Ion-induced folding of a kink turn that departs from the conventional sequence

Kink turns (k-turns) are important structural motifs that create a sharp axial bend in RNA. Most conform to a consensus in which a three-nucleotide bulge is followed by consecutive G•A and A•G base pairs, and when these G•A pairs are modified in vitro this generally leads to a failure to adopt the k-turn conformation. Kt-23 in the 30S ribosomal subunit of Thermus thermophilus is a rare exception in which the bulge-distal A•G pair is replaced by a non-Watson–Crick A•U pair. In the context of the ribosome, Kt-23 adopts a completely conventional k-turn geometry. We show here that this sequence is induced to fold into a k-turn structure in an isolated RNA duplex by Mg²⁺ or Na⁺ ions. Therefore, the Kt-23 is intrinsically stable despite lacking the key A•G pair; its formation requires neither tertiary interactions nor protein binding. Moreover, the Kt-23 k-turn is stabilized by the same critical hydrogen-bonding interactions within the core of the structure that are found in more conventional sequences such as the near-consensus Kt-7. T. thermophilus Kt-23 has two further non-Watson–Crick base pairs within the non-canonical helix, three and four nucleotides from the bulge, and we find that the nature of these pairs influences the ability of the RNA to adopt k-turn conformation, although the base pair adjacent to the A•U pair is more important than the other.     

The spontaneous replication error and the mismatch discrimination mechanisms of human DNA polymerase β

To provide molecular-level insights into the spontaneous replication error and the mismatch discrimination mechanisms of human DNA polymerase β (polβ), we report four crystal structures of polβ complexed with dG•dTTP and dA•dCTP mismatches in the presence of Mg²⁺ or Mn²⁺. The Mg²⁺-bound ground-state structures show that the dA•dCTP-Mg²⁺ complex adopts an ‘intermediate’ protein conformation while the dG•dTTP-Mg²⁺ complex adopts an open protein conformation. The Mn²⁺-bound ‘pre-chemistry-state’ structures show that the dA•dCTP-Mn²⁺ complex is structurally very similar to the dA•dCTP-Mg²⁺ complex, whereas the dG•dTTP-Mn²⁺ complex undergoes a large-scale conformational change to adopt a Watson–Crick-like dG•dTTP base pair and a closed protein conformation. These structural differences, together with our molecular dynamics simulation studies, suggest that polβ increases replication fidelity via a two-stage mismatch discrimination mechanism, where one is in the ground state and the other in the closed conformation state. In the closed conformation state, polβ appears to allow only a Watson–Crick-like conformation for purine•pyrimidine base pairs, thereby discriminating the mismatched base pairs based on their ability to form the Watson–Crick-like conformation. Overall, the present studies provide new insights into the spontaneous replication error and the replication fidelity mechanisms of polβ.     

Studies of translational misreading in vivo show that the ribosome very efficiently discriminates against most potential errors

Protein synthesis must rapidly and repeatedly discriminate between a single correct and many incorrect aminoacyl-tRNAs. We have attempted to measure the frequencies of all possible missense errors by tRNA, tRNA and tRNA. The most frequent errors involve three types of mismatched nucleotide pairs, U•U, U•C, or U•G, all of which can form a noncanonical base pair with geometry similar to that of the canonical U•A or C•G Watson–Crick pairs. Our system is sensitive enough to measure errors at other potential mismatches that occur at frequencies as low as 1 in 500,000 codons. The ribosome appears to discriminate this efficiently against any pair with non-Watson–Crick geometry. This extreme accuracy may be necessary to allow discrimination against the errors involving near Watson–Crick pairing.     

Recognition of T*G mismatched base pairs in DNA by stacked imidazole-containing polyamides: surface plasmon resonance and circular dichroism studies

An imidazole-containing polyamide trimer, f-ImImIm, where f is a formamido group, was recently found using NMR methods to recognize T·G mismatched base pairs. In order to characterize in detail the T·G recognition affinity and specificity of imidazole-containing polyamides, f-ImIm, f-ImImIm and f-PyImIm were synthesized. The kinetics and thermodynamics for the polyamides binding to Watson–Crick and mismatched (containing one or two T·G, A·G or G·G mismatched base pairs) hairpin oligonucleotides were determined by surface plasmon resonance and circular dichroism (CD) methods. f-ImImIm binds significantly more strongly to the T·G mismatch-containing oligonucleotides than to the sequences with other mismatched or with Watson–Crick base pairs. Compared with the Watson–Crick CCGG sequence, f-ImImIm associates more slowly with DNAs containing T·G mismatches in place of one or two C·G base pairs and, more importantly, the dissociation rate from the T·G oligonucleotides is very slow (small k_d). These results clearly demonstrate the binding selectivity and enhanced affinity of side-by-side imidazole/imidazole pairings for T·G mismatches and show that the affinity and specificity increase arise from much lower k_d values with the T·G mismatched duplexes. CD titration studies of f-ImImIm complexes with T·G mismatched sequences produce strong induced bands at ~330 nm with clear isodichroic points, in support of a single minor groove complex. CD DNA bands suggest that the complexes remain in the B conformation.     

