Magnetic colorimetric immunoassay for human interleukin-6 based on the oxidase activity of ceria spheres

A novel magnetic colorimetric immunoassay strategy was designed for sensitive detection of human interleukin-6 (IL-6) using ceria spheres as labels. Ceria spheres showed excellent oxidase activity, which can directly catalyze the oxidation of substrate o-phenylenediamine (OPD) to a stable yellow product, 2,3-diaminophenazine (oxOPD). The absorbance of oxOPD was recorded to reflect the level of IL-6. The relatively mild conditions made the immunoassay strategy more robust, reliable, and easy. A linear relationship between absorbance intensity and the logarithm of IL-6 concentrations was obtained in the range of 0.0001–10 ng mL⁻¹ with a detection limit of 0.04 pg mL⁻¹ (S/N = 3). The colorimetric immunoassay exhibited high sensitivity and specificity for the detection of IL-6. This immunoassay has been successfully applied in the detection of IL-6 in serum samples and can be readily extended toward the on-site monitoring of cancer biomarkers in serum samples.     

Isolation of a new ssDNA aptamer against staphylococcal enterotoxin B based on CNBr‐activated sepharose‐4B affinity chromatography

Staphylococcus aureus are potent human pathogens possessing arsenal of virulence factors. Staphylococcal food poisoning (SFP) and respiratory infections mediated by staphylococcal enterotoxin B (SEB) are common clinical manifestations. Many diagnostic techniques are based on serological detection and quantification of SEB in different food and clinical samples. Aptamers are known as new therapeutic and detection tools which are available in different ssDNA, dsDNA and protein structures. In this study, we used a new set of ssDNA aptamers against SEB. The methods used included preparation of a dsDNA library using standard SEB protein as the target analyte, affinity chromatography matrix in microfuge tubes, SELEX procedures to isolate specific ssDNA‐aptamer as an affinity ligand, aptamer purification using ethanol precipitation method, affinity binding assay using ELISA, aptamer cloning and specificity test. Among 12 readable sequences, three of them were selected as the most appropriate aptamer because of their affinity and specificity to SEB. This study presents a new set of ssDNA aptamer with favorable selectivity to SEB through 12 rounds of SELEX. Selected aptamers were used to detect SEB in infected serum samples. Results showed that SEB c1 aptamer (2 µg SEB/100 nM aptamer) had favorable specificity to SEB (k_d = 2.3 × 10^?11). In conclusion, aptamers can be considered as useful tools for detecting and evaluating SEB. The results showed that affinity chromatography was an affordable assay with acceptable accuracy to isolate sensitive and selective novel aptamers. Copyright © 2016 John Wiley & Sons, Ltd.     

Design of ultrasensitive bisphenol A–aptamer based on platinum nanoparticles loading to polyethyleneimine-functionalized carbon nanotubes

Here, a highly sensitive electrochemical aptasensor based on a novel signal amplification strategy for the determination of bisphenol A (BPA) was developed. Construction of the aptasensor began with the deposition of highly dispersed platinum nanoparticles (PtNPs)/acid-oxidized carbon nanotubes (CNTs–COOH) functionalized with polyethyleneimine (PEI) at the surface of glassy carbon (PtNPs/PEI/CNTs–COOH/GC) electrode. After immobilizing the amine-capped capture probe (ssDNA1) through the covalent amide bonds formed by the carboxyl groups on the nanotubes and the amino groups on the oligonucleotides, we employed a designed complementary BPA–aptamer (ssDNA2) as a detection probe to hybridize with the ssDNA1. By adding BPA as a target, the aptamer specifically bound to BPA and its end folded into a BPA-binding junction. Because of steric/conformational restrictions caused by aptamer–BPA complex formation at the surface of modified electrode, the interfacial electron transfer of [Fe(CN)₆]^3−/4− as a probe was blocked. Sensitive quantitative detection of BPA was carried out by monitoring the decrease of differential pulse voltammetric responses of [Fe(CN)₆]^3−/4− peak current with increasing BPA concentrations. The newly developed aptasensor embraced a number of attractive features such as ease of fabrication, low detection limit, excellent selectivity, good stability and a wide linear range with respect to BPA.     

