Evidence for selective sulfhydryl reactivity in cytochalasin A--mediated bacterial inhibitions.

Cytochalasin A (CA) at 5 × 10^?5$\text{M}$ strongly inhibits glucose transport in Arthrobacter sialophilis. This effect and other bacteriostatic and metabolic inhibitions of gram-positive bacteria are not caused by the closely related congeners cytochalasin B or D. Inhibitions by CA are nullified by prior drug incubation with sulfhydryl compounds. It was also found that the characterized adduct of CA with β-mercaptoethanol is devoid of biological activity. N-ethylmaleimide, p-chloromercuribenzoate and ethacrynic acid (a known, liposoluble, sulfhydryl reactant) were each shown at 5 × 10^?5$\text{M}$ to be relatively ineffective in inhibiting D-glucose transport in $\text{A. sialophilus}$. These observations suggest that CA reacts at the molecular biological level in a site-specific manner.     

Structure of a ribosomal 5S RNA from a mushroom, Coprinus cinereus

The nucleotide sequence of the 5S rRNA from a mushroom, $\text{Coprinus cinereus}$, was determined to be: pAUCCACGGCCAUACGACUCUGAAAGCACCGCACCGCAUCCCGUCCGAUCUGCGCAGUUAACCAGAGUGCCGCUCAGUUAGUACCACGGUGGGGGACCACGCGGGAAUCCUGGGUGCUGUGGUU. This sequence is consistent with current models for the secondary structure of 5S RNAs and indicates a very high degree of sequence conservation among the most highly evolved fungi. Sequence heterogeneity was not evident in this fungus suggesting that the more highly evolved fungi may not contain the dispersed pattern of 5S rRNA genes which have been observed in intermediate fungi such as $\text{Neurospora}$ (Selker, E.U., and Yanofsky, C. (1981) Cell $\text{24}$, 819–828.)     

Crystallization of ribonuclease St

The crystals of ribonuclease St, the extracellular ribonuclease from Streptomyces erythreus, have been obtained from (NH₄)₂SO₄ solution with acetate buffer (pH 4.1). The crystals belong to a monoclinic space group C2 with dimensions $\text{a = 88.4}\text{A}\text{?}\text{, b = 33.0}\text{A}\text{?}\text{, c = 69.0}\text{A}\text{?}\text{, β = 98.4 °}$. There are two protein molecules per asymmetric unit. The crystals diffract beyond 2.0 Å resolution.     

The amino acid sequence of carbonic anhydrase I from the rhesus macaque

The complete amino acid sequence of carbonic anhydrase I (CA I) isolated from the red cells of the rhesus macaque ($\text{Macaca}$$\text{mulatta}$) is presented. This sequence was obtained by aligning peptides derived from various fragmentation procedures with the fully characterized sequence of human CA I. When the peptides of rhesus CA I were ordered in this manner, 13 of the 260 residues were found to differ from the human CA I sequence. The known markedly higher specific esterase activity of rhesus CA I compared to human CA I could not be correlated with any changes in residues postulated to be within 10 Å of the single zinc ion at the active site.     

Antagonistic activity of soil acidophilic actinomycetes

It has been shown that soil acidophilic actinomycetes (mycelial prokaryotes with a growth optinum between pH 3 and 7) markedly differ from neutrophilic actinomycetes in antimicrobial activity: the former are more active against fungi and yeasts, whereas the latter effectively suppress Gram-positive bacteria. Acidophilic streptomycetes actively inhibit the growth of phytopathogenic fungi, especially on acidic media.     

Simultaneous determination of cysteine sulfinic acid and cysteic acid in rat brain by high-performance liquid chromatography

A sensitive and specific assay method for cysteine sulfinic acid (CSA) and cysteic acid (CA) using high-performance liquid chromatography has been developed. The method includes post-column derivatization of various amino acids with o-phthalaldehyde in the presence of 2-mercaptoethanol. The column packed with cation-exchange resin ($\text{ISC-07}\text{S1504}$, Shimadzu Sci entific instruments, Inc., Kyoto, Japan) was used for obtaining general separation of amino acids except CSA and CA, while the separation of CSA and CA was achieved using a strong-base anion exchange ($\text{ISA-07}\text{S2504}$, Shimadzu Scientific Instruments) column. The fluorescence peak area for CSA was linear between 20 pmol and 5 nmol, whereas that for CA was 10 pmol to 5 nmol. The regional distribution of CSA, CA, and other amino acids in the rat brain was studied using this new assay method.     

