X-ray inactivation studies of nonheme iron proteins the action of X-rays on Spinach ferredoxin in aqueous solutions

Summary Exposure of aqueous spinach ferredoxin solutions to X-rays results in a rapid and irreversible denaturation of the molecule. The denaturation is manifested by a decrease of the characteristic absorption of spinach ferredoxin at 320 and 416 nm, and by the concomitant liberation of ferric iron and hydrogen sulfide. The absorption decrease at 320 and 416 nm and the iron liberation are found to parallel the activity decrease in functioning as electron transfer factor in the noncyclic electron transport system in spinach chloroplasts.X-ray inactivated spinach ferredoxin does not contain iron or free SH-groups, and can be regarded as anapo-form of the native protein. This X-ray-inactivated apoprotein, however, showed a higher molar extinction coefficient at 275 nm than the apoferredoxin, and was not reconstitutable.Spinach ferredoxin was found to be even more radiosensitive than clostridial ferredoxin. AG- value of 1.25 for biological inactivation and iron liberation was found, as compared to aG- value of 0.8 for clostridial ferredoxin.     

Purification and characterization of a 7Fe ferredoxin from Streptomyces griseus

A ferredoxin has been purified from Streptomyces griseus grown in soybean flour-containing medium. The homogeneous protein has a molecular weight near 14000 as determined by both PAGE and size exclusion chromatography. The iron and labile sulfide content is 6–7 atoms/mole protein. EPR spectroscopy of native S. griseus ferredoxin shows an isotropic signal at g=2.01 which is typical of [3Fe-4S]¹⁺ clusters and which quantitates to 0.9 spin/mole. Reduction of the ferredoxin by excess dithionite at pH 8.0 produces an EPR silent state with a small amount of a g=1.95 type signal. Photoreduction in the presence of deazaflavin generates a signal typical of [4Fe-4S]¹⁺ clusters at much higher yields (0.4–0.5 spin/mole) with major features at g-values of 2.06, 1.94, 1.90 and 1.88. This latter EPR signal is most similar to that seen for reduced 7Fe ferredoxins, which contain both a [3Fe-4S] and [4Fe-4S] cluster. In vitro reconstitution experiments demonstrate the ability of the S. grisues ferredoxin to couple electron transfer between spinach ferredoxin reductase and S. griseus cytochrome P-450_soy for NADPH-dependent substrate oxidation. This represents a possible physiological function for the S. griseus ferredoxin, which if true, would be the first functional role demonstrated for a 7Fe ferredoxin.     

Ferredoxin from Selenomonas ruminantium

Ferredoxin from the strict rumen anaerobe Selenomonas ruminantium has been purified to homogeneity and characterized with respect to its molecular weight and amino acid composition. The molecular weight of ferredoxin was 9,880. The A₃₈₀/A₂₈₀ absorbance ratio of the pure ferredoxin was 0.54 with a molar extinction coefficient of 31,000 M^-1 cm^-1 at 380 nm. Ferredoxin was reduced by cell-free extracts in the presence of hydrogen gas or pyruvate and acetyl coenzyme A.Abbreviations [Fe_x/S_y] denotes an iron sulfur cluster containing x iron and y sulfur atoms     

Novel Three-Component Rieske Non-Heme Iron Oxygenase System Catalyzing the N-Dealkylation of Chloroacetanilide Herbicides in Sphingomonads DC-6 and DC-2

Sphingomonads DC-6 and DC-2 degrade the chloroacetanilide herbicides alachlor, acetochlor, and butachlor via N-dealkylation. In this study, we report a three-component Rieske non-heme iron oxygenase (RHO) system catalyzing the N-dealkylation of these herbicides. The oxygenase component gene cndA is located in a transposable element that is highly conserved in the two strains. CndA shares 24 to 42% amino acid sequence identities with the oxygenase components of some RHOs that catalyze N- or O-demethylation. Two putative [2Fe-2S] ferredoxin genes and one glutathione reductase (GR)-type reductase gene were retrieved from the genome of each strain. These genes were not located in the immediate vicinity of cndA. The four ferredoxins share 64 to 72% amino acid sequence identities to the ferredoxin component of dicamba O-demethylase (DMO), and the two reductases share 62 to 65% amino acid sequence identities to the reductase component of DMO. cndA, the four ferredoxin genes, and the two reductases genes were expressed in Escherichia coli, and the recombinant proteins were purified using Ni-affinity chromatography. The individual components or the components in pairs displayed no activity; the enzyme mixture showed N-dealkylase activities toward alachlor, acetochlor, and butachlor only when CndA-His₆ was combined with one of the four ferredoxins and one of the two reductases, suggesting that the enzyme consists of three components, a homo-oligomer oxygenase, a [2Fe-2S] ferredoxin, and a GR-type reductase, and CndA has a low specificity for the electron transport component (ETC). The N-dealkylase utilizes NADH, but not NADPH, as the electron donor.     

