Studies of defective interfering RNAs of Sindbis virus with and without tRNAAsp sequences at their 5'' termini.

Three of six independently derived defective interfering (DI) particles of Sindbis virus generated by high-multiplicity passaging in cultured cells have tRNAAsp sequences at the 5' terminus of their RNAs (Monroe and Schlesinger, J. Virol. 49:865-872, 1984). In the present work, we found that the 5'-terminal sequences of the three tRNAAsp-negative DI RNAs were all derived from viral genomic RNA. One DI RNA sample had the same 5'-terminal sequence as the standard genome. The DI RNAs from another DI particle preparation were heterogeneous at the 5' terminus, with the sequence being either that of the standard 5' end or rearrangements of regions near the 5' end. The sequence of the 5' terminus of the third DI RNA sample consisted of the 5' terminus of the subgenomic 26S mRNA with a deletion from nucleotides 24 to 67 of the 26S RNA sequence. These data showed that the 5'-terminal nucleotides can undergo extensive variations and that the RNA is still replicated by virus-specific enzymes. DI RNAs of Sindbis virus evolve from larger to smaller species. In the two cases in which we followed the evolution of DI RNAs, the appearance of tRNAAsp-positive molecules occurred at the same time as did the emergence of the smaller species of DI RNAs. In pairwise competition experiments, one of the tRNAAsp-positive DI RNAs proved to be the most effective DI RNA, but under identical conditions, a second tRNAAsp-positive DI RNA was unable to compete with the tRNAAsp-negative DIs. Therefore, the tRNAAsp sequence at the 5' terminus of a Sindbis DI RNA is not the primary factor in determining which DI RNA becomes the predominant species in a population of DI RNA molecules.     

Sequence analysis of cDNA''s derived from the RNA of Sindbis virions and of defective interfering particles

Sindbis virus generates defective interfering (DI) particles during serial high-multiplicity passage in cultured cells. These DI particles inhibit the replication of infectious virus and can be an important factor in the establishment and maintenance of persistent infection in BHK cells. In an effort to understand how these DI particles are generated and how they interfere with the replication of standard virus, we performed a partial sequence analysis of the RNA obtained from two independently isolated populations of DI particles and from two Sindbis virus variants and compared these with the RNA of the parental wild-type virus. The 3'-terminal regions of the RNAs were sequenced by the dideoxy chain terminating method. Internal regions of the RNA were examined by restriction endonuclease digestion of cDNA's made to the various RNAs and by direct chemical sequencing of 5' end-labeled restriction fragments from cDNA made to the DI RNAs. One of the variant viruses examined was originally derived from cells persistently infected with Sindbis virus for 16 months and is resistant to interference by the DI strains used. In the 3'-terminal region of the RNA from this variant, only two base changes were found; one of these occurs in the 20-nucleotide 3'-terminal sequence which is highly conserved among alphaviruses. The DI RNA sequences were found to have been produced not by a single deletional event, but by multiple deletion steps combined with sequence rearrangements; all sequences examined are derived from the plus strand of Sindbis virion RNA. Both DI RNAs had at least 50 nucleotides of wild-type sequence conserved at the 3' terminus; in addition, they both contained conserved and perhaps amplified sequences derived from the non-26S region of the genome which may be of importance in their replication and interference ability.     

The complete sequence of a unique RNA species synthesized by a DI particle of VSV.

The 2S RNA synthesized in vitro by the RNA polymerase of a defective interfering (DI) particle of vesicular stomatitis virus was labeled at its 3' terminus with 32P-cytidine 3', 5' bisphosphate and RNA ligase. Analysis of the labeled RNA showed that it was a family of RNAs of different length but all sharing the same 5' terminal sequence. The largest labeled RNA was purified by gel electrophoresis, and the sequence of 41 of its 46 nucleotides was determined by rapid RNA sequencing methods. The assignment of the remaining 5 nucleotides was made on the basis of an analysis of one of the smaller RNAs and published data. A new approach in RNA sequencing based on the identification of 3' terminal nucleotides of rna fragments originally present in the DI product or generated during the ligation reaction confirmed most of the sequence. The complete sequence of this 46 nucleotide long plus-sense RNA is: ppACGAAGACCACAAAACCAGAUAAAAAA UAAAAACCACAAGAGGGUC-OH. This RNA anneals to the RNA of the DI particle from which it was synthesized, indicating that its synthesis is template-specified. At least the first 17 and possibly all of the nucleotides are also complementary to sequences at the 3' end of two other VSV DI particles which were derived independently and whose genomes differ significantly in length. These data suggest a common 3' terminal sequence among all VSV DI particles which contain part of the Lgene region of the parental genome.     

