portion of the ligand, which prevents intercalation adjacent to C+GC triplets. The most stable structures are formed when the stacked rings (bases or ligand) alternate between charged and uncharged species. Triplexes containing alternating C+GC and TAT triplets are not stabilized by ligands as they would interrupt the alternating pattern of charged and uncharged residues.     

Recombination R-triplex: H-bonds contribution to stability as revealed with minor base substitutions for adenine

Several cellular processes involve alignment of three nucleic acids strands, in which the third strand (DNA or RNA) is identical and in a parallel orientation to one of the DNA duplex strands. Earlier, using 2-aminopurine as a fluorescent reporter base, we demonstrated that a self-folding oligonucleotide forms a recombination-like structure consistent with the R-triplex. Here, we extended this approach, placing the reporter 2-aminopurine either in the 5′- or 3′-strand. We obtained direct evidence that the 3′-strand forms a stable duplex with the complementary central strand, while the 5′-strand participates in non-Watson–Crick interactions. Substituting 2,6-diaminopurine or 7-deazaadenine for adenine, we tested and confirmed the proposed hydrogen bonding scheme of the A*(T·A) R-type triplet. The adenine substitutions expected to provide additional H-bonds led to triplex structures with increased stability, whereas the substitutions consistent with a decrease in the number of H-bonds destabilized the triplex. The triplex formation enthalpies and free energies exhibited linear dependences on the number of H-bonds predicted from the A*(T·A) triplet scheme. The enthalpy of the 10 nt long intramolecular triplex of −100 kJ·mol⁻¹ demonstrates that the R-triplex is relatively unstable and thus an ideal candidate for a transient intermediate in homologous recombination, t-loop formation at the mammalian telomere ends, and short RNA invasion into a duplex. On the other hand, the impact of a single H-bond, 18 kJ·mol⁻¹, is high compared with the overall triplex formation enthalpy. The observed energy advantage of a ‘correct’ base in the third strand opposite the Watson–Crick base pair may be a powerful mechanism for securing selectivity of recognition between the single strand and the duplex.     

Hydration effects of Ni(2+) binding to synthetic polynucleotides with regularly alternating purine-pyrimidine sequences

High precision ultrasonic and densimetric techniques have been used to study the interaction of Ni²⁺ ions with right-handed poly[d(G-C)]·poly[d(G-C)], poly-[d(A-C)]·poly[d(G-T)] and poly[d(A-T)]·poly[d(A-T)] in 5 mM CsCl, 0.2 mM HEPES, pH 7.5 at 20°C. From these measurements the changes in the apparent molar volume and the apparent molar adiabatic compressibility due to the interaction have been obtained. The volume effects of the binding, calculated per mole of Ni²⁺ ions, range from 11.7 to 23.9 cm³ mol^–1 and the compressibility effects range from 19.3 × 10^–4 to 43.1 × 10^–4 cm³ mol^–1 bar^–1. These data are interpreted in terms of dehydration of the polynucleotides and Ni²⁺ ions, i.e. the release of water molecules from the hydration shells of the molecules. An increase in G+C content gives an increase in volume and compressibility effects, indicating a rise in the extent of dehydration. The dehydration effects of Ni²⁺ binding to poly[d(G-C)]·poly[d(G-C)] are approximately twice those of poly[d(A-T)]·poly[d(A-T)]. The volume and compressibility effects of Ni²⁺–EDTA complex formation have also been measured and used as a model system for quantitative estimation. These values revealed that Ni²⁺ ions can coordinate two atomic groups of poly[d(G-C)]·poly[d(G-C)], while in the case of the Ni²⁺–poly[d(A-T)]·poly[d(A-T)] complex volume and compressibility effects correspond to one direct or two indirect (through water) contacts.     