1H NMR spectroscopy of carbohydrates from the G glycoprotein of vesicular stomatitis virus grown in parental and Lec4 Chinese hamster ovary cells

Carbohydrate moieties derived from the G glycoprotein of Vesicular Stomatitis Virus (VSV) grown in parental Chinese hamster ovary (CHO) cells and the glycosylation mutant Lec4 have been analyzed by high-field ¹H NMR spectroscopy. The major glycopeptides of $\text{CHO}\text{VSV}$ and $\text{Lec4}\text{VSV}$ were purified by their ability to bind to concanavalin A-Sepharose. The carbohydrates in this fraction are of the biantennary, complex type with heterogeneity in the presence of α(2,3)-linked sialic acid and α(1,6)-linked fucose residues. A minor $\text{CHO}\text{VSV}$ glycopeptide fraction, which does not bind to concanavalin A-Sepharose but which binds to pea lectin-agarose, was also investigated by ¹H NMR spectroscopy. These carbohydrates are complex moieties which appear to contain N-acetylglucosamine in β(1,6) linkage. Their spectral properties are most similar to those of a triantennary complex oligosaccharide containing a 2,6-disubstituted mannose α(1,6) residue. Carbohydrates of this type are not found among the glycopeptides of VSV grown in the Lec4 CHO glycosylation mutant.     

Microbial population of feedlot waste and associated sites

A quantitative determination was made every 2 months for a year of the microflora of beef cattle waste and runoff at a medium-sized midwestern feedlot. Counts were obtained for selected groups of organisms in waste taken from paved areas of pens cleaned daily and, therefore, reflect the flora of raw waste. Overall, in terms of viable count per gram dry weight, the feedlot waste contained 10¹⁰ total organisms, 10⁹ anaerobes, 10⁸ gram-negative bacteria, 10⁷ coliforms, 10⁶ sporeformers, and 10⁵ yeasts, fungi, and streptomycetes. The specific numbers and pattern of these groups of organisms varied only slightly during the study in spite of a wide variation in weather. Data indicate that little microbial growth occurs in the waste as it exists in the feedlot. Runoff from the pens contained the same general population pattern but with greater variation attributable to volume of liquid. Comparable determinations of an associated field disposal area (before and after cropping), stockpiled waste, and elevated dirt areas in the pens indicate that fungi, and especially streptomycetes, are the aerobic organisms most associated with final stabilization of the waste. Yeasts, which are the dominant type of organism in the ensiled corn fed the cattle, do not occur in large numbers in the animal waste. Large ditches receiving runoff and subsurface water from the fields have a population similar to the runoff but with fewer coliforms.     

Specific activity of LHRH and TRH degrading enzymes in various tissues of normal and castrated male rats.

The chlorophyll composition and Hill activity of the leaf, developing seed parts and pod have been studied in three species of legumes, $\text{Lathyrus latifolius}$, $\text{Pisum sativum}$ and $\text{Vicia faba}$. The studies indicate that in all the species, the level of chlorophyll, on mg/g fresh weight basis, is maximum in the leaf. However, Hill activity studies show that the cotyledonary chloroplasts in all the cases have a higher Hill activity than the leaf chloroplasts. Thus, the Hill activities of the cotyledonary chloroplasts are 340% of the leaf chloroplasts in $\text{Lathyrus}$$\text{latifolius}$, 144% of the leaf chloroplasts in $\text{Pisum}$$\text{sativum}$ and 200% of the leaf chloroplasts in $\text{Vicia}$$\text{faba}$.     

Isolation and properties of the cytochrome B-C1 complex from Rhodopseudomonas sphaeroides

A highly purified and active cytochrome $\text{b}$-$\text{c}$₁ complex has been isolated from the chromatophores of the photosynthetic bacteria $\text{Rhodopseudomonas}\text{sphaeroides}$ R-26, through steps of Triton X-100 solubilization, salt fractionation and calcium phosphate column chromatography. The isolated enzyme complex catalyzes fully antimycin A sensitive oxidation of ubiquinol by cytochrome $\text{c}$ with a turnover number of 1500 per minute at 23° based on cytochrome $\text{c}$₁. It contains 8.3 nmoles of cytochromes $\text{b}$ and $\text{c}$₁ per mg protein and shows four polypeptides in the sodium dodecylsulfate polyacrylamide gel electrophoresis.     

Binding of cytochrome c to the cytochrome bc1 complex (complex III) and its subunits cytochrome c1 and b1.