Purification and properties of two ferredoxins from the nitrogen-fixing bacterium Bacillus polymyxa

Two ferredoxins, designated FdI and FdII, have been isolated from the nitrogen-fixing bacterium Bacillus polymyxa. The two ferredoxins were readily separated on DEAE-cellulose and disc gel electrophoresis. The amino acid compositions of FdI and FdII showed them to be different protein species; the greater number of acidic amino acid residues in FdI than in FdII appears to account for separation based on electronic charge. FdI and FdII were both found to have four nonheme iron and four acid-labile sulfur groups per mole. The absorption spectra of the two ferredoxins are almost identical, with a peak in the visible region of the spectrum at 385 nm. The $\text{A}{}_{358}\text{A}{}_{280}$ absorbance ratio of both ferredoxins was 0.54–0.55. FdII was not stable under aerobic conditions, as indicated by a decrease in the visible region of the spectrum. Both FdI and FdII have nearly identical molecular weights, as judged by gel filtration and amino acid composition (approx 8800).The purified ferredoxins catalyzed the photoreduction of NADP by spinach chloroplasts with equal effectiveness. In the nitrogen-fixation reaction of B. polymyxa, FdII was more effective than FdI.     

Primary structure of a 7Fe ferredoxin from Streptomyces griseus

The complete primary structure of a Streptomyces griseus (ATCC 13273) 7Fe ferredoxin, which can couple electron transfer between spinach ferredoxin reductase and S. griseus cytochrome P-450_soy for NADPH-dependent substrate oxidation, has been determined by Edman degradation of the whole protein and peptides derived by Staphylococcus aureus V8 proteinase and trypsin digestion. The protein consists of 105 amino acids and has a calculated molecular weight, including seven irons and eight sulfurs, of 12291. The ferredoxin sequence is highly homologous (73%) to that of the 7Fe ferredoxin from Mycobacterium smegmatis. The N-terminal half of the sequence, which is the FeS clusters binding domain, has more than 50% homology with other 7Fe ferredoxins. In particular, the seven cysteines known from the crystal structure of Azotobacter vinelandii ferredoxin I to be involved in binding the two FeS clusters are conserved.     

Purification of a flavoprotein having NADPH-cytochrome c reductase and transhydrogenase activities from Nitrobacter winogradskyi and its molecular and enzymatic properties

A flavoenzyme which showed NADPH-cytochrome c reductase (NADPH-cytochrome c oxidoreductase EC 1.6.2.4) and transhydrogenase (NADPH-NAD⁺ oxidoreductase, EC 1.6.1.1) activities was purified to an electrophoretically homogeneous state from Nitrobacter winogradskyi. The reductase was a flavoprotein which contained one FAD per molecule but no FMN. The oxidized form of the enzyme showed absorption maxima at 272, 375 and 459 nm with a shoulder at 490 nm, its molecular weight was estimated to be 36,000 by SDS polyacrylamide gel electrophoresis, and the enzyme seemed to exist as a dimer in aqueous solution. The enzyme catalyzed reduction of cytochrome c, DCIP and benzylviologen by NADPH, oxidation of NADPH with menadione and duroquinone, and showed transhydrogenase activity. NADH was less effective than NADPH as the electron donor in the reactions catalyzed by the enzyme. The NADPH-reduction catalyzed by the enzyme of N. winogradskyi cytochrome c-550 and horse cytochrome c was stimulated by spinach ferredoxin. The enzyme reduced NADP⁺ with reduced spinach ferredoxin and benzylviologen radical.Abbreviations DCIP dichlorophenolindophenol - Tris trishydroxy-methylaminomethane - Mops 3-(N-morpholino) propanesulfonic acid - SDS sodium dodecylsufate     

Interactions between spinach ferredoxin and other electron carriers. The involvement of a ferredoxin:cytochrome c complex in the ferredoxin-linked cytochrome c reductase activity of ferredoxin:NADP+ oxidoreductase.

