Genetic diversity and effect of temperature and pH on the growth of <Emphasis Type="Italic">Macrophomina phaseolina</Emphasis> isolates from sunflower fields in Hungary

The effects of temperature and pH on the growth of 45 Hungarian Macrophomina phaseolina isolates from different locations and hosts were compared on the basis of their genetic diversity. One Spanish and two Serbian isolates were also included in the experiment. The most favourable temperature regimes for the development of the isolates ranged between 25 and 35°C. The optimal pH for the pathogen varied between 4.0 and 6.0, but growth was observed on potato dextrose agar even at pH values of 3.0, 7.0 and 8.0. RAPD analysis with 13 different primer pairs generated 148 unambiguous bands. RFLP analysis involving 8 different restriction endonucleases was performed on a 1550 bp fragment of the rDNA region containing internal transcribed spacers (ITS1, ITS2), the 5.8S rDNA and part of the 25S rDNA. The greatest genetic distance values were obtained for three isolates, two from Hungary and one from Spain, which had similar values, but were quite distinct from all the others. A strong positive correlation was observed between the genetic distances and the growth parameters measured at various temperatures, and between the geographical data and the growth data sets at different pH values, but the correlation was less strong in the latter case. While Hungarian M. phaseolina populations are thought to reproduce clonally, the present results indicate the coexistence of different haplotypes in this area, and besides the geographical dominance of a given haplotype it was found that a closer genetic relationship might exist between spatially distinct haplotypes.     

Characterization of native <Emphasis Type="Italic">Bacillus thuringiensis</Emphasis> strains by PCR-RAPD based fingerprinting

Seventy isolates of Bacillus thuringiensis were isolated from soil samples collected from cotton fields. These isolates were characterized by randomly amplified poylmorphic DNA (RAPD) markers to determine their genetic diversity pattern based on their source of origin. Different random decamer primers were used for RAPD amplification, which generated a total of 1935 fragments; of these 1865 were polymorphic and 68 monomorphic. The primers OPA03, OPA08, OPD14, OPD19, OPD20, OPE17 and OPD19 produced 100% polymorphic fragments, whereas primers OPC06, OPC20 and OPD17 produced 20, 31 and 17 monomorphic fragments, respectively. When the RAPD banding pattern data was subjected to dendrogram construction, the 70 isolates fell into two separate clusters, cluster I and cluster II, which includes 26 and 44 B. thuringiensis isolates, respectively. These two main clusters were further divided into four subclusters at Eucledian distance of 150 and 80% similarity index. All primers showed amplification and indicated the good diversity of B. thuringiensis isolates. The RAPD pattern showed 4–10 bands per isolate, with MWt in the range of 0.4–3.5 Kb and an average of 193.5 fragments were produced per primer. The primer OPE17 was found to be the most discriminatory as it produced 286 polymorphic bands.     

Intraspecies diversity of Macrophomina phaseolina in Iran

To study the pathogenic and genetic diversity of the Macrophomina phaseolina in Iran, 52 isolates of the fungus were isolated from 24 host plants across the 14 Iranian provinces. All isolates were confirmed to the species based on the species-specific primers. The aggressiveness of M. phaseolina isolates was evaluated on the common bean. Based on the pathogenicity tests, M. phaseolina isolates from the different hosts displayed different levels of aggressiveness on the common beans. The results showed that there was significant variation in the aggressiveness of the pathogen; however, there was no distinct pattern of differentiation based on the host or geographical origin linked to the virulence of the isolates, as frequently theisolates from the same host or geographical origin had different levels of aggressiveness. Inter-simple sequence repeat (ISSR) markers were used to assess the genetic diversity of the fungus. The unweighted pair-group method, using arithmetic mean clustering of data, showed that isolates did not clearly differentiate to the specific group according to the host or geographical origins; however, usually the isolates from the same host or the same geographical origin tend to group nearly. Our results did not show a correlation between the genetic diversity based on the ISSR and pathogenic patterns on common bean in the greenhouse. Similar to the M. phaseolina populations in the other countries, the Iranian isolates were highly diverse based on the pathogenic and genotypic characteristics.     

