Cloning of chemically synthesized lactose operators. II. EcoRI-linkered operators.

A 40 base, mainly duplex DNA segment, with the following sequence pAATTCCACATGTGGAATTGTGAGCGGATAACAATTTGTT (3') GGTGTACACCTTAACACTCGCCTATTGTTAAACACCTTAAp (5') has been synthesized by combination of chemical and enzymatic methods. It consists of a wild-type lactose operator sequence (boxed) bracketed by "linker" sequences which permit excision of the segment from plasmid vehicles by the EcoRI restriction endonuclease. This segment has been ligated into the pMB9 plasmid and the resulting operator plasmids used to transform E. coli K-12. Among the transformant products were strains carrying plasmids with one, two, three, or four operator segments in tandem. Derepression of the lactose operon effected by these plasmids in vivo as well as the lifetimes of complexes formed between repressor and these plasmids in vitro increase with increasing numbers of operators per plasmid.     

Enzymatic multiplication of a chemically synthesized DNA fragment.

A synthetic DNA fragment of 19 residues was enlarged by the enzymatic addition of deoxyadenylate residues to its 3'-end with calf thymus terminal deoxynucleotidyl transferase. The 3'-terminus of this elongated DNA strand was blocked with 2', 3'-dideoxyadenylate to prevent hydrolysis by the 3'-exonuclease function of E. coli DNA polymerase I. This elongated and 3'-blocked fragment was annealed to an oligomeric primer and used as a template for the synthesis of a complementary copy of the synthetic 19-mer. The product of such a repair synthesis was separated by gel filtration and analyzed by nearest neighbor techniques. All template strands were copied with complete repair in over 90% of the chains. Facile recovery of the elongated template by virtue of its size permitted repetition of the copy process, thus allowing accumulation of the desired strand.     

Forssmann antigenicity of chemically synthesized globopentaose

The Forssman antigenicity of a chemically synthesized globopentaose was studied. Globobentaose at 40 ng showed strong inhibitory activity for the formation of a precipitin line between globopentaosylceramide (Forssman glycolipid) and anit-Forssmann rabbit antiserum, while much more pentasaccharide (7 and 100 μg, respectively) was required to inhibit a 50% quantitative precipitin reaction and a hemolysis reaction. An immune complex of the ³H-labeled globopentaose with anti-Forssman antibody was hardly formed. Thus, the chemically synthesized globopentaose possesses the same antigenic specificity as globopentaosylceramide but it is difficult to achieve a stable complex with Forssman antibody.     

Forssman antigenicity of chemically synthesized globopentaose

The Forssman antigenicity of a chemically synthesized globopentaose was studied. Globopentaose at 40 ng showed strong inhibitory activity for the formation of a precipitin line between globopentaosylceramide (Forssman glycolipid) and anti-Forssman rabbit antiserum, while much more pentasaccharide (7 and 100 micrograms, respectively) was required to inhibit a 50% quantitative precipitin reaction and a hemolysis reaction. An immune complex of the 3H-labeled globopentaose with anti-Forssman antibody was hardly formed. Thus, the chemically synthesized globopentaose possesses the same antigenic specificity as globopentaosylceramide but it is difficult to achieve a stable complex with Forssman antibody.     

A comprehensive list of chemically synthesized genes

A databank for chemically synthesized genes has been compiled.     

Reconstitution of chemically synthesized ribooligonucleotides with naturally occurring tRNA fragments.

Chemically synthesized yeast tRNA terminal fragments were reconstituted with natural tRNA fragments which were obtained by partial digestion with RNase T1. The synthetic 3'-nonanucleotide (I) accepted alanine (3% with respect to the intact tRNA) when combined with a 4-fold excess of the natural 5'-quarter and the chemically synthesized hexanucleotide (II) stimulated the aminoacylation of the natural 3'-half molecule.     

Chemotactic response of Escherichia coli to chemically synthesized amino acids.

In Escherichia coli, seven of the commonly occurring amino acids are strong attractants: L-aspartate, L-serine, L-glutamate, L-alanine, L-asparagine, glycine, and L-cysteine, in order of decreasing effectiveness. The chemotactic response to each amino acid attractant is mediated by either methyl-accepting chemotaxis protein I or II, but not by both. Seven of the commonly occurring amino acids are repellents. This work was carried out with chemically synthesized amino acids.     

Expression of chemically synthesized alpha-neo-endorphin gene fused to E. coli alkaline phosphatase.

