共查询到20条相似文献,搜索用时 42 毫秒
1.
George J. Thomas 《Biopolymers》1969,7(3):325-334
A method is described for determining the fractions of adenine-uracil and guanine-cytosine base pairs of partly double-helical ribonucleic acids in aqueous solution. The method is based upon the ability to distinguish between paired and unpaired bases by means of infrared spectroscopy of their deuterium oxide solutions in the 1500–1800 cm?1 frequency region of the infrared spectrum. An application of the method to yeast ribosomal RNA is described. At 30°C, ribosomal RNA is 64± 6% paired (35% GC, 29% AU). The method can be applied to determine the fractions of Watson-Crick base pairs at a given temperature in any RNA containing the four common bases in known ratios. 相似文献
2.
Magnetic material in the body parts of the stingless bee Schwarziana quadripunctata, heads, pairs of antennae, thorax and abdomens, were investigated by SQUID magnetometry and Ferromagnetic Resonance (FMR).
The saturation, Js and remanent, Jr, magnetizations and coercive field Hc are determined from the hysteresis curves. From Hc and Jr/Js the magnetic particle sizes are estimated. The Js and the FMR spectral absorption areas yield 23±3%, 45±5%, 15±2% and 19±4% magnetic material contributions of head, pair of
antennae, thorax and abdomen, respectively, similar to those observed in the migratory ant Pachycondyla marginata. This result is discussed in light of the hypothesis of antennae as a magnetosensor structure. 相似文献
3.
Slawomir Tubek 《Biological trace element research》2001,83(1):31-38
Zinc absorption from the alimentary tract, as revealed by serum zinc concentration, was studied in a group of 10 patients
(age 37.7±5.1 yr) with moderate and severe untreated primary arterial hypertension before and after a 30-d treatment with
perindopril 4 mg/d. Blood pressure was 177.33±16.24/111.33±15.26 mm Hg before and 143.41±17.34/91.29±12.54 mm Hg after treatment
(p<0.05/p<0.05). Nine persons (age 37±6.2 yr) with normal blood pressure (121.33±9.9/78±5.23 mm Hg) were the control group. Blood samples
were taken from the ulnar vein at 8.00 am (0 h), before taking zinc orally (one tablet of Zincas (zinc aspartate), containing 5 mg Zn2+) and at 1, 3, and 6 h after the dose. Serum zinc concentration in control and hypertensive group (before treatment) were
initially 15.47±6.26 versus 15.99±5.65 (NS), 19.37±6.40 versus 20.83±4.48 (NS) after 1 h, 17.91±4.76 versus 31.32±10.49 (p<0.003) after 3 h, and 15.32±5.47 versus 17.87±6.56 (NS) after 6 h. Maximal increase of Zn was 4.77±2.10 versus 17.53±4.13,
respectively (p<0.001). In the hypertensive group, serum Zn before and after perindopril treatment was initially 15.98±5.65 versus 14.81±3.11
(NS), 20.83±4.48 versus 18.17±2.50 (NS) after 1 h, 31.32±10.49 versus 22.94±5.80 (NS) after 3 h, 17.53±4.13 (p<0.001) after 6 h. Maximal increase of Zn before treatment was 17.53±4.13 versus 9.17±4.67 (p<0.017) after treatment. The following conclusions were reached: (1) In patients with primary arterial hypertension, an increased
zinc absorption from alimentary tract was found; (2) A 30-d perindopril treatment 4 mg/d orally decreased zinc absorption
in these patients. 相似文献
4.
Abstract The RNA PK5 (GCGAUUUCUGACCGCUUUUUUGUCAG) forms a pseudoknotted structure at low temperatures and a hairpin containing an A · C opposition at higher temperatures (J. Mol. Biol. 214, 455–470 (1990)). CD and absorption spectra of PK5 were measured at several temperatures. A basis set of spectra were fit to the spectra of PK5 using a method that can provide estimates of the numbers of A · U, G · C, and G · U base pairs as well as the number of each of 11 nearest-neighbor base pairs in an RNA (Biopolymers 31, 373–384 (1991)). The fits were close, indicating that PK5 retained the A conformation in the pseudoknot structure and that the fitting technique is not hindered by pseudoknots or A · C oppositions. The results from the analysis were consistent with the pseudoknotted structure at low temperatures and with the hairpin structure at higher temperatures. We concluded that the method of spectral analysis should be useful for determining the secondary structures of other RNAs containing pseudoknots and A · C oppositions. 相似文献
5.