Population analysis of <Emphasis Type="Italic">Magnaporthe oryzae</Emphasis> by using endogenous repetitive DNA sequences and mating-type alleles in different districts of Karnataka,India

Rice is the staple food crop of more than 60% of the population of the world. This crop suffers from blast disease caused by Magnaporthe oryzae. Information on the mating-type allele distribution and diversity of the pathogen population for the state of Karnataka, India is scanty. With this background, a total of 72 isolates of M. oryzae from rice in different districts of Karnataka were examined for identifying sexual mating alleles MAT1, MAT2 and understanding the genetic diversity based on DNA fingerprint of pot2, an inverted repeat transposon. Among 72 isolates, 44 isolates belonged to MAT1 type (male fertile) and 28 isolates were of MAT2 (female fertile) and there were no hermaphrodite isolates. In a given geographical location, only one mating type was identified. Results revealed that the isolates obtained from these regions are not sexually fertile showing predominant asexual reproduction. Hence, genetic variation observed in the pathogen may be mainly because of high copy number of transposons. A high copy number transposon, namely Pot2, was selected in our study to detect genetic diversity of the pathogen. Pot2 rep-PCR DNA fingerprinting profile showed 27 polymorphic bands with bands ranging in size from 0.65 to 4.0 kb and an average of 10 to 14 bands per isolate. Five distinct clusters were formed with two major, two minor, and one outlier. Clusters 4 and 5 are further subdivided into three sub-clusters. Some of the isolates belonging to clusters 3, 4, and 5 are interlinked as these locations are close to one another sharing common geographical parameters and boundaries. This knowledge on the sexual behavior and genetic diversity of M. oryzae is important with respect to breeding for disease resistance.     

Variability of United States Isolates of Macrophomina phaseolina Based on Simple Sequence Repeats and Cross Genus Transferability to Related Genera Within Botryosphaeriaceae

Twelve simple sequence repeat (SSRs) loci were used to evaluate genetic diversity of 109 isolates of Macrophomina phaseolina collected from different geographical regions and host species throughout the United States (US). Genetic diversity was assessed using Nei’s minimum genetic distance, and the usefulness of each locus was determined by calculating the polymorphism information content (PIC). A total of 98 alleles were detected and of these 31 were unique to individual genotypes. Eight of twelve loci were highly informative with PIC values greater than 0.50. The majority of pairwise comparisons of genetic distance were greater than 0.60 indicating moderate to high genetic diversity. Dendrograms based on the genetic dissimilarities were created for the 109 isolates of which 79 were from soybean. Some clustering by host and geography was noted, but, the dendrograms generally grouped isolates independent of host or geography. Additionally, sequencing of the internal transcribed spacer region (ITS) for 10 isolates revealed that all of these isolates were 99% similar. Three SSR loci from M. phaseolina were cross amplified in other genera in the Botryosphaeriaceae. This was the first study of genotyping and assessing genetic diversity of M. phaseolina isolates collected from a widespread host and geographic range across the US with SSRs. With an additional 34 loci publically available for M. phaseolina, the results indicate that previously developed SSRs from one species can be used in future population, ecological, and genetic studies of M. phaseolina and other genera within the Botryosphaeriaceae.     

The molecular diversity of different isolates of <Emphasis Type="Italic">Beauveria bassiana</Emphasis> (Bals.) Vuill. as assessed using intermicrosatellites (ISSR<Subscript>s</Subscript>)

Inter-microsatellite PCR (ISSR-PCR) markers were used to identify and to examine the genetic diversity of eleven Beauveria bassiana isolates with different geographic origins. The variability and the phylogenetic relationships between the eleven strains were analyzed using 172 ISSR-PCR markers. A high level of polymorphism (near 80%) was found using these molecular markers. Seven different isolates showed exclusive bands, and ISSR primer 873 was able to distinguish between all the strains. The dendrogram obtained with these markers is robust and in agreement with the geographical origins of the strains. All the isolates from the Caribbean region were grouped together in a cluster, while the other isolates grouped in the other cluster. The similarity exhibited between the two clusters was less than 50%. This value of homology shows the high genetic variability detected between the isolates from the Caribbean region and the other isolates. ISSR-PCR markers provide a quick, reliable and highly informative system for DNA fingerprinting, and allowed the identification of the different B. bassiana isolates studied.     