An alpha-neo-endorphin (alpha NE) gene, which we previously synthesized chemically and inserted into E. coli beta-galactosidase gene of pK013 plasmid, has been excised and fused to E. coli alkaline phosphatase (APase) gene. One of the transformants was named E15/pA alpha NE1. Under the APase gene regulation, APase-alpha NE chimeric protein was expressed at 1.3 X 10(6) molecules per cell, and accounted for about 60% of total cellular proteins. The HPLC pattern of CNBr treated E15/pA alpha NE1 was very simple reflecting the high content of the chimeric protein and low numbers of methionine residues in it. A series of genes encoding APase-alpha NE chimeric proteins in which 30 to 94 C-terminal amino acid residues were replaced by (met)-alpha NE, was cloned in E. coli. Transportation of the chimeric proteins to periplasmic space was studied. All chimeric proteins were apparently processed by signal peptidase but few, if any, was transported to the periplasmic space.     

Cloning and characterization of the natural lactose operator

A 55-bp DNA segment carrying the wild-type lactose operator sequence has been cloned. Its sequence is: (Formula: see text). With the exceptions of the bases at positions 19 and 41, 26 and 34, and 28 and 32, the sequence is a perfect inverted repeat about base pair 30. This segment was obtained from the wild-type lactose promoter and operator region of lambda h80dlac phage DNA by a combination of in vitro and in vivo steps. Up to four direct-repeat copies of this segment have been cloned in plasmid pMB9 and pBR325. Repressor affinity for this 55-bp fragment does not differ significantly from that for a 40-bp synthetic operator fragment cloned previously, even though the 55-bp fragment contains the complete set of sequence symmetries associated with the natural operator, whereas the 40-bp fragment does not. An improved procedure for operator purification is described: this was used to prepare 14 mg of the 55-bp fragment over a 2-month period.     

On-resin biotinylation of chemically synthesized proteins for one-step purification

A general, convenient, one-step purification procedure for chemically synthesized proteins present in low yields using on-resin biotinylation is reported. The protein, terminally deprotected and neutralized on-resin, is stirred in dimethylformamide and then biotinylated with N-hydroxysuccinimidobiotin (2 mg/mg protein on-resin) for 24 h at 45 degrees C. Following low/high hydrogen fluoride cleavage (J. P. Tam, W. F. Heath, and R. B. Merrifield (1983) J. Amer. Chem. Soc. 105, 6442-6455) the crude cleavage product was applied to an avidin agarose column. The column was washed with phosphate-buffered saline until all unbound materials had been eluted off. Then the biotinylated protein was eluted with 0.1 M glycine HCl, pH 2.0. A pilot experiment with two unrelated peptides on-resin established the experimental conditions for biotinylation. We then demonstrated that the chemically synthesized 153 residue [Asp205]-interleukin-1 beta (117-269), present in less than 1% yield in the crude HF cleavage mixture, could be purified to homogeneity in one step. In addition 70 and 114 residue synthetic fragments, (200-269) and (156-269), were also purified in this manner. Biotinylation on-resin appears to be an attractive method of purifying low yield chemically synthesized proteins and for preparing proteins with biotinyl moieties at specific locations such as the amino terminus.     

DNA binding properties of a chemically synthesized DNA binding domain of hRFX1.

The RFX DNA binding domain (DBD) is a novel highly conserved motif belonging to a large number of dimeric DNA binding proteins which have diverse regulatory functions in eukaryotic organisms, ranging from yeasts to human. To characterize this novel motif, solid phase synthesis of a 76mer polypeptide corresponding to the DBD of human hRFX1 (hRFX1/DBD), a prototypical member of the RFX family, has been optimized to yield large quantities (approximately 90 mg) of pure compound. Preliminary two-dimensional1H NMR experiments suggested the presence of helical regions in this sequence in agreement with previously reported secondary structure predictions. In gel mobility shift assays, this synthetic peptide was shown to bind in a cooperative manner the 23mer duplex oligodeoxynucleotide corresponding to the binding site of hRFX1, with a 2:1 stoichoimetry due to an inverse repeat present in the 23mer. The stoichiometry of this complex was reduced to 1:1 by decreasing the length of the DNA sequence to a 13mer oligonucleotide containing a single half-site. Surface plasmon resonance measurements were achieved using this 5'-biotylinated 13mer oligonucleotide immobilized on an avidin-coated sensor chip. Using this method an association constant (K a = 4 x 10(5)/M/s), a dissociation constant (K d = 6 x 10(-2)/s) and an equilibrium dissociation constant (K D = 153 nM) were determined for binding of hRFX1/DBD to the double-stranded 13mer oligonucleotide. In the presence of hRFX1/DBD the melting temperature of the 13mer DNA was increased by 16 degreesC, illustrating stabilization of the double-stranded conformation induced by the peptide.     

