Netropsin, distamycin A, bis-netropsins as selective inhibitors of restrictases and DNAse I

The simultaneous analysis of DNAase I "footprinting" data and restriction endonucleases inhibition data was performed on the same DNA end-labelled fragment. The inhibition induced by netropsin, a number of bis-netropsins and distamycin A was investigated. These experiments led us to the following conclusions. The restriction endonucleases inhibition by the ligands is caused by the ligand molecules binding in the close vicinity to the restriction endonuclease recognition sequence. The zone of +/- 4 bp from the center of the restriction endonuclease recognition sequence can be defined as the zone of the influence of the bounded ligand on the restriction endonuclease. But in this case the intersection of recognition sequence and the binding site occupied by a single ligand molecule is not sufficient for the inhibition to occur. Restriction endonuclease cutting sites protected by netropsin can be predicted basing upon known nucleotide sequence specificity of netropsin. Netropsin and bis-netropsins show different nucleotide sequence specificity. This fact can be used for selective inhibition of restriction endonucleases.     

Very efficient template/primer-independent DNA synthesis by thermophilic DNA polymerase in the presence of a thermophilic restriction endonuclease

We have found that, in the presence of a thermophilic restriction endonuclease, thermophilic DNA polymerase efficiently synthesizes and amplifies DNA in the absence of any added template and primer nucleic acid under isothermal conditions. More than 10 microg of DNA can be synthesized by 1 unit of DNA polymerase in 1 h, and the reaction proceeds until available dNTPs are consumed. We used mostly the Tsp509I restriction endonuclease (recognition sequence: decreasing AATT), the TspRI restriction endonuclease (recognition sequence: NNCA(G/C)TGNN decreasing), and Vent (exo(-)) and Vent DNA polymerase. The synthesized double-stranded DNA has a highly repetitive palindromic sequence, e.g. (AAAAATTTTT)(n) and (ATACACTGTATATACAGTGTAT)(n). In every repeating unit, there are one or two recognition sites for the restriction enzyme. Our data show that the high efficiency of the restriction-endonuclease-DNA-polymerase (RE-pol) DNA synthesis results from an efficient exponential amplification involving digestion-elongation cycles: a longer DNA with numerous recognition sites for the restriction enzyme is digested to short fragments, and the short fragments are used as seeds for elongation to synthesize longer DNA. A possible role of RE-pol DNA synthesis in the evolutionary development of genetic materials is briefly discussed.     

RSITE: a computer program to predict the recognition sequence of a restriction enzyme.

A computer program (RSITE) was developed which predicts the recognition sequence of a restriction endonuclease. The sizes of fragments experimentally determined on cleavage of a DNA of known sequence were input. Possible recognition sequences producing fragments of sizes matching those determined empirically were printed out. The program faithfully predicted the specificity of restriction enzymes of known recognition sequence and also determined the recognition sequence of a new restriction enzyme from Haemophilus influenzae GU (HinGU II).     

BtrI, a novel restriction endonuclease, recognises the non-palindromic sequence 5'-CACGTC(-3/-3)-3'

The recognition sequence and cleavage positions of a new restriction endonuclease BTR:I isolated from Bacillus stearothermophilus SE-U62 have been determined. BTR:I belongs to a rare type IIQ of restriction endonucleases, which recognise non-palindromic nucleotide sequences and cleave DNA symmetrically within them.     

Tsp49I (ACGT/), a thermostable neoschizomer of the Type II restriction endonuclease MaeII (A/CGT), discovered in isolates of the genus Thermus from the Azores, Iceland and New Zealand.