Characterization of <Emphasis Type="Italic">Bradyrhizobium</Emphasis> Strains Isolated from Different Varieties of Soybean with 16SrDNA RFLP from Agricultural Land of Madhya Pradesh,India

Madhya Pradesh is the major soybean contributor in India. The taxonomy of nitrogen fixing bacteria forming symbiotic associations with leguminous plants has been deeply changed in recent years. The use of very sensitive and accurate molecular methods has enabled the detection of large rhizobial diversity. Molecular biotyping and characterization the Bradyrhizobium, isolates from eleven varieties of soybean from agricultural field of Sehore district of Madhya Pradesh is done using 16S rDNA typing. Bradyrhizobia were identified genetically by determining the %Guanine plus Cytosine content of the whole genome, followed by 16S rDNA-RFLP analysis % Guanine plus Cytosine content of all the Bradyrhizobium isolates reflects similarity at generic level among all Bradyrhizobial isolates. Restriction Fragment Length Polymorphism (RFLP) further showed a considerable level of genetic diversity among the Bradyrhizobial isolates. PCR-RFLP of 16S rDNA supported existence of two divergent groups among indigenous Bradyrhizobial isolates, at similarity level of 66, and 75 and 74% of similarity within the group. The technique used was helpful in characterizing Bradyrhizobium isolates to be used as inoculants for improving productivity of agricultural land of Madhya Pradesh (India).     

Detection of double stranded RNA in phytopathogenic <Emphasis Type="Italic">Macrophomina phaseolina</Emphasis> causing charcoal rot in <Emphasis Type="Italic">Cyamopsis tetragonoloba</Emphasis>

One hundred one isolates of Macrophomina phaseolina from various hosts and eco-geographical locations were employed for elucidating relationships among genetic diversity and virulence. Highly pathogenic, moderately pathogenic, and hypovirulent cluster bean specific isolates were identified. In order to correlate respective phenotypes of plant pathogenic fungus multiple and complex patterns of dsRNA elements were analyzed. Double-stranded ribonucleic acids (dsRNA) are ubiquitous in all major groups and most of them have vast potential as biological control agents for fungi. Rate of virulence and its further association could ascertain by host plant and their fungal genotypes. Variability of the fungal genotypes decides the link between the complexity of dsRNA with different variants and the change in virulence pattern. Double-stranded RNA was identified in approximately 21.7% of M. phaseolina isolates from charcoal rot infected cluster bean varieties. After recurrent laboratory transfer on culture media, the preponderance of the isolates harboring dsRNAs developed degenerate culture phenotypes and showed reduced virulence (hypovirulence) to cluster bean. Macrophomina has successfully showed diversified and reproducible banding profile in dsRNA containing/free isolates. This is the first report of hypovirulence and detection of dsRNA in Macrophomina phaseolina isolates of cluster bean origin.     

URP‐based DNA Fingerprinting of Bipolaris sorokiniana Isolates Causing Spot Blotch of Wheat

Spot blotch, caused by the pathogen Bipolaris sorokiniana is an important disease of wheat and is responsible for large economic losses world wide. In this study, molecular variability in B. sorokiniana isolates collected from different regions of India was investigated using URP‐PCR technique. All the 40 isolates used in the study were pathogenic when tested on susceptible host, Agra local, although they varied in pathogenicity. Isolate BS‐49 was least virulent showing 4.5 infection index while BS‐75 was the most virulent with 63.4 infection index. The universal rice primers (URPs’) are primers which have been derived from DNA repeat sequences in the rice genome. Out of the 12 URP markers used in the study, 10 markers were effective in producing polymorphic fingerprint patterns from DNA of B. sorokiniana isolates. The analysis of entire fingerprint profile using unweighted pair group method with arithmetic averages (UPGMA) differentiated B. sorokiniana isolates obtained from different geographic regions. One isolate BS‐53 from northern hill zone was different from rest of the isolates showing less than 50% similarity. Broadly, three major clusters were obtained using UPGMA method. One cluster consisted of isolates from North western plain zone; second cluster having isolates from North eastern plain zone and third cluster consisted of isolates from Peninsular zone showing more than 75% genetic similarity among them. One of the markers, URP‐2F (5′GTGTGCGATCAGTTGCTGGG3′) amplified three monomorphic bands of 0.60, 0.80 and 0.90 kb size which could be used as specific markers for identification of B. sorokiniana. Further, based on URP‐PCR analysis, the grouping of the isolates according to the geographic origin was possible. This analysis also provided important information on the degree of genetic variability and relationship between the isolates of B. sorokiniana.     