Cytochrome $\text{c}$₁, the electron donor for cytochrome $\text{c}$, is a subunit of the mitochondrial cytochrome $\text{bc}$₁ complex (complex III, cytochrome $\text{c}$ reductase). To test if cytochrome $\text{c}$₁ is the cytochrome $\text{c}$-binding subunit of the $\text{bc}$₁ complex, binding of cytochrome $\text{c}$ to the complex and to isolated cytochrome $\text{c}$₁ was compared by a gel-filtration method under non-equilibrium conditions (a $\text{bc}$₁ complex lacking the Rieske ironsulfur protein was used; von Jagow et al. (1977) Biochim. Biophys. Acta $\text{462}$, 549–558). The approximate stoichiometries and binding affinities were found to be very similar. Binding of cytochrome $\text{c}$ to isolated cytochrome $\text{b}$ which is another subunit of the reductase was not detectable by the gel-filtration method. Further, the same lysine residues of cytochrome $\text{c}$ were shielded towards chemical acetylation in the complexes $\text{c}\text{:}\text{c}$₁ and $\text{c}\text{:}\text{bc}$₁. From this we conclude that the same surface area of cytochrome $\text{c}$ is in direct contact with cytochrome $\text{bc}$₁ and with cytochrome $\text{c}$₁ in the respective complexes and that therefore cytochrome $\text{c}$ is most probably the structural ligand for cytochrome $\text{c}$ in mitochondrial cytochrome $\text{c}$ reductase.     

Selectivity of oxidase and reductase activity of horse heart cytochrome c

The ascorbate-TMPD-cytochrome $\text{c}$ oxidase and succinate cytochrome $\text{c}$ reductase activities and the redox potentials of native and chemically modified cytochromes $\text{c}\text{—NBS-cytochrome}\text{c}$ with modification of Trp-59 and Met-65, nitro-cytochrome $\text{c}$ with modification of Tyr-67, and a new preparation, Chloramine-T-cytochrome m$\text{c}$ with modification of Met-80 and -65 to methionine sulfoxide—have been compared at pH 7.8 in 25 mM cacodylate-Tris buffer. These modifications exhibit (i) a slight lowering of redox potential, from 260 mV to 180, 215 and 170 mV, respectively, (ii) destabilization of the cytochrome $\text{c}$-reductase complex, 6 to 12 fold, but without alteration of the cytochrome $\text{c}$-oxidase complex, and (iii) a slight lowering of the maximum velocity for both the oxidase and reductase reactions. The selective destabilization of the cytochrome $\text{c}$-reductase complex is interpreted as an indication of a two-path, two-function model for the oxido-reduction function of cytochrome $\text{c}$.     

Reversible redox titrations of cytochrome c and cytochrome c oxidase using detergent solubilized electrochemically generated mediator-titrants

The repetitive, $\text{reversible}$ equilibrium redox cycling of cytochrome $\text{c}$, cytochrome $\text{c}$ oxidase, or mixtures thereof has been made possible by the use of the oxidant, ferricinium ion. This ion is electrochemically generated by the use of non-ionic detergent solubilized ferrocene which is apparently incorporated as micelles and readily electron transfers with an electrode. The $\text{ferricinium-ferrocene}$ couple equilibrates rapidly with these heme proteins. Electrochemically generated benzylviologen radical cations are used as the reductant. The E^O′ values for cytochrome $\text{c}$ oxidase at pH 7.0 are 209 ± 15 mv (2e^?) and 340 ± 15 mv (2e^?).     

Studies on Substances Active on the Behavior of Planarian

Substances which acted on the behavior of planarian were searched for, and two active components were isolated from culture broth of Streptomyces sp. 340. They were identified as trans-3-methylthioacrylic acid (MTAA) and 3-methylthiopropionic acid (MTPA).

It was found that many Streptomyces and some fungi accumulated MTAA, and many Streptomyces, fungi, bacteria and yeasts accumulated MTPA when the microorganisms were grown in the medium containing methionine.     

Pulmonary cell response to bacterial challenge in mutant mice with some hereditary alterations resembling cystic fibrosis

Animal models make it possible to perform studies that normally can not be done in human beings. In the present work, the cellular response pattern of the lungs both to the environment and to a challenger strain of bacteria were analyzed in two mouse mutations-cribriform degeneration ($\text{cri}$) and motheaten (me)-. The mice were submitted to an infective aerosol containing $\text{Staphylococcus aureus}$ and were killed either immediately or 4 h after exposure; pulmonary washings were performed in these animals as well as in non-infected controls. The results showed neither quantitative differences in the total cell count nor in cell viability between the different groups. However, there were qualitative changes in the differential cell content characterized by a neutrophilic response in $\text{cri}$/$\text{cri}$ mice and a giant cell response in $\text{me}$/$\text{me}$ mice. Since most of the cystic fibrosis patients suffer from chronic lung infection, with a persistently high proportion of neutrophils, these findings point to the $\text{cri}$/$\text{cri}$ mouse as a promising animal model for cystic fibrosis studies.     

