Codon replacement in the PGK1 gene of Saccharomyces cerevisiae: experimental approach to study the role of biased codon usage in gene expression.

The coding sequences of genes in the yeast Saccharomyces cerevisiae show a preference for 25 of the 61 possible coding triplets. The degree of this biased codon usage in each gene is positively correlated to its expression level. Highly expressed genes use these 25 major codons almost exclusively. As an experimental approach to studying biased codon usage and its possible role in modulating gene expression, systematic codon replacements were carried out in the highly expressed PGK1 gene. The expression of phosphoglycerate kinase (PGK) was studied both on a high-copy-number plasmid and as a single copy gene integrated into the chromosome. Replacing an increasing number (up to 39% of all codons) of major codons with synonymous minor ones at the 5' end of the coding sequence caused a dramatic decline of the expression level. The PGK protein levels dropped 10-fold. The steady-state mRNA levels also declined, but to a lesser extent (threefold). Our data indicate that this reduction in mRNA levels was due to destabilization caused by impaired translation elongation at the minor codons. By preventing translation of the PGK mRNAs by the introduction of a stop codon 3' and adjacent to the start codon, the steady-state mRNA levels decreased dramatically. We conclude that efficient mRNA translation is required for maintaining mRNA stability in S. cerevisiae. These findings have important implications for the study of the expression of heterologous genes in yeast cells.     

Homologous versus heterologous gene expression in the yeast, Saccharomyces cerevisiae.

DNA sequences normally flanking the highly expressed yeast 3-phosphoglycerate kinase (PGK) gene have been placed adjacent to heterologous mammalian genes on high copy number plasmid vectors and used for expression experiments in yeast. For many genes thus far expressed with this system, expression has been 15-50 times lower than the expression of the natural homologous PGK gene on the same plasmid. We have extensively investigated this dramatic difference and have found that in most cases it is directly proportional to the steady-state levels of mRNAs. We demonstrate this phenomenon and suggest possible causes for this effect on mRNA levels.     

Human, yeast and hybrid 3-phosphoglycerate kinase gene expression in yeast.

When the gene for yeast 3-phosphoglycerate kinase (PGK) is present on a high copy number plasmid in Saccharomyces cerevisiae, 30-40 percent of yeast protein is produced as PGK. However, when the structural part of this gene is replaced by as many as twenty different heterologous genes, production of gene products is greatly reduced--usually by more than 20 fold. This decrease in protein production is accompanied by large decreases in the steady-state levels of mRNA. However, in contrast to these coding sequences, replacement of the yeast PGK structural gene with a human PGK cDNA has little effect on the steady-state mRNA level in yeast. PGK is a two-domain enzyme and its 3-dimensional structure is highly conserved among species. These observations and others have led us to propose that the PGK protein itself might influence its own mRNA levels (Chen et al., Nucleic Acids Res. 12, pp. 8951-8969, 1984). In addition, data is presented here which suggest that the human PGK mRNA is less efficiently translated than the yeast PGK mRNA. Two different mechanisms of controlling gene expression are indicated. Both mechanisms appear to be independent of gene copy number.     

Comparison of proteolytic susceptibility in phosphoglycerate kinases from yeast and E. coli: modulation of conformational ensembles without altering structure or stability

Escherichia coli phosphoglycerate kinase (PGK) is resistant to proteolytic cleavage while the yeast homolog from Saccharomyces cerevisiae is not. We have explored the biophysical basis of this surprising difference. The sequences of these homologs are 39% identical and 56% similar. Determination of the crystal structure for the E. coli protein and comparison to the previously solved yeast structure reveals that the two proteins have extremely similar tertiary structures, and their global stabilities determined by equilibrium denaturation are also very similar. The extrapolated unfolding rate of E. coli PGK is, however, 10(5) slower than that of the yeast homolog. This surprisingly large difference in unfolding rates appears to arise from a divergence in the extent of cooperativity between the two structural domains (the N and C-domains) that make up these kinases. This is supported by: (1) the C-domain of E. coli PGK cannot be expressed or fold independently of the N-domain, while both domains of the yeast protein fold in isolation into stable structures and (2) the energetics and kinetics of the proteolytically sensitive state of E. coli PGK match those for global unfolding. This suggests that proteolysis occurs from the globally unfolded state of E. coli PGK, while the characteristics defining the yeast homolog suggest that proteolysis occurs upon unfolding of only the C-domain, with the N-domain remaining folded and consequently resistant to cleavage.     

Characterisation of sequences required for RNA initiation from the PGK promoter of Saccharomyces cerevisiae.

In the phosphoglycerate kinase (PGK) gene of yeast, as in other highly expressed yeast genes, the sequences surrounding the site of RNA initiation have a loosely conserved structure of a CT rich stretch followed by the tetranucleotide CAAG. Using internal deletions and insertions we have identified the elements in the PGK promoter which are required for correct RNA initiation at the CAAG sequence at -39. The results indicate that two different components of the PGK promoter contribute to correct RNA initiation, the TATA homologies, located at -152 and -113, and the sequences at the site of initiation. Both TATA elements can function in RNA initiation. Deletion of the upstream TATA element, TATAI, results in slightly heterogeneous RNA initiation, but the majority of the RNA initiates correctly. Deletion of both the PGK TATA elements results in the majority of the RNA initiating at sites downstream from the wild-type I site, within the structural gene between +40 to +80. The CT rich box is not essential for correct mRNA initiation as shown by deletion analysis. The site of RNA initiation in the PGK promoter appears to be determined by sequences located immediately 5' of the CAAG sequence motif. This short sequence, ACAGATC, when located the correct distance from the TATA elements may be sufficient to determine a discrete initiation site.     