Genetic relationships among South-East Turkey wild barley populations and sampling strategies of Hordeum spontaneum

To assess the genetic diversity and the genetic structure of Turkish wild barley (Hordeum spontaneum Tell.) populations, 76 genotypes from ten ecologically and geographically different locations were analyzed by means of amplified fragment length polymorphism (AFLP) markers. Five primer combinations produced 187 scorable bands, of which 117 (62.6%) were polymorphic. Several population-specific and genotype-specific bands were identified, which differentiate populations or genotypes. Genetic distance, determined by Nei’s distance coefficient, varied from 0.07 to 0.21 with an average of 0.13. In the UPGMA dendrogram based on Nei genetic distances, the Hordeum spontaneum populations were separated into two major clusters. Genetic diversity was larger among (68%) than within (32%) populations. Eight AFLP bands were strongly correlated to the altitude of the collecting site, while no clear trend was detected between geographical origin and genetic diversity. Our results strongly suggest the need for a change in Hordeum spontaneum sampling strategy: more populations, rather then more individuals within population, should be sampled to appraise and safeguard genetic diversity in the wild barley gene pool.     

Genetic diversity analysis of <Emphasis Type="Italic">Sclerotinia sclerotiorum</Emphasis> causing stem rot in chickpea using RAPD,ITS-RFLP,ITS sequencing and mycelial compatibility grouping

Sclerotinia sclerotiorum is one of the most devastating soil-inhabiting fungal plant pathogens infecting various crop plants including chickpea. Genetic diversity of 24 isolates of S. sclerotiorum representing 10 different states of India was determined by different molecular markers and mycelial compatibility grouping (MCG). The majority of the isolates showed more than 90% genetic similarity. Unweighted paired group method with arithmetic average cluster analysis of DNA profiles generated by 21 RAPD primers grouped the isolates into seven categories showing high magnitude of genetic homogeneity and showed partial correlation with geographical origin of the isolates. Identical ITS-RFLP profiles were generated in all the isolates. Limited variability was observed among the nucleotide sequences of ITS region of the isolates. The phylogenetic tree generated from bootstrap neighbor-joining analysis indicated that 50% of Indian populations were distinct and grouped separately. The isolates were variable in mycelial compatibility and they were grouped into seven MCGs, namely, MCG A, MCG B, MCG C, MCG D, MCG E, MCG F and MCG G.     

Detection of molecular variation in the insect pathogenic fungus Metarhizium using RAPD-PCR

Abstract DNA polymorphism among isolates of the insect pathogenic fungus Metarhizium anisopliae and M. flavoviride was investigated by RAPD-PCR. DNA fragments of between 0.3 and 2.7 kb were obtained using eight 10-mer PCR primers of arbitrary nucleotide sequence, and each isolate differed in the size and number of RAPD products, indicating considerable polymorphism. Isolate-specific RAPD fingerprints were used to calculate relative genetic similarity; this differentiated isolates into two major groups, separating nine of the ten isolates of M. anisopliae from the two of M. flavoviride . However, an Australian M. anisopliae isolated from an Orthopteran host exhibited a higher degree of genetic similarity to the M. flavoviride group. M. anisopliae isolates were further segregated into three subgroups which were loosely related to their geographical origins. although considerable polymorphism was observed within these groups. There was no apparent association between genotype and original insect host.     