One hundred and forty eight isolates of the genus Thermus, from neutral and alkaline hot water springs on four continents, have been screened for the presence of restriction endonuclease activity. An isolate (SM49) from the island of Sao Miguel, in the Azores, showed a high level of restriction endonuclease activity when a cell-free extract was incubated with lambda phage DNA at 65 degrees C. A Type II restriction endonuclease (Tsp49I) has been partially purified from this isolate and the recognition and cleavage site determined. Tsp49I recognizes the four base sequence ACGT, which is the same as the recognition sequence of the mesophilic Type II restriction endonuclease MaeII. However, unlike MaeII, which cleaves DNA between the first and second bass of the recognition sequence (A/CGT), Tsp49I hydrolyses the phosphodiester bond in both strands of the substrate after the last base of the recognition sequence 5'-ACGT/-3', producing four base 3'-OH overhangs (sticky ends). The enzyme has a pH optimum of 9.0, requires 2 mM MgCl2 for maximum activity and retains full enzyme activity following incubation for 10 min at temperatures up to 8O degrees C. Two further examples of the same restriction endonuclease specificity as Tsp491 were detected in Thermus isolates from Iceland (TspIDSI) and New Zealand (TspWAM8AI). The three MaeII neoschizomers, Tsp49I, TspIDSI and TspWAM8AI, exhibit similar pH optima, heat stabilities and MgCl2 requirements, but differ in their requirements for NaCl and KCl.     

Taq52 I, a novel and thermostable type II restriction endonuclease from the genus Thermus, recognising the pentanucleotide sequence GC(A or T)GC and cleaving DNA between the first and second bases of the recognition sequence: G decreased or reduced C(A or T)GC.

127 isolates of the genus Thermus, from neutral and alkaline hot water springs on four continents, have been screened for the presence of restriction endonuclease activity. An isolate (YS52) from Yellowstone National Park, USA, showed a high level of restriction endonuclease activity when a cell free extract was incubated with lambda phage DNA at 65 degrees C. A Type II restriction endonuclease (Taq52 I) has been partially purified from this isolate and the recognition and cleavage site determined. Taq52 I has a novel interrupted palindromic tetranucleotide recognition sequence GCWGC, where W can be either adenine (A) or thymine (T). It hydrolyses the phosphodiester bond in both strands of the substrate between the first and second bases of the recognition sequence: 5'G decreased or reduced CWGC3', producing three-base 5'-OH overhangs (sticky ends). The enzyme has a pH optimum of 7.0, requires 8 mM MgCl2 for maximum activity and is thermally stable, retaining full enzyme activity following incubation at 79 degrees C for 10 min. Taq52 I not only represents a new addition to the Type II restriction endonucleases, but also increases the small list of thermostable restriction endonucleases.     

WebFARM: web server for finite automated restriction mapping

Restriction endonucleases are indispensable tools in molecular biology and biotechnology. Type II restriction endonucleases are part of restriction modification systems. DNA fragment extraction and restriction mapping are the basis for several biotechnological activities. WebFARM is a server application for identifying restriction endonuclease recognition sites and to give information regarding restriction mapping for given nucleotide sequences. WebFARM analyses given nucleotide sequence and identify restriction site for selected restriction endonucleases. It will also provide frequency of restriction for each restriction endonuclease. AVAILABILITY: http://webfarm.bioinfoindia.org/     

Isolation and characterisation of DraI, a type II restriction endonuclease recognising a sequence containing only A:T basepairs, and inhibition of its activity by uv irradiation of substrate DNA

A type II restriction endonuclease, DraI, isolated from Deinococcus radiophilus ATCC 27603 recognises the palindromic hexanucleotide sequence (formula; see text) and cleaves it, as indicated by the arrows, to produce blunt-ended fragments. The yield of enzyme is 100 to 1000 times that of the only other known type II restriction endonuclease that recognises a sequence composed solely of A:T basepairs, the isoschizomer AhaIII (1). Ultraviolet irradiation of the DNA substrate at relatively low doses inhibits the activity of DraI by "protecting" the recognition sequence and this may be exploited to give control of partial digestion of DNA by DraI.     

TspGWI, a thermophilic class-IIS restriction endonuclease from Thermus sp., recognizes novel asymmetric sequence 5'-ACGGA(N11/9)-3'

A novel prototype class-IIS restriction endonuclease, TspGWI, was isolated from the thermophilic bacterium Thermus sp. GW. The recognition sequence and cleavage positions have been established: TspGWI recognizes the non-palindromic 5-bp sequence 5'-ACGGA-3' and cleaves the DNA 11 and 9 nt downstream in the top and bottom strand, respectively. In addition, an accompanying endonuclease, TspGWII, an isoschizomer of Pst I, was found in Thermus sp. GW cells.     