The free solution mobility of DNA has been measured by capillary electrophoresis in the two buffers most commonly used for DNA gel electrophoresis, Tris-borate-EDTA (TBE) and Tris-acetate-EDTA (TAE). The capillaries were coated with polymers of either of two novel acrylamide monomers, N-acryloylaminoethoxyethanol or N-acryloylaminopropanol, both of which are stable at basic pH and effectively eliminate the electroendosmotic mobility due to the capillary walls. The free solution mobility of DNA in TAE buffer was found to be (3.75 ± 0.04) × 10−4 cm2 V−1 s−1 at 25°C, independent of DNA concentration, sample size, electric field strength, and capillary coating, and in good agreement with other values in the literature. The free solution mobility was independent of DNA molecular weight from ∼ 400 base pairs to 48.5 kilobase pairs, but decreased monotonically with decreasing molecular weight for smaller fragments. Surprisingly, the free solution mobility of DNA in TBE buffer was found to be (4.5 ± 0.1) × 10−4 cm2 V−1 s−1, about 20% larger than observed in TAE buffer, presumably because of the formation of nonspecific borate-deoxyribose complexes. © 1997 John Wiley & Sons, Inc. Biopoly 42: 687–703, 1997 相似文献
6.
Johannes H Ippel Virginia Lanzotti Aldo Galeone Luciano Mayol Jaquelien E van den Boogaart Jeroen A Pikkemaat Cornelis Altonaf 《Biopolymers》1995,36(6):701-710
The conformational behavior of DNA minihairpin loops is sensitive to the directionality of the base pair that closes the loop. Especially tailored circular dumbbells, consisting of a stem of three Watson–Crick base pairs capped on each side with a minihairpin loop, serve as excellent model compounds by means of which deeper insight is gained into the relative stability and melting properties of hairpin loops that differ only in directionality of the closing pair: C-G vs G-C. For this reason the thermodynamic properties of the circular DNA decamers 5′-d〈pCGC-TT-GCG-TT〉-3′( I ) and reference compounds 5′-d〈pGGC-TT-GCC-TT≤-3′( II ) and 5′-d(GCG-TC-CGC)-3′( III ) are studied by means of nmr spectroscopy. Molecules I and II adopt dumbbell structures closed on both sides by a two-membered hairpin hop. At low temperature I consists of a mixture of two slowly exchanging forms, denoted L2L2 and L2L4 . The low-temperature L2L2 form is the fully intact minihairpin structure with three Watson–Crick C-G base pairs. The high-temperature form, L2L4 ,contains a partially disrupted closing G-C base pair in the 5′-GTTC-3′ loop, with the cytosine base placed in a syn orientation. The opposite 5′-CTTG-3′ loop remains stable. A study of the noncircular hairpin structure III shows similar conformational behavior for the 5′-GTTC-3′ loop as found in I a syn orientation for C(6) and two slowly exchanging imino proton signals for G(3). The melting point Tm of II was estimated to lie above 365 K. The Tm value of the duplex stem and the 5′-CTTG-3′ loop of the L2L4 form ofIis 352 ± 2 K. The ΔH° is calculated as ?89 ± 10 kJ/mol. The Tm value determined for the individual residues of the 5′-GTTC-3′ loop lies 4°–11° lower. The enthalpy ΔH° of melting the thymine residues in the 5′-GTTC-3′ loop is calculated to be -61± 7 kJ/mol. Thermodynamic data of the equilibrium between the slowly exchanging two- and four-membered loop conformers of I reveal an upper limit for ΔH° of +30 kJ/mol in going from a two-memberedto a four-membered loop, in agreement with the enthalpy difference of +28 k.j/mol between the two loops at the Tm midpoint. For hairpin III the upper limit for ΔH° going from a two-membered to a four-membered loop amounts to ±21 kJ/mol. The mutual exchange rate between the L2 and L4 form in III is estimated as 13.6 s?1. Our results clearly suggest that small four-way DNA junctions(model for immobilized Holliday junctions) can be designed that consist of a single DNA strandthat features -CTTG-caps on three of the four arms of the junction. © 1995 John Wiley & Sons, Inc. 相似文献
7.