Photoaffinity labelling by S-(p-azidophenacyl)-glutathione of glyoxalase II and glutathione S-transferase

S-(p-azidophenacyl)-glutathione, $\text{l}$, is a linear competitive inhibitor at pH 7.40 of beef liver glyoxalase II with K_i = 7.96 × 10^?4 M. On irradiation at 340 nm it covalently inhibits glyoxalase II to a level of 42 ± 5% inhibition. This photoaffinity labelling is prevented by the presence of a glyoxalase II competitive inhibitor (the hemimercaptal of glutathione and methylglyoxal). A crude preparation of sheep liver glutathione S-transferases is also irreversibly inactivated (86% ± 5% inhibition) by irradiation at 320 nm in the presence of $\text{l}$.     

Effects of gaseous anaesthetics and inert gases on the phase transition in smectic mesophases of dipalmitoyl phosphatidylcholine

The phase transition in smectic mesophases of dipalmitoyl phosphatidylcholine was studied under high pressures of helium (340 atm), nitrogen (340 atm), nitrous oxide (43 atm), cyclopropane (4.4 atm) and $\text{n-}\text{propane}$ (8.2 atm), using a turbidimetric technique. Helium and nitrogen increased the transition temperature by 0.021 and 0.006°C/atm, respectively, compared with 0.024°C/atm for hydrostatic pressure. Nitrous oxide reduced the transition by 0.58°C/atm. The hydrocarbon gases spread the transition width and lowered the transition temperature with increasing effect at higher doses. Comparisons with other membrane probes are made and the concentration of gases in the bilayer which lower the transition temperature by 1°C are estimated, in mol%: He, 10.2; N₂, 13.2; N₂O, 9.04; $\text{n-}\text{C}{}_3\text{H}{}_8$, 6.3 and cyclopropane, 12.8.     

I/i antigens on the peripheral blood lymphocytes in Graves disease

I/i antigens on the membrane of peripheral blood lymphocytes (PBL) in Graves disease were investigated by bithermic 2-hr cytotoxicity assay using homogeneous anti-i and anti-I cold agglutinins (CA). Cytotoxicity curves using dilutions of CA from $\text{1}\text{100}$ to $\text{1}\text{1200}$ and 50% cytotoxicity titers were assessed in 20 patients with Graves disease and 22 matched controls. No statistically significant differences were observed in cytotoxicity curves up to the highest dilution, whereas estimation of the 50% cytotoxic titers showed that PBL in Graves disease were slightly more susceptible to anti-I CA as compared to normal PBL. Thus, the statement of Farid et al. (Cell. Immunol.22, 394, 1976) that PBL in Graves disease are less susceptible to cold agglutinins and that their I/i antigens are masked by autoantibodies cannot be confirmed.     

Activité des corpora allata et contrôle photopériodique de la maturation ovarienne chez Locusta migratoria

Locusta migratoria migratoria females of the ‘Kazalinsk’ strain show a sustained inhibition of ovarian maturation when submitted to long-day photoperiodic conditions ($\text{17}\text{hr}\text{24}\text{hr}$). A full ovarian cycle can be initiated at any time throughout adult life by implantation of corpora allata (CA) taken from egg-laying females. Therefore, in inhibited females, the gonadotropic activity of the CA fail to allow normal vitellogenesis. However, if such females receive CA taken from females conditioned in the same way, a full ovarian cycle still occurs. If CA taken from 5-week-old, either mature or immature, females are implanted into 5-day-old females reared without males under long-day lighting, a single ovarian cycle results, no matter what the state of the donor females. The possibility is discussed that in L. migratoria females neurosecretory material may be involved in the functional development of adult CA, whereas the gonadotropic hormone is released from the CA under nervous control, as far as a photoperiod-sensitive strain is concerned.     

The dextro and levorotatory isomers of N-phenylisopropyladenosine: stereospecific effects on cyclic AMP-formation and evoked synaptic responses in brain slices.

The stereoisomers of N⁶-phenylisopropyladenosine elicit accumulations of cyclic AMP in brain slices via interaction with adenosine-receptors. The response in guinea pig cerebral cortical slices and in rat hippocampal slices is blocked by theophylline and potentiated by biogenic amines. A chelator, EGTA, potentiates the response to phenylisopropyladenosine in guinea pig cerebral cortical slices. The $\text{1}$-isomer (EC₅₀ 25 μM) is four- to five-fold more potent than the $\text{d}$-isomer in eliciting accumulations of cyclic AMP in brain slices. In a rat coronal hippocampal slice $\text{in vitro}$, $\text{1}$-phenylisopropyladenosine (IC₅₀ ～ 0.7 μM) reduces the amplitude of evoked synaptic responses generated $\text{via}$ a monosynaptic pathway to the CA1 pyramidal neurons. The $\text{d}$-isomer is nearly one hundred-fold less potent. Thus, the adenosine-receptors involved in the electrophysical response appear much more stereoselective for the $\text{1}$-isomer of phenylisopropyladenosine than the adenosine-receptors involved in cyclic AMP-generation in brain slices.