Recognition sequence of a restriction endonuclease from Haemophilus gallinarum

From comparison of the sequences in and around the cleavage sites of restriction endonuclease HgaI isolated from Haemophilus gallinarum, the recognition sequence and cleavage site of this enzyme was deduced as below: (formula: see text) This enzyme recognizes a specific but asymmetric penta-nucleotide sequence, GCGTC, and introduces staggered cleavages at appointed positions away from the recognition sequence, generating protruding 5'-ends of five nucleotides. The sequences surrounding the cleavage sites bear no obvious relation to one another.     

Determination of substrate specificity of restriction endonuclease FauI

The recognition sequence and cleavage point of restriction endonuclease FauI have been determined as 5'-CCCGC(4/6). Not being isoschisomer of any known restriction endonuclease, this enzyme may be used in genetic engineering.     

SruI restriction endonuclease from Selenomonas ruminantium

Abstract Sru I, specific restriction endonuclease, has been characterized from Selenomonas ruminantium isolated from the rumen of fallow deer. Results from the study demonstrate that S. ruminantium 18D possesses a type II restriction endonuclease, which recognizes the sequence 5'-TTT↓AAA-3'. The recognition sequence of Sru I was identified using digestions on pBR322, pBR328, pUC18, M13mp18RF, pACYC184 and λDNA. The cleavage patterns obtained were compared with computer-derived data. Sru I recognises the palindromic hexanucleotide sequence and cleaves DNA after the third T in the sequence, producing blunt ends. The purification and characterization of restriction endonuclease Sru I presented here is the first described for Selenomonas ruminantium spp. and demonstrates that this microorganism pocesses a DNA-cleaving enzyme with the same specificity as Dra I or Aha III.     

Cloning and nucleotide sequence of the genes coding for the Sau96I restriction and modification enzymes.

The genes coding for the GGNCC specific Sau96I restriction and modification enzymes were cloned and expressed in E. coli. The DNA sequence predicts a 430 amino acid protein (Mr: 49,252) for the methyltransferase and a 261 amino acid protein (Mr: 30,486) for the endonuclease. No protein sequence similarity was detected between the Sau96I methyltransferase and endonuclease. The methyltransferase contains the sequence elements characteristic for m5C-methyltransferases. In addition to this, M.Sau96I shows similarity, also in the variable region, with one m5C-methyltransferase (M.SinI) which has closely related recognition specificity (GGA/TCC). M.Sau96I methylates the internal cytosine within the GGNCC recognition sequence. The Sau96I endonuclease appears to act as a monomer.     

Characterization of BseMII, a new type IV restriction-modification system, which recognizes the pentanucleotide sequence 5'-CTCAG(N)(10/8)/

We report the properties of the new BseMII restriction and modification enzymes from Bacillus stearothermophilus Isl 15-111, which recognize the 5'-CTCAG sequence, and the nucleotide sequence of the genes encoding them. The restriction endonuclease R.BseMII makes a staggered cut at the tenth base pair downstream of the recognition sequence on the upper strand, producing a two base 3'-protruding end. Magnesium ions and S:-adenosyl-L-methionine (AdoMet) are required for cleavage. S:-adenosylhomocysteine and sinefungin can replace AdoMet in the cleavage reaction. The BseMII methyltransferase modifies unique adenine residues in both strands of the target sequence 5'-CTCAG-3'/5'-CTGAG-3'. Monomeric R.BseMII in addition to endonucleolytic activity also possesses methyltransferase activity that modifies the A base only within the 5'-CTCAG strand of the target duplex. The deduced amino acid sequence of the restriction endonuclease contains conserved motifs of DNA N6-adenine methylases involved in S-adenosyl-L-methionine binding and catalysis. According to its structure and enzymatic properties, R.BseMII may be regarded as a representative of the type IV restriction endonucleases.     