Dinshaw J. Patel 《Biopolymers》1977,16(8):1635-1656
We have monitored the helix-coil transition of the self-complementary d-CpCpGpG and d-GpGpCpC sequences (20mM strand concentration) at the base pairs, sugar rings, and backbone phosphates by 360-MHz proton and 145.7-MHz phosphorus nmr spectroscopy in 0.1M phosphate solution between 5 and 95°C. The guanine 1-imino Watson-Crick hydrogen-bonded protons, characteristic of the duplex state, are observed below 10°C, with solvent exchange occurring by transient opening of the tetranucleotide duplexes. The cytosine 4-amino Watson-Crick hydrogen-bonded protons resonate 1.5 ppm downfield from the exposed protons at the same position in the tetranucleotide duplexes, with slow exchange indicative of restricted rotation about the C-N bond below 15°C. The guanine 2-amino exchangeable protons in the tetranucleotide sequence exhibit very broad resonances at low temperatures and narrow average resonances above 20°C, corresponding to intermediate and fast rotation about the C-N bond, respectively. Solvent exchange is slower at the amino protons compared to the imino protons since the latter broaden out above 10°C. The well-resolved nonexchangeable base proton chemical shifts exhibit helix-coil transition midpoints between 37 and 42°C. The transition midpoints and the temperature dependence of the chemical shifts at low temperatures were utilized to differentiate between resonances located at the terminal and internal base pairs while the H-5 and H-6 doublets of individual cytosines were related by spin decoupling studies. For each tetranucleotide duplex, the cytosine H-5 resonances exhibit the largest chemical shift change associated with the helix-coil transition, a result predicted from calculations based on nearest-neighbor atomic diamagnetic anisotropy and ring current contributions for a B-DNA duplex. There is reasonable agreement between experimental and calculated chemical shift changes for the helix-coil transition at the internal base pairs but the experimental shifts exceed the calculated values at the terminal base pairs due to end-to-end aggregation at low temperatures. Since the guanine H-8 resonances of the CpCpGpG and d-CpCpGpG sequences exhibit upfield shifts of 0.6–0.8 and <0.1 ppm, respectively, on duplex formation, these RNA and DNA tetranucleotides with the same sequence must adopt different base-pair overlap geometries. The large chemical shift changes associated with duplex formation at the sugar H-1′ triplets are not detected at the other sugar protons and emphasize the contribution of the attached base at the 1′ position. The coupling sum between the H-1′ and the H-2′ and H-2″ protons equals 15–17 Hz at all four sugar rings for the d-CpCpGpG and d-GpGpCpC duplexes (25°C), consistent with a C-3′ exo sugar ring pucker for the deoxytetranucleotides in solution. The temperature dependent phosphate chemical shifts monitor changes in the ω,ω′ angles about the O-P backbone bonds, in contrast to the base-pair proton chemical shifts, which monitor stacking interactions. 相似文献
8.
Objective : Few weight loss supplements are clinically tested for efficacy, yet their proliferation continues. Chitosan‐based supplements are sold as fat trappers and fat magnets. They purportedly block fat absorption and cause weight loss without food restriction. We quantified the in vivo effect of a chitosan product on fat absorption. Research Methods and Procedures : Participants (n = 15) consumed five meals per day for 12 days. Energy intake was not restricted. Participants consumed no supplements during a 4‐day control period and two capsules five times per day (4.5 g chitosan/d), 30 minutes before each meal, during a 4‐day supplement period. All feces were collected from days 2 to 12. Oral charcoal markers permitted division of the feces into two periods. The two fecal pools were analyzed for fat content. Results : Participants were male, 26.3 ± 5.9 years old, BMI of 25.6 ± 2.3 kg/m2. Subjects consumed 133 ± 23 g of fat/d and 12.91 ± 1.79 MJ/d (3084 ± 427 kcal/d). Individual meals averaged 26.3 ± 9.3 g of fat. With chitosan supplementation at 10 capsules/day, fecal fat excretion increased by 1.1 ± 1.8 g/d (p = 0.02), from 6.1 ± 1.2 to 7.2 ± 1.8 g/d. Discussion : The effect of chitosan on fat absorption is clinically negligible. Far from being a fat trapper, at 0.11 ± 0.18 g of fat trapped per 0.45‐g capsule or 1.1 g (9.9 kcal) fat trapped per day, this product would have no significant effect on energy balance. The fat trapping claims associated with chitosan are unsubstantiated. 相似文献
9.