Development of a ssDNA aptamer system with reduced graphene oxide (rGO) to detect nonylphenol ethoxylate in domestic detergent

Endocrine‐disrupting chemicals are a major public health problem throughout the world. In the human body, these compounds functionalize the same as sexual hormones, inducing precocious puberty, gynecomastia, etc. To help prevent this occurrence, a simple detection system is needed. In this study, a nonylphenol ethoxylate (NPE)‐specific aptamer was selected by reduced graphene oxide‐systematic evolution of ligands by exponential enrichment. A random ssDNA library was incubated with rGO for adsorption, followed by elution with the target molecule. As a result of screening, a DNA aptamer was found that specifically bounds to the target with high binding affinity (K_d = 100.9 ± 13.2 nM) and had a low limit of detection (LOD = 696 pM). Furthermore, this NPE‐binding aptamer bounds selectively to the target. Characterization of the aptamer was confirmed by measuring the fluorescence signal recovery from rGO. In addition, detection of NPE was performed with several water samples, and the detection accuracy was 100 ± 10%. From these results, we expect that this aptamer could be applied to an on‐site detection system for NPE in industrial sites or domestic fields.     

Determination of collagen type IV by Surface Plasmon Resonance Imaging using a specific biosensor

Serum collagen type IV (COLIV) is a promising tumor marker. High COLIV concentrations have been found in the serum of patients with colorectal, gastric, lung, liver and breast cancers. The aim of this work was to develop a biosensor for use with the Surface Plasmon Resonance Imaging (SPRI) technique for COLIV determination. The biosensor consists of glass covered with gold and immobilized monoclonal mouse anti-human collagen type IV antibody via cysteamine linker. The biosensor works selectively within a dynamic response range between 10 and 300 ng mL⁻¹, with LOD 2.4 ng mL⁻¹ and LOQ 8 ng mL⁻¹. The precision of determination is 4.7% at a 150 ng mL⁻¹ COLIV spike and 8.0% at a 20 ng mL⁻¹ spike, with recoveries of 101% and 106% respectively. A 100-fold excess of collagen I, albumin, laminin and fibronectin is tolerated. The average COLIV blood plasma concentration of healthy donors determined by the developed method was 69 ± 10 ng mL⁻¹, while the median of six results available in the literature was approximately 80 ng mL⁻¹. The average COLIV blood plasma concentration of breast cancer patients was 360 ± 68 ng mL⁻¹, showing the high potential of COLIV as a marker of this type of cancer.     

Tetramethyl-6-carboxyrhodamine quenching-based aptasensing platform for aflatoxin B1: Analytical performance comparison of two aptamers

In this study, a simple TAMRA (tetramethyl-6-carboxyrhodamine) quenching-based aptasensing platform was designed for the detection of aflatoxin B1 (AFB1). Here, we compared the analytical performance of two aptamer sequences: seqA and seqB. The AFB1 detection was based on the interactions of FAM (carboxyfluorescein)-labeled aptamer with TAMRA-labeled DNA complementary strand in the presence and absence of target analyte. Under optimized experimental conditions, TAMRA-labeled strand quenched the fluorescence response of FAM-labeled aptamer due to the noncovalent interaction between the two DNA strands. The binding of AFB1 induced the complex formation and weakened the interaction between FAM-labeled aptamer and TAMRA-labeled complementary strand, resulting in the fluorescence recovery. By using this principle concept, an assay was constructed for the detection of AFB1. The method exhibited good sensitivity, good selectivity with a limit of detection of 0.2 ng ml⁻¹, and a wide linear range from 0.25 to 32 ng ml⁻¹. For real sample application, the aptasensors were tested in beer and wine samples, with good recovery rates obtained for AFB1 detection.     

Selection of a DNA aptamer that binds 8-OHdG using GMP-agarose

DNA aptamers, which bind specific molecule, such as 8-OHdG, with high affinity were investigated using an in vitro selection strategy called systematic evolution of ligands by exponential enrichment (SELEX). However, 8-OHdG was difficult to immobilize on a carrier for SELEX. Therefore, a DNA aptamer binding to 8-OHdG was selected using GMP-agarose as an analogue from a library of about 4⁶⁰ random ssDNA sources. As a result, three aptamer candidates were selected. Among the selected DNA aptamers, the No. 22 DNA aptamer exhibited a high affinity for 8-OHdG. The dissociation constant, K_D, of No. 22 DNA aptamer was on the order of 0.1 μmol/L. This result suggests that using an analogue will be a useful new SELEX method for obtaining various aptamers that are difficult to immobilize on a matrix.     