Purification and Characterization of Two Highly Thermophilic Alkaline Lipases from Thermosyntropha lipolytica

Two thermostable lipases were isolated and characterized from Thermosyntropha lipolytica DSM 11003, an anaerobic, thermophilic, alkali-tolerant bacterium which grows syntrophically with methanogens on lipids such as olive oil, utilizing only the liberated fatty acid moieties but not the glycerol. Lipases LipA and LipB were purified from culture supernatants to gel electrophoretic homogeneity by ammonium sulfate precipitation and hydrophobic interaction column chromatography. The apparent molecular masses of LipA and LipB determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis were 50 and 57 kDa, respectively. The temperature for maximal activity of LipA and LipB was around 96°C, which is, so far as is known, the highest temperature for maximal activity among lipases, and the pH optima for growth determined at 25°C (pH^25°C optima) were 9.4 and 9.6, respectively. LipA and LipB at 100°C and pH^25°C 8.0 retained 50% activity after 6 and 2 h of incubation, respectively. Both enzymes exhibited high activity with long-chain fatty acid glycerides, yielding maximum activity with trioleate (C_18:1) and, among the p-nitrophenyl esters, with p-nitrophenyl laurate. Hydrolysis of glycerol ester bonds occurred at positions 1 and 3. The activities of both lipases were totally inhibited by 10 mM phenylmethylsulfonyl fluoride and 10 mM EDTA. Metal analysis indicated that both LipA and LipB contain 1 Ca²⁺ and one Mn²⁺ ion per monomeric enzyme unit. The addition of 1 mM MnCl₂ to dialyzed enzyme preparations enhanced the activities at 96°C of both LipA and LipB by threefold and increased the durations of their thermal stability at 60°C and 75°C, respectively, by 4 h.     

Site-resolved stabilization of a DNA triple helix by magnesium ions

Proton exchange and NMR spectroscopy have been used to define the effects of Mg²⁺ ions upon the stability of individual base pairs in the intramolecular parallel triple helix formed by the DNA oligonucleotide d(GAAGAGGTTTTTCCTCTTCTTTTTCTTCTCC). The rates of exchange of individual Watson–Crick and Hoogsteen imino protons in the DNA triple helix were measured in the absence and in the presence of Mg²⁺ ions. The results reveal that Mg²⁺ lowers the exchange rates of most imino protons in the structure by stabilizing the corresponding base pairs in their native closed conformation. Comparison of the DNA triple helix containing Na⁺ counterions to the same helix containing Mg²⁺ counterions shows that these stabilizing effects result, in large part, from Mg²⁺ ions closely associated with the DNA. Moreover, the effects are site-specific and depend on the number and location of protonated cytosines relative to the observed base. These findings provide new insights into the molecular roles of C⁺·GC triads in determining the stability of DNA triple-helical structures.     

Stabilities of intrastrand pyrimidine motif DNA and RNA triple helices

Nucleic acid triple helices have provoked interest since their discovery more than 40 years ago, but it remains unknown whether such structures occur naturally in cells. To pursue this question, it is important to determine the stabilities of representative triple helices at physiological temperature and pH. Previous investigations have concluded that while both DNA and RNA can participate in the pyrimidine triplex motif under mildly acidic conditions, these structures are often relatively unstable at neutral pH. We are now explorin g the stability of intrastrand DNA and RNA pyrimidine motif triplexes at physiological temperature and pH. Duplex and triplex formation were monitored by thermal denaturation analysis, circular dichroism spectroscopy and gel shift experiments. Short intrastrand triplexes were observed to form in the pyrimidine motif in both DNA and RNA. In the presence of physiological concentrations of Mg²⁺ and at physiological pH, all detected triplexes were sufficiently stable to persist at physiological temperature. If sequences specifying such intrastrand triplexes are encoded in genomes, the potential exists for the formation of stable structures in RNA or DNA in vivo.     

Reduction of the 2,2′-Azinobis(3-Ethylbenzthiazoline-6-Sulfonate) Cation Radical by Physiological Organic Acids in the Absence and Presence of Manganese