Parallel intramolecular DNA triple helix with G and T bases in the third strand stabilized by Zn(2+) ions

We present evidence of formation of an intramolecular parallel triple helix with T•A.T and G•G.C base triplets (where • represents the hydrogen bonding interaction between the third strand and the duplex while . represents the Watson–Crick interactions which stabilize the duplex). The third GT strand, containing seven GpT/TpG steps, targets the polypurine sequence 5′-AGG-AGG-GAG-GAG-3′. The triple helix is obtained by the folding back twice of a 36mer, formed by three dodecamers tethered by hydroxyalkyl linkers (-L-). Due to the design of the oligonucleotide, the third strand orientation is parallel with respect to the polypurine strand. Triple helical formation has been studied in concentration conditions in which native gel electrophoresis experiments showed the absence of intermolecular structures. Circular dichroism (CD) and UV spectroscopy have been used to evidence the triplex structure. A CD spectrum characteristic of triple helical formation as well as biphasic UV and CD melting curves have been obtained in high ionic strength NaCl solutions in the presence of Zn²⁺ ions. Specific interactions with Zn²⁺ ions in low water activity conditions are necessary to stabilize the parallel triplex.     

Requirement for canonical base pairing in the short pseudoknot structure of genomic hepatitis delta virus ribozyme

The tertiary structure of the 3′-cleaved product of the genomic hepatitis delta virus (HDV) ribozyme was solved by X-ray crystallographic analysis. In this structure, three single-stranded regions (SSrA, -B and -C) interact intricately with one another via hydrogen bonds between nucleotide bases, phosphate oxygens and 2′-OHs to form a nested double pseudoknot structure. Among these interactions, two Watson–Crick (W–C) base pairs, 726G–710C and 727G–709C, that form between SSrA and SSrC (P1.1) seem to be especially important for compact folding. To characterize the importance of these base pairs, ribozymes were subjected to in vitro selection from a pool of RNA molecules randomly substituted at positions 709, 710, 726 and 727. The results establish the importance of the two W–C base pairs for activity, although some mutants are active with one G–C base pair. In addition, the kinetic parameters were analyzed in all 16 combinations with two canonical base pairs. Comparison of variant ribozymes with the wild-type ribozyme reveals that the difference in reaction rates for these variants (ΔΔG^‡) is not simply accounted for by the differences in the stability of P1.1 (ΔΔG⁰₃₇). The role played by Mg²⁺ ions in formation of the P1.1 structure is also discussed.     

Analysis of intermolecular base pair formation of prohead RNA of the phage phi29 DNA packaging motor using NMR spectroscopy

The bacteriophage ø29 DNA packaging motor that assembles on the precursor capsid (prohead) contains an essential 174-nt structural RNA (pRNA) that forms multimers. To determine the structural features of the CE- and D-loops believed to be involved in multimerization of pRNA, 35- and 19-nt RNA molecules containing the CE-loop or the D-loop, respectively, were produced and shown to form a heterodimer in a Mg²⁺-dependent manner, similar to that with full-length pRNA. It has been hypothesized that four intermolecular base pairs are formed between pRNA molecules. Our NMR study of the heterodimer, for the first time, proved directly the existence of two intermolecular Watson–Crick G–C base pairs. The two potential intermolecular A–U base pairs were not observed. In addition, flexibility of the D-loop was found to be important since a Watson–Crick base pair introduced at the base of the D-loop disrupted the formation of the intermolecular G–C hydrogen bonds, and therefore affected heterodimerization. Introduction of this mutation into the biologically active 120-nt pRNA (U80C mutant) resulted in no detectable dimerization at ambient temperature as shown by native gel and sedimentation velocity analyses. Interestingly, this pRNA bound to prohead and packaged DNA as well as the wild-type 120-nt pRNA.     