The trinitrophenylation of a single amino group of spinach ferredoxin abolishes its ability to inhibit the diaphorase activity of the flavoprotein, ferredoxin:NADP oxidoreductase (EC 1.6.7.1); in contrast, the ability of ferredoxin to participate in the ferredoxin-linked cytochrome c reductase activity catalyzed by the flavoprotein is unaffected. Comparison with previously published results [Davis, D. J., and San Pietro, A. (1977) Biochem. Biophys. Res. Commun.74, 33–40]indicates that the site of interaction between ferredoxin and the flavoprotein resulting in inhibition if diaphorase activity is responsible for the spectrally observable 1:1 complex between the two proteins and is identical to the site of ferredoxin involvement in NADP photoreduction. The role of ferredoxin in the ferredoxin-linked cytochrome c reductase activity of the flavoprotein has been reexamined under conditions were the entire electron-accepting system (rather than just the ferredoxin component) is rate limiting. The data support a mechanism by which ferredoxin can bind either to the flavoprotein or to cytochrome c, and the ferredoxin:cytochrome c complex serves as the true substrate for reduction by the flavoprotein. Furthermore, Chromatographic evidence is presented for the formation of complexes between ferredoxin and cytochrome c.     

Isolation and Characterization of a Ferredoxin Gene from Arabidopsis thaliana

We report the cloning and characterization of an Arabidopsis thaliana (L.) Heynh. (Columbia ecotype) ferredoxin gene (Fed A). Sequence analysis of a genomic clone shows an intron-free, 444-base pair open reading frame which encodes a 96 amino acid mature ferredoxin polypeptide preceded by a 52 amino acid transit peptide. Comparison with other plant ferredoxin proteins suggests that Fed A encodes a leaf ferredoxin. Genomic Southern blot analysis indicates the presence of a second, weakly related gene, consistent with other reports of at least two ferredoxins in plants. The Fed A gene promoter contains two regions, ACGCCACGTGGTAGATAGGATT (G-I box) and CCACGCCATTTCCACAAGC (CCAC box), which are strongly conserved in both sequence and position between the Arabidopsis and pea ferredoxin genes. Similarities with other better characterized plant promoter elements are also discussed.     

The effect of low osmotic potential on nitrite reduction in intact spinach chloroplasts

The effect of water stress (reduced osmotic potential) on photosynthetic nitrite reduction was investigated using intact, isolated spinach (Spinacia oleracea) chloroplasts. Nitrite-dependent O₂ evolution was inhibited 39% at −29.5 bars osmotic potential, relative to a control at −11 bars. In the presence of an uncoupler of photophosphorylation this inhibition was not seen. Reduced osmotic potential did not inhibit either methyl viologen reduction or photosynthetic O₂ reduction. These results indicate that an inhibition of electron transport to ferredoxin cannot account for the observed inhibition of nitrite-dependent O₂ evolution. In vitro assay of nitrite reductase activity showed that the interaction of the enzyme with nitrite was not affected by changes in the concentrations of ions or molecules that might be caused by water stress conditions. These results indicate that the most likely site for the effect of water stress on chloroplastic nitrite reduction is the interaction of ferredoxin with nitrite reductase.     

Isolation and characterization of a rubredoxin and an (8Fe-8S) ferredoxin from Desulfuromonas acetoxidans

A two cluster (4Fe4S) ferredoxin and a rubredoxin have been isolated from the sulfur-reducing bacterium Desulfuromonas acetoxidans. Their amino acid compositions are reported and compared to those of other iron-sulfur proteins.The ferredoxin contains 8 cysteine residues, 8 atoms of iron and 8 atoms of labile sulfur per molecule; its minimum molecular weight is 6163. The protein exhibits an absorbance ratio of $\text{A}{}_{385}\text{A}{}_{283}\text{= 0.74}$. Storage results in a bleaching of the chromophore; the denatured ferredoxin is reconstitutable with iron and sulfide. The instability temperature is 52°C.The rubredoxin does not differ markedly from rubredoxins from other anaerobic bacteria.     