Simultaneous electrochemical detection of multiple biomarkers using gold nanoparticles decorated multiwall carbon nanotubes as signal enhancers

In this work, a novel sandwich-type electrochemical immunosensor has been developed for simultaneous detection of carcinoembryonic antigen (CEA) and α-fetoprotein (AFP) based on metal ion labels. Gold nanoparticles decorated multiwall carbon nanotubes (AuNPs@MWCNTs) were used as carriers to immobilize secondary antibodies and distinguishable electrochemical tags of Pb²⁺ and Cd²⁺ to amplify the signals. Due to the intrinsic property of high surface-to-volume ratio, the AuNPs@MWCNTs could load numerous secondary antibodies and labels. Therefore, the multiplexed immunoassay exhibited good sensitivity and selectivity. Experimental results revealed that this sandwich-type immunoassay displayed an excellent linear response, with a linear range of 0.01 to 60 ng mL^–1 for both analytes and detection limits of 3.0 pg mL^–1 for CEA and 4.5 pg mL^–1 for AFP (at a signal-to-noise ratio of 3). The method was successfully applied for the determination of AFP and CEA levels in clinical serum samples.     

Isolation and characterization of enantioselective DNA aptamers for ibuprofen

Single stranded DNA aptamers that can bind to ibuprofen, a widely used anti-inflammation drug, were selected from random DNA library of 10¹⁵ nucleotides by FluMag-SELEX process. Five different sequences were selected and their enantioselectivity and affinity were characterized. Three out of five aptamer candidates did not show any affinity to (S)-ibuprofen, but only to racemic form of ibuprofen, suggesting that they are (R)-ibuprofen specific aptamers. Another two aptamer candidates showed affinity to both racemic form and (S)-ibuprofen, which were considered as (S)-ibuprofen specific aptamers. The affinity of five ssDNA aptamers isolated was in a range of 1.5–5.2 μM. In addition, all of these five aptamers did not show any affinity to analogues of ibuprofen in its profen’s group (fenoprofen, flubiprofen, and naproxen) and the antibiotics of oxytetracycline, another control.     

Establishment of a sensitive time-resolved fluoroimmunoassay for detection of Bacillus thuringiensis Cry1Ie toxin based nanobody from a phage display library

Cry1Ie toxin was an insect-resistant protein used in genetically modified crops (GMC). In this study, a large human VH gene nanobodies phage displayed library was employed to select anti-Cry1Ie toxin antibody by affinity panning. After 5 rounds of panning, total 12 positive monoclonal phage particles were obtained. One of the identified positive phage nanobody was expressed in E.coli BL21 and the purified protein was indicated as a molecular mass of approximately 20 kDa by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). Then a sensitive indirect competitive time-resolved fluoroimmunoassay (IC-TRFIA) was established for detection of Cry1Ie toxin by the purified protein. The working range of detection for Cry1Ie toxin standards in the IC-TRFIA were 0.08–6.44 ng mL⁻¹ and the medium inhibition of control (IC₅₀) was 0.73 ng mL⁻¹. It showed a weak cross-reactivity with Cry1Ab toxin (at 5.6%), but did not recognize Cry1B, Cry1C, Cry1F, and Cry2A toxins (were <0.1%). The average recoveries of Cry1Ie toxin from respectively spiked in rice, corn and soil samples were in the range of 83.5%–96.6% and with a coefficient of variation (CV) among 2.0%–8.6%. These results showed the IC-TRFIA was promising for detection of Cry1Ie toxin in agricultural and environmental samples.     