Methylation of the nucleobases in RNA oligonucleotides mediates duplex-hairpin conversion

We have systematically investigated the duplex to hairpin conversion of oligoribonucleotides under the aspect of nucleobase methylation. The first part of our study refers to the self-complementary sequence rCGCGAAUUCGCGA, which forms a stable Watson–Crick base paired duplex under various buffer conditions. It is shown that this sequence is forced to adopt a hairpin conformation if one of the central 6 nt is replaced by the corresponding methylated nucleotide, such as 1-methylguanosine N²,N²-dimethylguanosine, N⁶,N⁶-dimethyladenosine (m⁶₂A) or 3-methyluridine. On the other hand, the duplex structure is retained and even stabilized by replacement of a central nucleotide with N²-methylguanosine (m²G) or N⁴-methylcytidine. A borderline case is represented by N⁶-methyladenosine (m⁶A). Although generally a duplex-preserving modification, our data indicate that m⁶A in specific strand positions and at low strand concentrations is able to effectuate duplex–hairpin conversion. Our studies also include the ssu ribosomal helix 45 sequence motif, rGACCm²GGm⁶₂Am⁶₂AGGUC. In analogy, it is demonstrated that the tandem m⁶₂A nucleobases of this oligoribonucleotide prevent duplex formation with complementary strands. Therefore, it can be concluded that nucleobase methylations at the Watson–Crick base pairing site provide the potential not only to modulate but to substantially affect RNA structure by formation of different secondary structure motifs.     

Markov state models elucidate the stability of DNA influenced by the chiral 5S-Tg base

The static and dynamic structures of DNA duplexes affected by 5S-Tg (Tg, Thymine glycol) epimers were studied using MD simulations and Markov State Models (MSMs) analysis. The results show that the 5S,6S-Tg base caused little perturbation to the helix, and the base-flipping barrier was determined to be 4.4 kcal mol⁻¹ through the use of enhanced sampling meta-eABF calculations, comparable to 5.4 kcal mol⁻¹ of the corresponding thymine flipping. Two conformations with the different hydrogen bond structures between 5S,6R-Tg and A19 were identified in several independent MD trajectories. The 5S,6R-Tg:O6H_O6•••N1:A19 hydrogen bond is present in the high-energy conformation displaying a clear helical distortion, and near barrier-free Tg base flipping. The low-energy conformation always maintains Watson–Crick base pairing between 5S,6R-Tg and A19, and 5S-Tg base flipping is accompanied by a small barrier of ca. 2.0 K_BT (T = 298 K). The same conformations are observed in the MSMs analysis. Moreover, the transition path and metastable structures of the damaged base flipping are for the first time verified through MSMs analysis. The data clearly show that the epimers have completely different influence on the stability of the DNA duplex, thus implying different enzymatic mechanisms for DNA repair.     

Improved nearest-neighbor parameters for the stability of RNA/DNA hybrids under a physiological condition

The stability of Watson–Crick paired RNA/DNA hybrids is important for designing optimal oligonucleotides for ASO (Antisense Oligonucleotide) and CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)–Cas9 techniques. Previous nearest-neighbour (NN) parameters for predicting hybrid stability in a 1 M NaCl solution, however, may not be applicable for predicting stability at salt concentrations closer to physiological condition (e.g. ∼100 mM Na⁺ or K⁺ in the presence or absence of Mg²⁺). Herein, we report measured thermodynamic parameters of 38 RNA/DNA hybrids at 100 mM NaCl and derive new NN parameters to predict duplex stability. Predicted ΔG°₃₇ and T_m values based on the established NN parameters agreed well with the measured values with 2.9% and 1.1°C deviations, respectively. The new results can also be used to make precise predictions for duplexes formed in 100 mM KCl or 100 mM NaCl in the presence of 1 mM Mg²⁺, which can mimic an intracellular and extracellular salt condition, respectively. Comparisons of the predicted thermodynamic parameters with published data using ASO and CRISPR–Cas9 may allow designing shorter oligonucleotides for these techniques that will diminish the probability of non-specific binding and also improve the efficiency of target gene regulation.     