Nucleotide sequence and stability of the RNA component of RNase P from a temperature-sensitive mutant of E. coli.

The gene coding for the RNA component of RNase P was cloned from a temperature-sensitive mutant of Escherichia coli defective in RNase P activity (ts709) and its parental wild-type strain (4273), and the complete nucleotide sequences of the gene and its flanking regions were determined. The 5'- and 3'-terminal sequences of the RNA component were determined and mapped on the DNA sequence. The mutant gene has GC-to-AT substitutions at positions corresponding to 89 and 365 nucleotides downstream from the 5' terminus of the RNA sequence. Comparing to the wild-type RNA, the mutant RNA is less stable and rapidly degraded in vivo and in vitro.     

Evidence for the Identity of Shared 5′-Terminal Sequences Between Genome RNA and Subgenomic mRNA''s of B77 Avian Sarcoma Virus

The polyribosomal fraction from chicken embryo fibroblasts infected with B77 avian sarcoma virus contained 38S, 28S, and 21S virus-specific RNAs in which sequences identical to the 5'-terminal 101 bases of the 38S genome RNA were present. The only polyadenylic acid-containing RNA species with 5' sequences which was detectable in purified virions had a sedimentation coefficient of 38S. This evidence is consistent with the hypothesis that a leader sequence derived from the 5' terminus of the RNA is spliced to the bodies of the 28S and 21S mRNA's, both of which have been shown previously to be derived from the 3' terminal half of the 38S RNA. The entire 101-base 5' terminal sequence of the genome RNA appeared to be present in the majority of the subgenomic intracellular virus-specific mRNA's, as established by several different methods. First, the extent of hybridization of DNA complementary to the 5'-terminal 101 bases of the genome to polyadenylic acid-containing subgenomic RNA was similar to the extent of its hybridization to 38S RNA from infected cells and from purified virions. Second, the fraction of the total cellular polyadenylic acid-containing RNA with 5' sequences was similar to the fraction of RNA containing sequences identical to the extreme 3' terminus of the genome RNA when calculated by the rate of hybridization of the appropriate complementary DNA probes. This suggests that most intracellular virus-specific RNA molecules contain sequences identical to those present in the 5'-terminal 101 bases of the genome. Third, the size of most of the radioactively labeled DNA complementary to the 5'-terminal 101 bases of the genome remained unchanged after the probe was annealed to either intracellular 38S RNA or to various size classes of subgenomic RNA and the hybrids were digested with S1 nuclease and denatured with alkali. However, after this procedure some DNA fragments of lower molecular weight were present. This was not the case when the DNA complementary to the 5'-terminal 101 bases of the genome was annealed to 38S genome RNA. These results suggest that, although the majority of the intracellular RNA contains the entire 101-base 5'-terminal leader sequence, a small population of virus-specific RNAs exist that contain either a shortened 5' leader sequence or additional splicing in the terminal 101 bases.     