Effects of reduced diameter of bag cultures on content of essential fatty acids and cell density in a continuous algal production system

Cell density and fatty acid (FA) content of Pavlova lutheri and Chaetoceros muelleri were analysed in a continuous algal production system (250-L bags) with reduced diameter. The cell density and FA content and composition in the algal production system were determined in replicate bags over a period of 5 weeks. The results showed that the cell density and essential FAs increased during the experiment for both species. After 5 weeks the mean cell numbers had increased to 6.0 ± 0.3 × 10⁶ cells mL⁻¹ in the P. lutheri bags and 6.0 ± 0.4 × 10⁶ cells mL⁻¹ in the C. muelleri bags. The content of total FAs increased significantly (p < 0.05) in all of the bags during the experiment. At the end of the experiment the mean total FA content were 2.7 ± 0.3 pg cell⁻¹ in the P. lutheri bags and 1.8 ± 0.1 pg cell⁻¹ in the C. muelleri bags. Maximum total FA content registered was 3.0 pg cell⁻¹ in one of the P. lutheri bags. The content of the essential FAs (ARA, EPA, DHA) increased over time in both of the species. At the end of the experiment the content of EPA (0.6 ± 0.1 pg cell⁻¹) and DHA (0.3 ± 0.0 pg cell⁻¹) were highest in the P. lutheri bags, while ARA (0.1 ± 0.0 pg cell⁻¹) was highest in C. muelleri. EPA and DHA constituted 22% and 11%, respectively, of total FA content in P. lutheri, while ARA constituted 6% of total FA content in C. muelleri. The results from this experiment indicate that flagellates such as P. lutheri perform better in narrow bags with improved light conditions, while diatoms like C. muelleri perform better in wider bags under light limitation. Implications for bivalve hatcheries are discussed.     

Electrochemical immunosensor of platelet-derived growth factor with aptamer-primed polymerase amplification

A new method for the determination of platelet-derived growth factor BB (PDGF-BB) was developed using an electrochemical immunosensor with an aptamer-primed, long-strand circular detection probe. Rabbit anti-human PDGF-B polyclonal antibody was immobilized on the electrode to serve as the capture antibody. The detection probe was synthesized via polymerase extension along a single-stranded circular plasmid DNA template with a primer headed by the anti-PDGF-B aptamer. In the presence of the analyte, the aptamer-primed circular probe was captured on the electrode via the formation of an antibody/PDGF-BB/aptamer sandwiched complex. The electroactivity indicator methylene blue was adsorbed on the electrode surface via the analyte-sandwiched complex with long-strand circular DNA, thus yielding a strong electrochemical signal for the quantification of PDGF-BB. This strategy allowed electrochemical detection with enormous signal amplification arising from the long-strand localized circular probe. The oxidation peak current of methylene blue in square wave voltammetric measurements showed a linear dependence on the concentration of PDGF-BB in the range from 50 to 500 ng mL⁻¹, with a detection limit as low as18 pg mL⁻¹.     

Development of a localized surface plasmon resonance-based gold nanobiosensor for the determination of prolactin hormone in human serum

A localized surface plasmon resonance immunoassay has been developed to determine prolactin hormone in human serum samples. Gold nanoparticles were synthesized, and the probe was prepared by electrostatic adsorption of antibody on the surfaces of gold nanoparticles. The pH and the antibody-to-gold nanoparticle ratio, as the factors affecting the probe functions, were optimized. The constructed nanobiosensor was characterized by dynamic light scattering. The sensor was applied for the determination of prolactin antigen concentration based on the amount of localized surface plasmon resonance peak shift. A linear dynamic range of 1–40 ng ml⁻¹, a detection limit of 0.8 ng ml⁻¹, and sensitivity of 10 pg ml⁻¹ were obtained. Finally, the nanobiosensor was applied for the determination of prolactin in human control serum sample.     

Electrochemical immunosensor based on Pd–Au nanoparticles supported on functionalized PDDA-MWCNT nanocomposites for aflatoxin B1 detection

This paper reports a label-free electrochemical immunosensor for the determination of aflatoxin B1 (AFB1), which is based on a gold electrode modified by a biocompatible film of carbon nanotubes/poly(diallyldimethylammoniumchloride)/Pd–Au nanoparticles (CNTs/PDDA/Pd–Au). The nanocomposite was characterized by transmission electron microscopy and the electrochemical behavior of modified electrodes was investigated by cyclic voltammetry. The CNTs/PDDA/Pd–Au nanocomposites film showed good electron transfer ability, which ensured high sensitivity to detect AFB1 in a range from 0.05 to 25 ng mL⁻¹ with a detection limit of 0.03 ng mL⁻¹ obtained at 3σ (where σ is the standard deviation of the blank solution, n = 10). The proposed immunosensor provides a simple tool for AFB1 detection. This strategy can be extended to any other antigen detection by using the corresponding antibodies.     