Solution structure of the DNA decamer duplex containing a 3'-T x T basepair of the cis-syn cyclobutane pyrimidine dimer: implication for the mutagenic property of the cis-syn dimer

The cis–syn dimer is the major DNA photoproduct produced by UV irradiation. In order to determine the origin of the mutagenic property of the cis–syn dimer, we used NMR restraints and molecular dynamics to determine the solution structure of a DNA decamer duplex containing a wobble pair between the 3′-T of the cis–syn dimer and the opposite T residue (CS/TA duplex). The solution structure of the CS/TA duplex revealed that the 3′-T·T base pair of the cis–syn dimer had base pair geometry that was significantly different from the canonical Watson–Crick base pair and caused destabilization and conformational distortion of its 3′-region. However, a 3′-T·A base pair at the cis–syn dimer within this related DNA decamer maintains the normal Watson–Crick base pair geometry and causes little distortion in the conformation of its 3′-side. Our results show that in spite of its stable hydrogen bonding, the insertion of a T residue opposite the 3′-T of the cis–syn dimer is inhibited by structural distortion caused by the 3′-T·T base pair. This may explain why the frequency of the 3′-T→A transversion, which is the major mutation produced by the cis–syn dimer, is only 4%.     

A recurrent magnesium-binding motif provides a framework for the ribosomal peptidyl transferase center

The ribosome is an ancient macromolecular machine responsible for the synthesis of all proteins in all living organisms. Here we demonstrate that the ribosomal peptidyl transferase center (PTC) is supported by a framework of magnesium microclusters (Mg²⁺-μc's). Common features of Mg²⁺-μc's include two paired Mg²⁺ ions that are chelated by a common bridging phosphate group in the form Mg_(a)²⁺–(O1P-P-O2P)–Mg_(b)²⁺. This bridging phosphate is part of a 10-membered chelation ring in the form Mg_(a)²⁺–(OP-P-O5′-C5′-C4′-C3′-O3′-P-OP)–Mg_(a)²⁺. The two phosphate groups of this 10-membered ring are contributed by adjacent residues along the RNA backbone. Both Mg²⁺ ions are octahedrally coordinated, but are substantially dehydrated by interactions with additional RNA phosphate groups. The Mg²⁺-μc's in the LSU (large subunit) appear to be highly conserved over evolution, since they are unchanged in bacteria (Thermus thermophilus, PDB entry 2J01) and archaea (Haloarcula marismortui, PDB entry 1JJ2). The 2D elements of the 23S rRNA that are linked by Mg²⁺-μc's are conserved between the rRNAs of bacteria, archaea and eukarya and in mitochondrial rRNA, and in a proposed minimal 23S-rRNA. We observe Mg²⁺-μc's in other rRNAs including the bacterial 16S rRNA, and the P4–P6 domain of the tetrahymena Group I intron ribozyme. It appears that Mg²⁺-μc's are a primeval motif, with pivotal roles in RNA folding, function and evolution.     

Site-resolved stabilization of a DNA triple helix by magnesium ions

Proton exchange and NMR spectroscopy have been used to define the effects of Mg²⁺ ions upon the stability of individual base pairs in the intramolecular parallel triple helix formed by the DNA oligonucleotide d(GAAGAGGTTTTTCCTCTTCTTTTTCTTCTCC). The rates of exchange of individual Watson–Crick and Hoogsteen imino protons in the DNA triple helix were measured in the absence and in the presence of Mg²⁺ ions. The results reveal that Mg²⁺ lowers the exchange rates of most imino protons in the structure by stabilizing the corresponding base pairs in their native closed conformation. Comparison of the DNA triple helix containing Na⁺ counterions to the same helix containing Mg²⁺ counterions shows that these stabilizing effects result, in large part, from Mg²⁺ ions closely associated with the DNA. Moreover, the effects are site-specific and depend on the number and location of protonated cytosines relative to the observed base. These findings provide new insights into the molecular roles of C⁺·GC triads in determining the stability of DNA triple-helical structures.     

Insights into xanthine riboswitch structure and metal ion-mediated ligand recognition

Riboswitches are conserved functional domains in mRNA that mostly exist in bacteria. They regulate gene expression in response to varying concentrations of metabolites or metal ions. Recently, the NMT1 RNA motif has been identified to selectively bind xanthine and uric acid, respectively, both are involved in the metabolic pathway of purine degradation. Here, we report a crystal structure of this RNA bound to xanthine. Overall, the riboswitch exhibits a rod-like, continuously stacked fold composed of three stems and two internal junctions. The binding-pocket is determined by the highly conserved junctional sequence J1 between stem P1 and P2a, and engages a long-distance Watson–Crick base pair to junction J2. Xanthine inserts between a G–U pair from the major groove side and is sandwiched between base triples. Strikingly, a Mg²⁺ ion is inner-sphere coordinated to O6 of xanthine and a non-bridging oxygen of a backbone phosphate. Two further hydrated Mg²⁺ ions participate in extensive interactions between xanthine and the pocket. Our structure model is verified by ligand binding analysis to selected riboswitch mutants using isothermal titration calorimetry, and by fluorescence spectroscopic analysis of RNA folding using 2-aminopurine-modified variants. Together, our study highlights the principles of metal ion-mediated ligand recognition by the xanthine riboswitch.     