Molecular diversity of Fusarium oxysporum causing rot diseases of vanilla in south India

Incidence of root, stem and beans rot of vanilla (Vanilla planifolia Andrews) caused by Fusarium oxysporum Schlecht was surveyed in vanilla growing areas of south India during December 2008. The incidence of the disease varied from 1 to 100% in different locations. A total of 60 isolates of F. oxysporum were obtained from diseased samples, and nine morphologically different isolates were taken for molecular characterization using Randomly Amplified Polymorphic DNA (RAPD) markers to study the genetic variability if any, among them. PCR amplification of total genomic DNA with random oligonucleotide primers generated unique banding patterns depending upon primers and isolates. Nine oligonucleotide primers were selected for the RAPD assays, which resulted in 384 bands for nine isolates of F. oxysporum. The number of bands obtained was entered into a NTSYS and the results showed that the variability among the pathogen isolates was moderate. The nine isolates studied were grouped into single major cluster at 0.66 similarity index. Hence, it is inferred that F. oxysporum infecting vanilla in south India consists of a single clonal lineage with a moderate level of genetic diversification.     

Detection,identification and morphological characteristic of Macrophomina phaseolina: the charcoal rot disease pathogens isolated from infected plants in Northern Jordan

This is the first report about charcoal rot disease in Jordan. Twenty-five Macrophomina phaseolina isolates were collected from infected plants showing typical symptoms of charcoal rot disease. All of the 25 M. phaseolina isolates were pathogenic to cucumber plants under green house effect. The amplification of the isolated DNA from the 25 pathogenic fungal cultures using ITS specific primers (ITS 1?+?ITS 4) showed a single band of 580?bp. There was a significant variation of their mycelial linear growth rate on PDA medium. The 25 M. phaseolina isolates showed a wide heterogeneity in their mycelium colour, microsclerotia distribution, pycnidia formation and chlorate phenotypes. Based on the morphological characterisation, the 25 isolates were grouped into seven different groups as indicated in a dendrogram of their morphological variation. The overall means similarity matrix of the 25 M. phaseolina recovered isolates were 0.58. The means of similarity matrix of the 25 M. phaseolina was in between 0.83 and 0.14. The similarity coefficient between the 25 isolates varies between 0.27 and 1.0.     

Possible Host Adaptation as an Evolution Factor of Cowpea aphid‐borne mosaic virus Deduced by Coat Protein Gene Analysis

Cowpea aphid‐borne mosaic virus (CABMV) causes major diseases in cowpea and passion flower plants in Brazil and also in other countries. CABMV has also been isolated from leguminous species including, Cassia hoffmannseggii, Canavalia rosea, Crotalaria juncea and Arachis hypogaea in Brazil. The virus seems to be adapted to two distinct families, the Passifloraceae and Fabaceae. Aiming to identify CABMV and elucidate a possible host adaptation of this virus species, isolates from cowpea, passion flower and C. hoffmannseggii collected in the states of Pernambuco and Rio Grande do Norte were analysed by sequencing the complete coat protein genes. A phylogenetic tree was constructed based on the obtained sequences and those available in public databases. Major Brazilian isolates from passion flower, independently of the geographical distances among them, were grouped in three different clusters. The possible host adaptation was also observed in fabaceous‐infecting CABMV Brazilian isolates. These host adaptations possibly occurred independently within Brazil, so all these clusters belong to a bigger Brazilian cluster. Nevertheless, African passion flower or cowpea‐infecting isolates formed totally different clusters. These results showed that host adaptation could be one factor for CABMV evolution, although geographical isolation is a stronger factor.     

Strain variation in Campylobacter pylori detected by numerical analysis of one-dimensional electrophoretic protein patterns

A total of 21 clinical isolates of Campylobacter pylori from Peru and the United Kingdom and two reference strains (from Australia), including the type strain (NCTC 11637^T), were characterized by high resolution one-dimensional SDS-polyacrylamide gel electrophoresis of cellular proteins. The protein patterns contained more than 40 discrete bands and the approximate molecular weights of the major bands were 22, 27, 46, 57, 60, 65 and 93 kD. The total patterns were used as the basis of numerical analysis. Most strains were clustered in four phenons at 91% similarity with the exception of six ungrouped strains. Overall similarity was high with all strains linked in the phenogram at 81%. Variation among strains was attributable principally to qualitative and quantitative band differences in the 47 to 56 kD (hypervariable) region of the C. pylori protein profile. From the analysis, ten different electropherotypes (EP-types) were identified. We demonstrated that differences were detectable among isolates from widely separated geographical locations as well as from the same location, although multiple isolates from two Peruvian patients had the same electropherotype. Our results indicate that determination of protein profiles provides the basis of a reproducible method for characterization of C. pylori isolates.     