Stable enzyme biosensors based on chemically synthesized Au-polypyrrole nanocomposites

This work describes development and optimization of a generic method for the immobilization of enzymes in chemically synthesized gold polypyrrole (Au-PPy) nanocomposite and their application in amperometric biosensors. Three enzyme systems have been used as model examples: cytochrome c, glucose oxidase and polyphenol oxidase. The synthesis and deposition of the nanocomposite was first optimized onto a glassy carbon electrode (GCE) and then, the optimum procedure was used for enzyme immobilization and subsequent fabrication of glucose and phenol biosensors. The resulting nanostructured polymer strongly adheres to the surface of the GCE electrode, has uniform distribution and is very stable. The method has proved to be an effective way for stable enzyme attachment while the presence of gold nanoparticles provides enhanced electrochemical activity; it needs very small amounts of pyrrole and enzyme and the Au-PPy matrix avoids enzyme leaking. The preparation conditions, Michaelis-Menten kinetics and analytical performance characteristics of the two biosensors are discussed. Optimization of the experimental parameters was performed with regard to pyrrole concentration, enzyme amount, pH and operating potential. These biosensors resulted in rapid, simple, and accurate measurement of glucose and phenol with high sensitivities (1.089 mA/M glucose and 497.1 mA/M phenol), low detection limits (2 x 10(-6)M glucose and 3 x 10(-8)M phenol) and fast response times (less than 10s). The biosensors showed an excellent operational stability (at least 100 assays) and reproducibility (R.S.D. of 1.36%).     

Expression in Escherichia coli of chemically synthesized gene for the human immune interferon.

A 454 base pair fragment of double stranded DNA consisting of a gene for a human immune interferon (hIFN-gamma), initiation and termination signals plus appropriate restriction endonuclease sites, was totally synthesized. The synthesis involved preparation of 62 oligodeoxyribonucleotides by rapid, solid phase procedures, and enzymatic ligation of the oligonucleotides. This synthetic gene was expressed in E. coli under the control of the lac UV5 promoter. The product has antiviral activity which was acid labile and completely neutralized by antiserum to hIFN-gamma but not by antiserum to hIFN-alpha or hIFN-beta. Molecular weight of hIFN-gamma produced by E. coli was estimated to be about 32,000 and 17,000 by gel filtration and SDS-polyacrylamide gel electrophoresis respectively.     

Studies towards the development of chemically synthesized non-radioactive biotinylated nucleic acid hybridization probes.

Non-radioactive nucleic acid hybridization probes have been constructed in which the reporter group is long chain biotin chemically linked to a basic macromolecule (histone H1, cytochrome C or polyethyleneimine). The modified basic macromolecule which carries many biotin residues can, in turn, be covalently linked to nucleic acids (DNA) via the bifunctional cross-linking reagents, glutaraldehyde, 1,2,7,8-diepoxyoctane, bis (succinimidyl) suberate or bis (sulfonosuccinimidyl) suberate. This provides a very sensitive probe by which as little as between 10-50fg of target DNA can be visualized using dot-blot hybridization procedures in conjunction with avidin or streptavidin enzyme conjugates.     

Cloning of chicken lysozyme structural gene sequences synthesized in vitro.

Double-stranded chicken lysozyme cDNA was synthesized from an oviduct mRNA fraction enriched for lysozyme mRNA. The ds-cDNA was inserted into the BamHI site of plasmid pBR322 using chemically synthesized DNA linker molecules containing the BamHI restriction endonuclease cleavage site. After bacterial transformation, colonies carrying lysozyme DNA were identified by hybridization with highly purified lysozyme cDNA. The 555 base pairs long cloned DNA fragment of one recombinant plasmid was isolated and characterized by restriction endonuclease digestion. The DNA sequence of selected parts of the inserted DNA is as predicted from the amino acid sequence of prelysozyme. The sequence data allows the unambiguous location of the coding region within lysozyme mRNA.