A remarkably stable kissing-loop interaction defines substrate recognition by the Neurospora Varkud Satellite ribozyme

Kissing loops are tertiary structure elements that often play key roles in functional RNAs. In the Neurospora VS ribozyme, a kissing-loop interaction between the stem–loop I (SLI) substrate and stem–loop V (SLV) of the catalytic domain is known to play an important role in substrate recognition. In addition, this I/V kissing-loop interaction is associated with a helix shift in SLI that activates the substrate for catalysis. To better understand the role of this kissing-loop interaction in substrate recognition and activation by the VS ribozyme, we performed a thermodynamic characterization by isothermal titration calorimetry using isolated SLI and SLV stem–loops. We demonstrate that preshifted SLI variants have higher affinity for SLV than shiftable SLI variants, with an energetic cost of 1.8–3 kcal/mol for the helix shift in SLI. The affinity of the preshifted SLI for SLV is remarkably high, the interaction being more stable by 7–8 kcal/mol than predicted for a comparable duplex containing three Watson–Crick base pairs. The structural basis of this remarkable stability is discussed in light of previous NMR studies. Comparative thermodynamic studies reveal that kissing-loop complexes containing 6–7 Watson–Crick base pairs are as stable as predicted from comparable RNA duplexes; however, those with 2–3 Watson–Crick base pairs are more stable than predicted. Interestingly, the stability of SLI/ribozyme complexes is similar to that of SLI/SLV complexes. Thus, the I/V kissing loop interaction represents the predominant energetic contribution to substrate recognition by the trans-cleaving VS ribozyme.     

New insights into Hoogsteen base pairs in DNA duplexes from a structure-based survey

Hoogsteen (HG) base pairs (bps) provide an alternative pairing geometry to Watson–Crick (WC) bps and can play unique functional roles in duplex DNA. Here, we use structural features unique to HG bps (syn purine base, HG hydrogen bonds and constricted C1′–C1′ distance across the bp) to search for HG bps in X-ray structures of DNA duplexes in the Protein Data Bank. The survey identifies 106 A•T and 34 G•C HG bps in DNA duplexes, many of which are undocumented in the literature. It also uncovers HG-like bps with syn purines lacking HG hydrogen bonds or constricted C1′–C1′ distances that are analogous to conformations that have been proposed to populate the WC-to-HG transition pathway. The survey reveals HG preferences similar to those observed for transient HG bps in solution by nuclear magnetic resonance, including stronger preferences for A•T versus G•C bps, TA versus GG steps, and also suggests enrichment at terminal ends with a preference for 5′-purine. HG bps induce small local perturbations in neighboring bps and, surprisingly, a small but significant degree of DNA bending (∼14°) directed toward the major groove. The survey provides insights into the preferences and structural consequences of HG bps in duplex DNA.     

Thermodynamic examination of the pyrophosphate sensor helix in the thiamine pyrophosphate riboswitch

Riboswitches are functional mRNA that control gene expression. Thiamine pyrophosphate (TPP) binds to thi-box riboswitch RNA and allosterically inhibits genes that code for proteins involved in the biosynthesis and transport of thiamine. Thiamine binding to the pyrimidine sensor helix and pyrophosphate binding to the pyrophosphate sensor helix cause changes in RNA conformation that regulate gene expression. Here we examine the thermodynamic properties of the internal loop of the pyrophosphate binding domain by comparing the wild-type construct (RNA WT) with six modified 2 × 2 bulged RNA and one 2 × 2 bulged DNA. The wild-type construct retains five conserved bases of the pyrophosphate sensor domain, two of which are in the 2 × 2 bulge (C65 and G66). The RNA WT construct was among the most stable (ΔG°₃₇ = −7.7 kcal/mol) in 1 M KCl at pH 7.5. Breaking the A•G mismatch of the bulge decreases the stability of the construct ∼0.5–1 kcal/mol, but does not affect magnesium binding to the RNA WT. Guanine at position 48 is important for RNA–Mg²⁺ interactions of the TPP-binding riboswitch at pH 7.5. In the presence of 9.5 mM magnesium at pH 5.5, the bulged RNA constructs gained an average of 1.1 kcal/mol relative to 1 M salt. Formation of a single A+•C mismatch base pair contributes about 0.5 kcal/mol at pH 5.5, whereas two tandem A+•C mismatch base pairs together contribute about 2 kcal/mol.     