<Emphasis Type="Italic">Nif</Emphasis>H-based studies on azotobacterial diversity in cotton soils of India

In order to promote the use of Azotobacter inoculants for cotton crop, a complete characterization of soil isolates of Azotobacter, isolated and screened on the basis of physiological properties, from four different cotton–wheat cropping regions of India was carried out, and their genetic diversity determined by RFLP (restriction fragment length polymorphism) analysis of the functional gene nifH. Genetic analysis of these isolates depicted a similarity coefficient of ≥80% among them, suggesting that though the isolates were obtained from different cotton soils of India, still they have large commonality in the nifH gene and constituted a homogeneous nifH population.     

A Pathotype Classification for Mycosphaerella pinodes

Genetic variation of Mycosphaerella pinodes in the pathogenesis of Pisum sativum is described for the first time. On a particular host line, isolates varied from those producing a few necrotic flecks to those causing large lesions on stems or leaves. Based on reactions of nine differential host lines, 45 isolates from a wide range of geographical locations could be classed, by stem symptoms, into 9 groups or, by leaf symptoms, into 16 groups.     

RAPD-PCR and 16S rDNA phylogenetic analysis of alkaline protease producing bacteria isolated from soil of India: Identification and detection of genetic variability

178 bacterial strains were isolated from the soil samples collected from different regions of India out of which, 20 bacterial isolates were selected for alkaline protease production. The alkaline protease production efficiency of organisms was monitored at regular intervals (24 h) upto 7 days at 37 °C, pH 10. The 16S rDNA sequencing and RAPD-PCR based technique were used to identify the genetic variability among the 20 isolates of alkaline protease producing bacteria. The phylogenetic analysis indicated that the isolates can be separated into two clusters which could be further subdivided into five groups. Group 1 and 5 represented the family Bacillaceae, Groups 2 represented the Micrococcaceae family while Group 3 included the Arthrobacter bacterial group (family Micrococcaceae) from different geographical locations, respectively. Group 4 was identified as Pseudomonadaceae which was gram (−) bacteria. 21 different oligonucleotide primers were used to amplify approximately 261 fragments from each DNA sample. The bands were scored on the basis of their presence and absence and similarity between DNA samples was checked using Jaccard’s coefficient. Isolates were distinguished into distinct groups based on RAPD profiles from different geographical locations, morphological features and enzyme production efficiency. For cluster analysis the dendrogram was constructed using the unweighted pair group method with arithmetic averages (UPGMA). The results indicated that 16S rDNA and RAPD-PCR are suitable methods for rapid identification and differentiation of alkaline protease producing bacteria.     

Determination of variability in monosporidial lines of Tilletia indica by RAPD analysis

Genetic variability in 23 monosporidial lines developed from five isolates of Tilletia indica causing Karnal bunt of wheat isolated from four wheat growing states of India was determined by using 19 rapid amplified polymorphic DNA (RAPD) markers. Amplification profile generated with all the 19 primers produced 3–16 numbers of bands of 1.5–5 kb size. High level of polymorphism (95.2%) suggested wide range of variability. Maximum Jaccard's similarity coefficient (80%) was observed between KB2MsB and KB2MsC followed by KB5MsC and KB5MsE with 75% similarity, whereas it was minimum between KB3MsA and Kb4MsB (47%). The dendrogram derived from the fingerprint analysis with 19 RAPD primers by using UPGMA showed different levels of genetic similarity among monosporidial lines. At 35% genetic similarity, the monosporidial lines were grouped in two clusters. Some primers, viz., OPN-1, OPN-6, OPN-9, OPN-12, OPN-13, OPN-18, OPM-2, OPM-8, OPM-10, OPB-8, OPB-17 and OPB-20 showed 100% polymorphism. The RAPD fingerprint generated by OPN-1 and OPM-3 were analysed and showed high range of variation in genetic make-up of monosporidial lines.