Interaction of ferredoxin and ferredoxin-NADP reductase with thylakoids

Ferredoxin-NADP reductase accounts for about 50% of the NADPH diaphorase activity of spinach leaf homogenates. The enzyme is bound to thylakoid membranes, but can be slowly extracted by aqueous buffers. Ferredoxin-NADP reductase can be extracted from the membranes by a 1- to 2-min treatment with a low concentration of trypsin. This treatment completely inactivates NADP photoreduction but does not affect electron transport from water to ferredoxin. It is shown that the inactivation is due to solubilization of ferredoxin-NADP reductase: the activity can be restored by addition of a very large excess of soluble enzyme in pure form. When ferredoxin-NADP reductase is added as a soluble enzyme after extraction or inactivation (by a specific antibody) of the membrane-bound enzyme, NADP photoreduction requires a very large excess of this enzyme, and the apparent K_m for ferredoxin is also increased. These observations are discussed as related to the interactions of thylakoids with ferredoxin-NADP reductase.     

Enzymatic properties of the ferredoxin-dependent nitrite reductase from Chlamydomonas reinhardtii. Evidence for hydroxylamine as a late intermediate in ammonia production

The ferredoxin-dependent nitrite reductase from the green alga Chlamydomonas reinhardtii has been cloned, expressed in Escherichia coli as a His-tagged recombinant protein, and purified to homogeneity. The spectra, kinetic properties and substrate-binding parameters of the C. reinhardtii enzyme are quite similar to those of the ferredoxin-dependent spinach chloroplast nitrite reductase. Computer modeling, based on the published structure of spinach nitrite reductase, predicts that the structure of C. reinhardtii nitrite reductase will be similar to that of the spinach enzyme. Chemical modification studies and the ionic-strength dependence of the enzyme’s ability to interact with ferredoxin are consistent with the involvement of arginine and lysine residues on C. reinhardtii nitrite reductase in electrostatically-stabilized binding to ferredoxin. The C. reinhardtii enzyme has been used to demonstrate that hydroxylamine can serve as an electron-accepting substrate for the enzyme and that the product of hydroxylamine reduction is ammonia, providing the first experimental evidence for the hypothesis that hydroxylamine, bound to the enzyme, can serve as a late intermediate during the reduction of nitrite to ammonia catalyzed by the enzyme.     

Ferredoxin Isolated from Plant Non-Photosynthetic Tissues. Purficaition and Characterization

A ferredoxin was isolated from non-photosynthetic tissues ofthe lower storage root of radish (Raphanus sativus L. var. acantiformiscultivar Miyashige) in a pure form by conventional means. Itshowed the characteristic features in its absorption spectrumof chloroplast-type ferredoxin. However, amino acid compositionand amino (N)- terminal sequence were different from those ofradish leaf ferredoxin. Root ferredoxin was able to transferelectrons from dithionite to nitrite reductase [EC 1.7.7.1 [EC] ]isolated from mung bean seedling roots and also to mediate NADP⁺photoreduction in spinach broken chloroplasts. It therefore is suggested that a set of distinctive molecularspecies of ferredoxin is present in non-photosynthetic tissuesand functions as a redox mediator in ferredox-independent enzymesystems. (Received October 18, 1985; Accepted January 16, 1986)     

Partial structure and properties of the ferredoxin from Rhodymenia palmata

A ferredoxin of MW 11 000 was isolated from the marine alga Rhodymenia palmata (Palmaria palmata). In its oxidised form the ferredoxin had absorption maxima at 276, sh 281, 328, 423 and 465 nm, and contained a single [2Fe-2S] cluster. The midpoint potential of the ferredoxin was ?400 mV and it effectively mediated electron transport in NADP⁺-photoreduction by higher plant chloroplasts, and pyruvate decarboxylation by the phosphoroclastic system of an anacrobic bacterium. The amino acid composition was Lys₃, His₁, Arg₁, Asx₁₂, Thr₉, Ser₈, Glx₁₃, Pro₄, Gly₈, Ala₇, Cys₅, Val₈, Ile₄, Leu₉, Tyr₄, Phe₂; tryptophan and methionine were absent from the molecule. The N-terminal amino acid region consisting of ca half the total amino acid sequence was determined using an automatic sequencer.     