Laccase is a copper-containing phenoloxidase, involved in lignin degradation by white rot fungi. The laccase substrate range can be extended to include nonphenolic lignin subunits in the presence of a noncatalytic cooxidant such as 2,2′-azinobis(3-ethylbenzthiazoline-6-sulfonate) (ABTS), with ABTS being oxidized to the stable cation radical, ABTS^·+, which accumulates. In this report, we demonstrate that the ABTS^·+ can be efficiently reduced back to ABTS by physiologically occurring organic acids such as oxalate, glyoxylate, and malonate. The reduction of the radical by oxalate results in the formation of H₂O₂, indicating the formation of O₂^·− as an intermediate. O₂^·− itself was shown to act as an ABTS^·+ reductant. ABTS^·+ reduction and H₂O₂ formation are strongly stimulated by the presence of Mn²⁺, with accumulation of Mn³⁺ being observed. Additionally, 4-methyl-O-isoeugenol, an unsaturated lignin monomer model, is capable of directly reducing ABTS^·+. These data suggest several mechanisms for the reduction of ABTS^·+ which would permit the effective use of ABTS as a laccase cooxidant at catalytic concentrations.     

Formation of an intramolecular triple-stranded DNA structure monitored by fluorescence of 2-aminopurine or 6-methylisoxanthopterin

The parallel (recombination) ‘R-triplex’ can accommodate any nucleotide sequence with the two identical DNA strands in parallel orientation. We have studied oligonucleotides able to fold back into such a recombination-like structure. We show that the fluorescent base analogs 2-aminopurine (2AP) and 6-methylisoxanthopterin (6MI) can be used as structural probes for monitoring the integrity of the triple-stranded conformation and for deriving the thermodynamic characteristics of these structures. A single adenine or guanine base in the third strand of the triplex-forming and the control oligonucleotides, as well as in the double-stranded (ds) and single-stranded (ss) reference molecules, was substituted with 2AP or 6MI. The 2AP*(T·A) and 6MI*(C·G) triplets were monitored by their fluorescence emission and the thermal denaturation curves were analyzed with a quasi-two-state model. The fluorescence of 2AP introduced into an oligonucleotide sequence unable to form a triplex served as a negative control. We observed a remarkable similarity between the thermodynamic parameters derived from melting of the secondary structures monitored through absorption of all bases at 260 nm or from fluorescence of the single base analog. The similarity suggests that fluorescence of the 2AP and 6MI base analogs may be used to monitor the structural disposition of the third strand. We consider the data in the light of alternative ‘branch migration’ and ‘strand exchange’ structures and discuss why these are less likely than the R-type triplex.     

Melting studies of dangling-ended DNA hairpins: effects of end length,loop sequence and biotinylation of loop bases

The effects of 3′ single-strand dangling-ends of different lengths, sequence identity of hairpin loop, and hairpin loop biotinylation at different loop residues on DNA hairpin thermodynamic stability were investigated. Hairpins contained 16 bp stem regions and five base loops formed from the sequence, 5′-TAGTCGACGTGGTCC-N₅-GGACCACGTCGACTAG-E_n-3′. The length of the 3′ dangling-ends (E_n) was n = 13 or 22 bases. The identities of loop bases at positions 2 and 4 were varied. Biotinylation was varied at loop base positions 2, 3 or 4. Melting buffers contained 25 or 115 mM Na⁺. Average t_m values for all molecules were 73.5 and 84.0°C in 25 and 115 mM Na⁺, respectively. Average two-state parameters evaluated from van’t Hoff analysis of the melting curve shapes in 25 mM Na⁺ were ΔH_vH = 84.8 ± 15.5 kcal/mol, ΔS_vH = 244.8 ± 45.0 cal/K·mol and ΔG_vH = 11.9 ± 2.1 kcal/mol. In 115 mM Na⁺, two-state parameters were not very different at ΔH_vH = 80.42 ± 12.74 kcal/mol, ΔS_vH = 225.24 ± 35.88 cal/K·mol and ΔG_vH = 13.3 ± 2.0 kcal/mol. Differential scanning calorimetry (DSC) was performed to test the validity of the two-state assumption and evaluated van’t Hoff parameters. Thermodynamic parameters from DSC measurements (within experimental error) agreed with van’t Hoff parameters, consistent with a two-state process. Overall, dangling-end DNA hairpin stabilities are not affected by dangling-end length, loop biotinylation or sequence and vary uniformly with [Na⁺]. Consider able freedom is afforded when designing DNA hairpins as probes in nucleic acid based detection assays, such as microarrays.