Modification of the 5' terminus of Sindbis virus genomic RNA allows nsP4 RNA polymerases with nonaromatic amino acids at the N terminus to function in RNA replication

We have previously shown that Sindbis virus RNA polymerase requires an N-terminal aromatic amino acid or histidine for wild-type or pseudo-wild-type function; mutant viruses with a nonaromatic amino acid at the N terminus of the polymerase, but which are otherwise wild type, are unable to produce progeny viruses and will not form a plaque at any temperature tested. We now show that such mutant polymerases can function to produce progeny virus sufficient to form plaques at both 30 and 40 degrees C upon addition of AU, AUA, or AUU to the 5' terminus of the genomic RNA or upon substitution of A for U as the third nucleotide of the genome. These results are consistent with the hypothesis that (i) 3'-UA-5' is required at the 3' terminus of the minus-strand RNA for initiation of plus-strand genomic RNA synthesis; (ii) in the wild-type virus this sequence is present in a secondary structure that can be opened by the wild-type polymerase but not by the mutant polymerase; (iii) the addition of AU, AUA, or AUU to the 5' end of the genomic RNA provides unpaired 3'-UA-5' at the 3' end of the minus strand that can be utilized by the mutant polymerase, and similarly, the effect of the U3A mutation is to destabilize the secondary structure, freeing 3'-terminal UA; and (iv) the N terminus of nsP4 may directly interact with the 3' terminus of the minus-strand RNA for the initiation of the plus-strand genomic RNA synthesis. This hypothesis is discussed in light of our present results as well as of previous studies of alphavirus RNAs, including defective interfering RNAs.     

Selection of functional 5' cis-acting elements promoting efficient sindbis virus genome replication

The 5' portion of the Sindbis virus (SIN) genome RNA is multifunctional. Besides initiating translation of the nonstructural polyprotein, RNA elements in the 5' 200 bases of the SIN genome RNA, or its complement at the 3' end of the negative-strand intermediate, play key roles in the synthesis of both negative- and positive-strand RNAs. We used here a combination of genetic and biochemical approaches to further dissect the functions of this sequence. Replacement of the SIN 5' end in defective-interfering (DI) and genome RNAs with sequences from a distantly related alphavirus, Semliki Forest virus (SFV), resulted in nonviable chimeras. The addition of five nucleotides from the 5' terminus of SIN restored negative-strand RNA synthesis in DI genomes but not their replication in vivo. Pseudorevertants of various SFV-SIN chimeras were isolated, and suppressor mutations were mapped to AU-rich sequences added to the 5' end of the original SFV 5' sequence or its "deleted" versions. Early pseudorevertants had heterogeneous 5' termini that were inefficient for replication relative to the parental SIN 5' sequence. In contrast, passaging of these pseudorevertant viral populations in BHK cells under competitive conditions yielded evolved, more homogeneous 5'-terminal sequences that were highly efficient for negative-strand synthesis and replication. These 5'-terminal sequences always began with 5'-AU, followed by one or more AU repeats or short stretches of oligo(A). Further analysis demonstrated a positive correlation between the number of repeat units and replication efficiency. Interestingly, some 5' modifications restored high-level viral replication in BHK-21 cells, but these viruses were impaired for replication in the cells of mosquito origin. These studies provide new information on sequence determinants required for SIN RNA replication and suggest new strategies for restricting cell tropism and optimizing the packaging of alphavirus vectors.     

Subcellular localization of RNAs in transfected cells: role of sequences at the 5' terminus

We have investigated the intracellular location of RNAs transcribed from transfected DNA. COS cells transfected with a clone containing the human adult beta globin gene contain three classes of globin RNAs. Their 3' termini and splice sites are indistinguishable from those of mature reticulocyte beta globin mRNA, and they are polyadenylated. However, as determined by S1 mapping, their 5' sequences are different. The 5' terminus of one is the same as that of mature beta globin mRNA (+1, cap site). The presumed 5' terminus of the second is located 30 nucleotides downstream from the cap site (+30). The third class contains additional nucleotides transcribed from sequences located 5' to the cap site (5' upstream RNA). The 5' upstream RNA molecules are restricted to the nucleus and are more stable than heterogeneous nuclear RNA. The +30 and +1 RNAs are located primarily in the cytoplasm. The data support the notion that nucleotide sequences and/or secondary modifications in the 5' region determine if an RNA is to be transported.     

Escherichia coli 23S ribosomal RNA truncated at its 5'' terminus.