Purification of Cytochrome P450 and Ferredoxin, Involved in Bisphenol A Degradation, from Sphingomonas sp. Strain AO1

In a previous study (M. Sasaki, J. Maki, K. Oshiman, Y. Matsumura, and T. Tsuchido, Biodegradation 16:449-459, 2005), the cytochrome P450 monooxygenase system was shown to be involved in bisphenol A (BPA) degradation by Sphingomonas sp. strain AO1. In the present investigation, we purified the components of this monooxygenase, cytochrome P450 (P450_bisd), ferredoxin (Fd_bisd), and ferredoxin reductase (Red_bisd). We demonstrated that P450_bisd and Fd_bisd are homodimeric proteins with molecular masses of 102.3 and 19.1 kDa, respectively, by gel filtration chromatography analysis. Spectroscopic analysis of Fd_bisd revealed the presence of a putidaredoxin-type [2Fe-2S] cluster. P450_bisd, in the presence of Fd_bisd, Red_bisd, and NADH, was able to convert BPA. The K_m and k_cat values for BPA degradation were 85 ± 4.7 μM and 3.9 ± 0.04 min⁻¹, respectively. NADPH, spinach ferredoxin, and spinach ferredoxin reductase resulted in weak monooxygenase activity. These results indicated that the electron transport system of P450_bisd might exhibit strict specificity. Two BPA degradation products of the P450_bisd system were detected by high-performance liquid chromatography analysis and were thought to be 1,2-bis(4-hydroxyphenyl)-2-propanol and 2,2-bis(4-hydroxyphenyl)-1-propanol based on mass spectrometry-mass spectrometry analysis. This is the first report demonstrating that the cytochrome P450 monooxygenase system in bacteria is involved in BPA degradation.     

Discovery and Characterization of the First Archaeal Dihydromethanopterin Reductase,an Iron-Sulfur Flavoprotein from Methanosarcina mazei

The microbial production of methane by methanogenic archaea is dependent on the synthesis of the pterin-containing cofactor tetrahydromethanopterin (H₄MPT). The enzyme catalyzing the last step of H₄MPT biosynthesis (dihydromethanopterin reductase) has not previously been identified in methane-producing microorganisms. Previous complementation studies with the methylotrophic bacterium Methylobacterium extorquens have indicated that an uncharacterized archaeal-flavoprotein-like flavoprotein (AfpA) from Methylobacillus flagellatus or Burkholderia xenovorans can replace the activity of a phylogenetically unrelated bacterial dihydromethanopterin reductase (DmrA). We propose that MM1854, a homolog of AfpA from Methanosarcina mazei, catalyzes the last step of H₄MPT biosynthesis in methane-producing microorganisms. To test this hypothesis, a six-histidine (His₆)-tagged version of MM1854 was produced. Bioinformatic analysis revealed the presence of one flavin mononucleotide (FMN)-binding site and two iron-sulfur cluster sites, consistent with an oxidoreductase enzyme. Purified His₆-MM1854 occurred as a homodimer of 29-kDa subunits, and the UV-visible spectrum of the purified protein showed absorbance peaks at 380 and 460 nm, characteristic of oxidized FMN. NAD(P)H was incapable of directly reducing the flavin cofactor, but dithionite eliminated the FMN peaks, indicating successful electron transfer to MM1854. An electron transfer system of NADPH, spinach NADPH-ferredoxin oxidoreductase, and ferredoxin could also reduce the FMN peaks. A newly developed assay indicated that dithiothreitol-reduced MM1854 could transfer electrons to dihydromethanopterin. This assay was also effective with a heat-stable DmrX analog from Methanocaldococcus jannaschii (MJ0208). These results provide the first biochemical evidence that MM1854 and MJ0208 function as archaeal dihydromethanopterin reductases (DmrX) and that ferredoxin may serve as an electron donor.     