Nature of an inserted sequence in the mitochondrial gene coding for the 15S ribosomal RNA of yeast

The small ribosomal RNA, or 15S RNA, or yeast mitochondria is coded by a mitochondrial gene. In the central part of the gene, there is a guanine-cytosine (GC) rich sequence of 40 base-pairs, flanked by adenine-thymine sequences. The GC-rich sequence is (5') TAGTTCCGGGGCCCGGCCACGGAGCCGAACCCGAAAGGAG (3'). We have found that this sequence is absent in the 15S rRNA gene of some strains of yeast. When present, it is transcribed into the mature 15S rRNA to produce a longer variant of the RNA. Sequences identical or closely related to this GC-rich sequence are present in many regions of the mitochondrial genome of Saccharomyces cerevisiae. The 5' and 3' terminal structures of all these sequences are highly constant.     

Golf complements a GPA1 null mutation in Saccharomyces cerevisiae and functionally couples to the STE2 pheromone receptor

We have produced a plasmid designed for the expression of heterologous G protein alpha subunits in the yeast Saccharomyces cerevisiae. Introduction of these genes is by simple cassette replacement using unique restriction sites, and their expression is controlled by the regulatory sequences of the S. cerevisiae GPA1 gene. Levels of expression are therefore suitable for interaction of these heterologous proteins with elements of the yeast pheromone response pathway. We believe that this plasmid will facilitate the coupling of more members of the seven transmembrane domain superfamily of receptors, through their native G protein alpha subunit, to the yeast pheromone response pathway. The plasmid pRGP, is a stable centromeric shuttle vector with a HIS3-selectable marker. We have demonstrated that production of GPA1 from this plasmid functionally complements a gpal1- null mutation. A similar response is obtained when an alternative G protein alpha subunit, G(olf), is introduced using pRGP. We believe that this is the first example of a heterologous G protein shown to couple to a yeast pheromone receptor.     

Heterologous expression of the Bacillus pumilus endo-beta-xylanase (xynA) gene in the yeast Saccharomyces cerevisiae

The endo-beta-xylanase-encoding gene (xynA) of Bacillus pumilus PLS was isolated from a genomic DNA library and the open reading frame (ORF) was inserted in expression vectors for the yeast Saccharomyces cerevisiae. Plasmid pFN3 harboured the xynA ORF fused to the yeast mating pheromone alpha-factor signal sequence (MFalpha1s) under the control of the alcohol dehydrogenase II gene promotor (ADH2P) and terminator (ADH2T) sequences. In plasmid pFN4, the MFalpha1S-xynA ORF was brought under the control of the phosphoglycerate kinase I gene promotor (PGK1p) and terminator (PGK1T) sequences. Autoselective, recombinant S. cerevisiae [fur1::LEU2] strains bearing pFN3 or pFN4 secreted functional endo-beta-xylanase when grown in complex medium. Enzymatic activities in the culture supernatants reached maximum levels of 8.5 nkat/ml and 4.5 nkat/ml, respectively. The temperature and pH optimum for both the bacterial and the recombinant xylanase were 58 degrees C and pH 6.2.     

Molecular cloning, primary structure and disruption of the structural gene of aldolase from Saccharomyces cerevisiae

A yeast cDNA genetic library in a bacteriophage expression vector was screened using an antiserum reacting with fructose 1,6-bisphosphate aldolase from Saccharomyces cerevisiae. Radio-labelled probes of selected immunopositive clones were used for screening of a yeast genomic library. From the genomic clones a yeast/Escherichia coli shuttle plasmid was constructed containing on a 1990-base-pair fragment the entire structural gene FBA1 coding for yeast aldolase. The primary structure of the FBA1 gene was determined. An open reading frame comprises 1077 base pairs coding for a protein of 359 amino acids with a predicted molecular mass of 39,608 Da. As observed for other strongly expressed yeast genes, codon usage is extremely biased. The 810 base pairs at the 5' end and the 90 base pairs at the 3' end of the coding region of the cloned FBA1 gene are sufficient for normal expression and show characteristic elements present in the noncoding sequences of other yeast genes. Aldolase is the major protein in yeast cells transformed with a high-copy-number plasmid containing the FBA1 gene. The aldolase gene was disrupted by insertion of the yeast URA3 gene into the coding region of one FBA1 allele in a homozygous diploid ura3 strain. The haploid offsprings with the defective aldolase allele fba1::URA3 lack aldolase enzymatic activity and fail to grow in media containing as a carbon source metabolites of only one side of the aldolase reaction.     

Regulated high efficiency expression of human interferon-alpha in Saccharomyces cerevisiae.

The 5' control region of the yeast phosphoglycerate kinase gene (PGK) was fused to the coding sequence of a human interferon-alpha. This PGK-interferon fusion was then introduced into yeast on a high copy number 2mu-based plasmid vector. Strains containing this plasmid produced a PGK-interferon-alpha fusion protein as 1-2% of cell protein and the expression of interferon activity was regulated by the availability of a fermentable carbon source. The system is capable of making as much as 15 mg of human interferon-alpha per litre of batch culture.