Gold nanoparticle-based colorimetric detection of kanamycin using a DNA aptamer

A selective kanamycin-binding single-strand DNA (ssDNA) aptamer (TGGGGGTTGAGGCTAAGCCGA) was discovered through in vitro selection using affinity chromatography with kanamycin-immobilized sepharose beads. The selected aptamer has a high affinity for kanamycin and also for kanamycin derivatives such as kanamycin B and tobramycin. The dissociation constants (K_d [kanamycin] = 78.8 nM, K_d [kanamycin B] = 84.5 nM, and K_d [tobramycin] = 103 nM) of the new aptamer were determined by fluorescence intensity analysis using 5′-fluorescein amidite (FAM) modification. Using this aptamer, kanamycin was detected down to 25 nM by the gold nanoparticle-based colorimetric method. Because the designed colorimetric method is simple, easy, and visible to the naked eye, it has advantages that make it useful for the detection of kanamycin. Furthermore, the selected new aptamer has many potential applications as a bioprobe for the detection of kanamycin, kanamycin B, and tobramycin in pharmaceutical preparations and food products.     

Nucleic acid aptamers for capture and detection of Listeria spp

The purpose of this study was to identify biotinylated single-stranded (ss) DNA aptamers with binding specificity to Listeria and use these for capture and subsequent qPCR detection of the organism. For aptamer selection, SELEX (systematic evolution of ligands by exponential enrichment) was applied to a biotin-labeled ssDNA combinatorial library. After multiple rounds of selection and counter-selection, aptamers separated, sequenced, and characterized by flow cytometry showed binding affinities to L. monocytogenes of 18–23%. Although selected for using L. monocytogenes, these aptamers showed similar binding affinity for other members of the Listeria genus and low binding affinity for non-Listeria species. One aptamer, Lbi-17, was chosen for development of a prototype capture and detection assay. When Lbi-17 was conjugated to magnetic beads and used in a combined aptamer magnetic capture (AMC)-qPCR assay, the pathogen could be detected at concentrations <60 CFU/500 μl buffer in the presence of a heterogeneous cocktail of non-Listeria bacterial cells, with a capture efficiency of 26–77%. Parallel experiments using immunomagnetic separation (IMS)-qPCR produced the same detection limit but lower capture efficiency (16–21%). Increasing assay volume to 10 and 50 ml resulted in reduced capture efficiency and higher limits of detection, at 2.7 and 4.8 log₁₀ CFU L. monocytogenes per sample, respectively, for the AMC-qPCR assay. Biotinylated ssDNA aptamers are promising ligands for food-borne pathogen concentration prior to detection using molecular methods.     

Hollow fiber-based liquid phase microextraction with factorial design optimization and gas chromatography–tandem mass spectrometry for determination of cannabinoids in human hair

A new method, based on hollow fiber liquid-phase microextraction (HF-LPME) and gas chromatography–tandem mass spectrometry (GC–MSMS), was developed for determination of Δ⁹-tetrahydrocannabinol (THC), cannabidiol (CBD) and cannabinol (CBN) in samples of human hair. Since hair is a solid matrix, the samples were subjected to alkaline digestion using NaOH. The aqueous solutions obtained were extracted using a 6 cm polypropylene fiber (600 μm i.d., 200 μm wall thickness, 0.2 μm pore size) for each extraction. A 2⁵⁻¹ fractional factorial design for screening, and a central composite design for optimization of significant variables, was applied during development of the extraction method. The variables evaluated were the type of extraction solvent, pH, stirring speed, extraction time, and acceptor phase volume. The optimized conditions for the proposed extraction procedure were 10 mg of hair sample; 20 μL of butyl acetate; aqueous (pH 14) donor phase containing 6.8% NaCl; 600 rpm stirring speed; 20 min extraction time. A linear response was obtained in the ranges 1–500 pg mg⁻¹ (CBD and CBN) and 20–500 pg mg⁻¹ (THC), with regression coefficients >0.99. Precision, determined as the relative standard deviation, was 3.3–8.9% (intra-day) and 4.4–13.7% (inter-day). Absolute recoveries varied in the ranges 4.4–4.8% (CBD), 7.6–8.9% (THC) and 7.7–8.2% (CBN). Limits of detection (LOD, S/N = 3) and quantification (LOQ, S/N = 10) were 0.5–15 pg mg⁻¹ and 1–20 pg mg⁻¹, respectively. The method was successfully used to determine CBD, THC and CBN in hair samples from patients in a drug dependency rehabilitation center. Concentrations varied in the ranges 1–18 pg mg⁻¹ (CBD), 20–232 pg mg⁻¹ (THC) and 9–107 pg mg⁻¹ (CBN), confirming the suitability of the method for monitoring studies.     