Substrate specificity of restriction endonuclease VspI

The recognition sequence and cleavage point of restriction endonuclease VspI have been determined as 5'-AT decreases TAAT. This enzyme is not isoschizomer of any known restriction endonucleases. DNA pBR322 contains a single VspI recognition sequence in position 3539. Therefore this enzyme may be used for cloning DNA in the VspI site in AmpR-gene of pBR322.     

A new Thermus sp. class-IIS enzyme sub-family: isolation of a 'twin' endonuclease TspDTI with a novel specificity 5'-ATGAA(N(11/9))-3', related to TspGWI,TaqII and Tth111II

The TspDTI restriction endonuclease, which shows a novel recognition specificity 5'-ATGAA(N(11/9))-3', was isolated from Thermus sp. DT. TspDTI appears to be a 'twin' of restriction endonuclease TspGWI from Thermus sp. GW, as we have previously reported. TspGWI was isolated from the same location as TspDTI, it recognizes a related sequence 5'-ACGGA(N(11/9))-3' and has conserved cleavage positions. Both enzymes resemble two other class-IIS endonucleases from Thermus sp.: TaqII and Tth111II. N-terminal amino acid sequences of TspGWI tryptic peptides exhibit 88.9-100% similarity to the TaqII sequence. All four enzymes were purified to homogeneity; their polypeptide sizes (114.5-122 kDa) make them the largest class-IIS restriction endonucleases known to date. The existence of a Thermus sp. sub-family of class-IIS restriction endonucleases of a common origin is herein proposed.     

The inhibition of restriction endonuclease PvuII cleavage activity by methylation outside its recognition sequence.

The recombinant plasmid pGEM4Z-ras DNA which was methylated on dam and dcm sites outside the PvuII recognition sequence was digested with restriction endonuclease PvuII, and one of the three PvuII sites was about 16-fold less efficient to cleave than either of the other two. On the contrary, the three PvuII sites were cleaved at about the same rate on the unmethylated DNA molecule. The results show that the cleavage inhibition of the methylated DNA on the certain PvuII site was caused by methylation outside the PvuII recognition sequence. Maybe a adjacent methylated dam site *A was responsible for the less efficient cleavage. This observation suggests that methylation outside the recognition sequence may be considered a new factor in the kinetic experiment of restriction endonuclease.     

Characterization of the specific DNA nicking activity of restriction endonuclease N.BstNBI

N.BstNBI is a unique restriction endonuclease isolated from Bacillus stearothermophilus. We have characterized the recognition sequence and the cleavage site of N.BstNBI. Mapping of cleavage sites of N.BstNBI showed that it recognizes an asymmetric sequence, 5' GAGTC 3', and cleaves only on the top strand 4 base pairs away from its recognition sequence. To verify the nicking activity of N. BstNBI, we have constructed two plasmids containing a single recognition sequence (pNB1) or no recognition site (pNB0). When pNB1 and pNB0 were incubated with the enzyme, N.BstNBI nicked only the plasmid pNB1, suggesting that N.BstNBI is a specific nicking endonuclease.     

Substrate specificity of restriction endonuclease SfeI

The recognition sequence and cleavage site C decreases TRYAG of a new restriction endonuclease SfeI have been determined.     

Isolation and computer-aided characterization of MmeI, a type II restriction endonuclease from Methylophilus methylotrophus.

A Type II restriction endonuclease, MmeI, has been purified from the obligate methylotroph, Methylophilus methylotrophus. The enzyme was shown to have the non-palindromic recognition sequence 5'-T C C Pu A C (N)20-3', 3'-A G G Py T G (N)18-5' and to cleave (as indicated) on the 3' side, generating a two nucleotide 3' projection. Determination of the recognition sequence was achieved using two new computer programs; RECOG, which predicts recognition sequences from the pattern of restriction fragments obtained from DNAs of known sequence, and GELSIM, which generates graphical simulations of DNA band patterns obtained by gel electrophoresis of restriction digests of sequenced DNA molecules.