In a strain of E. coli deficient in RNase III (ABL1), 23S rRNA has been shown to be present in incompletely processed form with extra nucleotides at both the 5' and 3' ends (King et al., 1984, Proc. Natl. Acad. Sci. U.S. 81, 185-188). RNA molecules with four different termini at the 5' end are observed in vivo, and are all found in polysomes. The shortest of these ("C3") is four nucleotides shorter than the accepted mature terminus. In growing cells of both wild-type and mutant strains up to 10% of the 23S rRNA chains contain the 5' C3 terminus. In stationary phase cells, the proportion of C3 termini remains the same in the wild-type cells; but C3 becomes the dominant terminus in the mutant. Species C3 is also one of the 5' termini of 23S rRNA generated in vitro from larger precursors by the action of purified RNase III. We therefore suggest that some form of RNase III may still exist in the mutant; and since no cleavage is detectable at any other RNase III-specific site, the remaining enzyme would have a particular affinity for the C3 cleavage site, especially in stationary phase cells. We raise the question whether the C3 terminus has a special role in cellular metabolism.     

Terminal sequences of vesicular stomatitis virus RNA are both complementary and conserved.

The nucleotide sequences at the 5' and 3' termini of RNA isolated from the New Jersey serotype of vesicular stomatitis virus [vsV(NJ)] and two of its defective interfering (DI) particles have been determined. The sequence differs from that previously demonstrated for the RNA from the Indiana serotype of VSV at only 1 of the first 17 positions from the 3' terminus and at only 2 of the first 17 positions from the 5' terminus. The 5'-terminal sequence of VSV(NJ) RNA is the complement of the 3'-terminal sequence, and duplexes which are 20 bases long and contain the 3' and 5' termini have been isolated from this RNA. The RNAs isolated from DI particles of VSV(NJ) have the same base sequences as do the RNAs from the parental virus. These results are in sharp contrast to those obtained with the Indiana serotype of VSV and its DI particles, in which the 3'-terminal sequences differ in 3 positions within the first 17. However, with both serotypes, the 3'-terminal sequence of the DI RNA is the complement of the 5'-terminal sequence of the RNA from the infectious virus. These findings suggest that the 3' and 5' RNA termini are highly conserved in both serotypes and that the 3' terminus of DI RNA is ultimately derived by copying the 5' end of the VSV genome, as recently proposed (D. Kolakofsky, M. Leppert, and L. Kort, in B. W. J. Mahy and R. D. Barry, ed., Negative-Strand Virus and the Host Cell, 1977; M. Leppert, L. Kort, and D. Kolakofsky, Cell 12:539-552, 1977; A. S. Huang, Bacteriol. Rev. 41:811-8218 1977).     

3' processing of human pre-U2 small nuclear RNA: a base-pairing interaction between the 3' extension of the precursor and an internal region.

The spliceosomal small nuclear RNAs U1, U2, U4, and U5 are transcribed by RNA polymerase II as precursors with extensions at their 3' ends. The 3' processing of these pre-snRNAs is not understood in detail. Two pathways of pre-U2 RNA 3' processing in vitro were revealed in the present investigation by using a series of human wild-type and mutant pre-U2 RNAs. Substrates with wild-type 3' ends were initially shortened by three or four nucleotides (which is the first step in vivo), and the correct mature 3' end was then rapidly generated. In contrast, certain mutant pre-U2 RNAs displayed an aberrant 3' processing pathway typified by the persistence of intermediates representing cleavage at each internucleoside bond in the precursor 3' extension. Comparison of the wild-type and mutant pre-U2 RNAs revealed a potential base-pairing interaction between nucleotides in the precursor 3' extension and a sequence located between the Sm domain and stem-loop III of U2 RNA. Substrate processing competition experiments using a highly purified pre-U2 RNA 3' processing activity suggested that only RNAs capable of this base-pairing interaction had high affinity for the pre-U2 RNA 3' processing enzyme. The importance of this postulated base-pairing interaction between the precursor 3' extension and the internal region between the Sm domain and stem-loop III was confirmed by the results obtained with a compensatory substitution that restores the base pairing, which displayed the normal 3' processing reaction. These results implicate a precursor-specific base-paired structure involving sequences on both sides of the mature cleavage site in the 3' processing of human U2 RNA.