Nearest neighbor parameters for Watson-Crick complementary heteroduplexes formed between 2'-O-methyl RNA and RNA oligonucleotides

Results from optical melting studies of Watson–Crick complementary heteroduplexes formed between 2′-O-methyl RNA and RNA oligonucleotides are used to determine nearest neighbor thermodynamic parameters for predicting the stabilities of such duplexes. The results are consistent with the physical model assumed by the individual nearest neighbor-hydrogen bonding model, which contains terms for helix initiation, base pair stacking and base pair composition. The sequence dependence is similar to that for Watson–Crick complementary RNA/RNA duplexes, which suggests that the sequence dependence may also be similar to that for other backbones that favor A-form RNA conformations.     

Crystal structure,mutational analysis and RNA-dependent ATPase activity of the yeast DEAD-box pre-mRNA splicing factor Prp28

Yeast Prp28 is a DEAD-box pre-mRNA splicing factor implicated in displacing U1 snRNP from the 5′ splice site. Here we report that the 588-aa Prp28 protein consists of a trypsin-sensitive 126-aa N-terminal segment (of which aa 1–89 are dispensable for Prp28 function in vivo) fused to a trypsin-resistant C-terminal catalytic domain. Purified recombinant Prp28 and Prp28-(127–588) have an intrinsic RNA-dependent ATPase activity, albeit with a low turnover number. The crystal structure of Prp28-(127–588) comprises two RecA-like domains splayed widely apart. AMPPNP•Mg²⁺ is engaged by the proximal domain, with proper and specific contacts from Phe194 and Gln201 (Q motif) to the adenine nucleobase. The triphosphate moiety of AMPPNP•Mg²⁺ is not poised for catalysis in the open domain conformation. Guided by the Prp28•AMPPNP structure, and that of the Drosophila Vasa•AMPPNP•Mg²⁺•RNA complex, we targeted 20 positions in Prp28 for alanine scanning. ATP-site components Asp341 and Glu342 (motif II) and Arg527 and Arg530 (motif VI) and RNA-site constituent Arg476 (motif Va) are essential for Prp28 activity in vivo. Synthetic lethality of double-alanine mutations highlighted functionally redundant contacts in the ATP-binding (Phe194-Gln201, Gln201-Asp502) and RNA-binding (Arg264-Arg320) sites. Overexpression of defective ATP-site mutants, but not defective RNA-site mutants, elicited severe dominant-negative growth defects.     

Determination of thermodynamic parameters for HIV DIS type loop-loop kissing complexes

The HIV-1 type dimerization initiation signal (DIS) loop was used as a starting point for the analysis of the stability of Watson–Crick (WC) base pairs in a tertiary structure context. We used ultraviolet melting to determine thermodynamic parameters for loop–loop tertiary interactions and compared them with regular secondary structure RNA helices of the same sequences. In 1 M Na⁺ the loop–loop interaction of a HIV-1 DIS type pairing is 4 kcal/mol more stable than its sequence in an equivalent regular and isolated RNA helix. This difference is constant and sequence independent, suggesting that the rules governing the stability of WC base pairs in the secondary structure context are also valid for WC base pairs in the tertiary structure context. Moreover, the effect of ion concentration on the stability of loop–loop tertiary interactions differs considerably from that of regular RNA helices. The stabilization by Na⁺ and Mg²⁺ is significantly greater if the base pairing occurs within the context of a loop–loop interaction. The dependence of the structural stability on salt concentration was defined via the slope of a T_m/log [ion] plot. The short base-paired helices are stabilized by 8°C/log [Mg²⁺] or 11°C/log [Na⁺], whereas base-paired helices forming tertiary loop–loop interactions are stabilized by 16°C/log [Mg²⁺] and 26°C/log [Na⁺]. The different dependence on ionic strength that is observed might reflect the contribution of specific divalent ion binding to the preformation of the hairpin loops poised for the tertiary kissing loop–loop contacts.