Determination of oxidation-reduction potentials by spectropolarimetric titration: application to several iron-sulfur proteins

The oxidation-reduction potential (E₀?') and the stoichiomotry of electron equivalents (n) of several iron—sulfur proteins determined by direct potentiomctric titration in the presence of redox-mediator dyes and monitored by concomitant changes in circular dichroism are reported. The absence of circular dichroism or changes in circular dichroism by the redox mediators undergoing redox transitions forma the operational basis for the spectropolarimetric titration. The applicability of the method was explored by extensive investigations with spinach ferredoxin.The redox potential and stoichiometry values determined by spectropolarimetric titration are: (1) a plant-type (spinach) ferredoxin, E₀?' = —0.423 V, pH-independent in the range 8.0–9.5; n = 1, (2) a ferredoxin from the nonphotosynthetic bacterium, Clostridium pasteurianum, E₀?' = —0.390 V at pH 8.8, $\text{ΔE}\text{Δ}\text{pH}\text{? 30}\text{mV}$ for pH rangc 6.8–8.8; n = 2, (3) a ferredoxin from the photosynthetic bacterium, Chromatium, E₀′ = ?0.489 V at pH 9.0 and 9.5; n = 2, and (4) an iron sulfur protein designated “Protein II” isolated from Azotobactetr vinelandii, E₀? = ?0.225 V at pH 7.0 and 8.0; n, = 1.An automatic-titration method with a continuously recorded titration curve was demonstrated using the azotobacter Protein II. The general applicability of the spectropolarimetric-titration technique to other biological electron carriers and some experimental factors are discussed.     

Methyl Viologen-linked Nitrite Reductase from Bean Roots

Methyl viologen-linked nitrite reductase (EC 1.7.7.1), an enzyme which catalyzes the 6-electron reduction of nitrite to ammonia, was isolated from bean roots. The isolated enzyme was homogeneous by disc electrophoresis with polyacrylamide gel. The molecular weight of the enzyme was estimated to be 62,000 by SDS-polyacrylamide gel electrophoresis. In the oxidized form, the enzyme had absorption maxima at 280, 397 (Soret band), 535, and 573 nm (α band), indicating that siroheme is directly involved in the catalysis of nitrite reduction. The absorbance ratios, A₃₉₇ : A₂₈₀ and A₅₇₃ : A₃₉₇, were 0.3 and 0.39, respectively. Antiserum to spinach leaf nitrite reductase failed to give a positive Ouchterlony result with bean root nitrite reductase, but this antiserum did inhibit the activity of the latter enzyme.     

M?ssbauer effect in Scenedesmus and spinach ferredoxins. The mechanism of electron transfer in plant-type iron–sulphur proteins

1. The Mössbauer spectra of Scenedesmus ferredoxin enriched in ⁵⁷Fe were measured and found to be identical with those of two other plant-type ferredoxins (from spinach and Euglena) that had been previously measured. Better resolved Mössbauer spectra of spinach ferredoxin are also reported from protein enriched in ⁵⁷Fe. All these iron–sulphur proteins are known to contain two iron atoms in a molecule that takes up one electron on reduction. 2. The Mössbauer spectra at 195°K have electric hyperfine structure only and show that on reduction the electron goes to one of the iron atoms, the other appearing to remain unchanged. 3. In the oxidized state, both iron atoms are in a similar chemical state, which appears from the chemical shift and quadrupole splitting to be high-spin Fe³⁺, but they are in slightly different environments. In the reduced state the iron atoms are different and the molecule appears to contain one high-spin Fe²⁺ and one high-spin Fe³⁺ atom. 4. At lower temperatures (77 and 4.2°K) the spectra of both iron atoms in the reduced proteins show magnetic hyperfine structure which suggests that the iron in the oxidized state also has unpaired electrons. This provides experimental evidence for earlier suggestions that in the oxidized state there is antiferromagnetic exchange coupling, which would result in a low value for the magnetic susceptibility. 5. In a small magnetic field the spectrum of the reduced ferredoxin shows a Zeeman splitting with hyperfine field (H_n) of 180kG at the nuclei. On application of a strong magnetic field H the spectrum splits into two spectra with effective fields H_n±H, thus confirming the presence of the two antiferromagnetically coupled iron atoms. 6. These results are in agreement with the model proposed by Gibson, Hall, Thornley & Whatley (1966); in the oxidized state there are two Fe³⁺ atoms (high spin) antiferromagnetically coupled and on reduction of the ferredoxin by one electron one of the ferric atoms becomes Fe²⁺ (high spin).