Enhanced electrochemiluminescence from luminol at carboxyl graphene for detection of α-fetoprotein

In this study, a novel sensitive electrochemiluminescence (ECL) immunosensor was constructed by carboxyl graphene (GR) for enhancing luminol–O₂ system emission. Here, carboxyl GR was used to enhance the ECL intensity of luminol that had excellent electron transfer ability and good solubility. The sensing platform was constructed by depositing carboxyl GR on electrodes and immobilizing antibodies on the surface of carboxyl GR through amidation. The specific immunoreaction between α-fetoprotein (AFP) and antibodies resulted in a decrease of ECL intensity, and the intensity decreased linearly with AFP concentrations in the range of 5 pg ml⁻¹ to 14 ng ml⁻¹ with a detection limit of 2.0 pg ml⁻¹. The proposed immunosensor exhibits high specificity, good reproducibility, and longtime stability. It may become a promising technique for protein detection.     

Single-Stranded DNA-Binding Protein Complex from Helicobacter pylori Suggests an ssDNA-Binding Surface

Single-stranded DNA (ssDNA)-binding protein (SSB) plays an important role in DNA replication, recombination, and repair. SSB consists of an N-terminal ssDNA-binding domain with an oligonucleotide/oligosaccharide binding fold and a flexible C-terminal tail involved in protein-protein interactions. SSB from Helicobacter pylori (HpSSB) was isolated, and the ssDNA-binding characteristics of HpSSB were analyzed by fluorescence titration and electrophoretic mobility shift assay. Tryptophan fluorescence quenching was measured as 61%, and the calculated cooperative affinity was 5.4 × 10⁷ M^− 1 with an ssDNA-binding length of 25-30 nt. The crystal structure of the C-terminally truncated protein (HpSSBc) in complex with 35-mer ssDNA [HpSSBc-(dT)₃₅] was determined at a resolution of 2.3 Å. The HpSSBc monomer folds as an oligonucleotide/oligosaccharide binding fold with a Y-shaped conformation. The ssDNA wrapped around the HpSSBc tetramer through a continuous binding path comprising five essential aromatic residues and a positively charged surface formed by numerous basic residues.     

A highly sensitive resonance scattering spectral assay for carcinoembryonic antigen using immunonanogold as probe and nanocatalyst of NH2OH�CCu(II) particle reaction

Nanogold of 10 nm was used to label carcinoembryonic antigen antibody (CEAAb) to prepare a probe (Au-CEAAb) for carcinoembryonic antigen (CEA). In a Na₂HPO₄–NaH₂PO₄ buffer solution of pH 6.8, CEA reacted with Au-CEAAb to form a big Au-CEAAb–CEA immunocomplex that can be removed by centrifugation. The unreacted Au-CEAAb in the centrifugal supernatant exhibited catalytic effect on the Cu₂O particle reaction, and the Cu₂O particles displayed a resonance scattering (RS) peak at 602 nm. When CEA increased, the RS intensity at 602 nm decreased, and the decreased RS intensity (ΔI _602 nm) was linear to CEA concentration (C _CEA) in the range of 0.02–12 ng mL⁻¹, with the regression equation of ΔI _602 nm = 27.1 C _CEA + 3.3, correlation coefficient of 0.9978 and detection limit of 3 pg mL⁻¹ CEA. The proposed method was applied to detect CEA in real samples, with satisfactory results.