Helix-coil dynamics of a Z-helix hairpin 总被引:1,自引:0,他引:1
The helix–coil transition of a Z-helix hairpin formed from d(C-G)5T4(C-G)5 has been characterized by equilibrium melting and temperature jump experiments in 5M NaClO4 and 10 mM Na2HPO4, pH 7.0. The melting curve can be represented by a simple all-or-none transition with a midpoint at 81.6 ± 0.4°C and an enthalpy change of 287 ± 15 kJ/mole. The temperature jump relaxation can be described by single exponentials at a reasonable accuracy. Amplitudes measured as a function of temperature provide equilibrium parameters consistent with those derived from equilibrium melting curves. The rate constants of Z-helix formation are found in the range from 1800 s?1 at 70°C to 800 s?1 at 90°C and are associated with an activation enthalpy of ?(50 ± 10) kJ/mole, whereas the rate constants of helix dissociation are found in the range from 200 s?1 at 70°C to 4500 s?1 at 90°C with an activation enthalpy +235 kJ/mole. These parameters are consistent with a requirement of 3–4 base pairs for helix nucleation. Apparently nucleation occurs in the Z-helix conformation, because a separate slow step corresponding to a B to Z transition has not been observed. In summary, the dynamics of the Z-helix–coil transition is very similar to that of previously investigated right-handed double helices. 相似文献
10.
Karsten Rippe Niels B. Ramsing Reinhard Klement Thomas M. Jovin 《Journal of biomolecular structure & dynamics》2013,31(6):1199-1209
Abstract DNA oligonucleotides with appropriately designed complementary sequences can form a duplex in which the two strands are paired in a parallel orientation and not in the conventional antiparallel double helix of B-DNA. All parallel stranded (ps) molecules reported to date have consisted exclusively of dA · dT base pairs. We have substituted four dA · dT base pairs of a 25-nt parallel stranded linear duplex (ps-D1 · D2) with dG · dC base pairs. The two strands still adopt a duplex structure with the characteristic spectroscopic properties of the ps conformation but with a reduced thermodynamic stability. Thus, the melting temperature of the ps duplex with four dG · dC base pairs (ps-D5 · D6) is 10-16°C lower and the van't Hoff enthalpy difference ΔvH for the helix-coil transition is reduced by 20% (in NaCl) and 10% (in MgCl2) compared to that of ps-Dl · D2. Based on energy minimizations of a ps-[d(T5GA5) · d(A5CT5)] duplex using force field calculations we propose a model for the conformation of a trans dG · dC base pair in a ps helix. 相似文献
11.
Jennifer L. Zangmeister Mark F. Haussmann Jack Cerchiara Robert A. Mauck 《Journal of Field Ornithology》2009,80(4):373-379
ABSTRACT The nocturnal activity of burrow‐nesting seabirds, such as storm‐petrels and shearwaters, makes it difficult to study their incubation behavior. In particular, little is known about possible differences in the incubation behavior of adults at successful and unsuccessful nests. We combined the use of passive integrated transponder (PIT) technology and nest‐temperature data loggers to monitor the incubation behavior of 10 pairs of Leach's Storm‐Petrels (Oceanodroma leucorhoa). The mean incubation bout length was 3.31 ± 0.59 (SD) days for individual adults at successful nests (N= 4) and 1.84 ± 1.16 d for individuals at unsuccessful nests (N= 6). Mean bout length for pairs in successful burrows (3.51 ± 0.56 d) did not differ significantly (P= 0.07) from that for pairs in unsuccessful burrows (1.80 ± 1.20 d), perhaps due to one failed nest with a high mean bout length (4.15 d). The total number of incubation bouts per parent (4.3 ± 1.9 bouts) did not differ with hatching success. Adults whose nests failed repeatedly exhibited truncated incubation bouts (< 12 h) prior to complete nest failure and were more likely than successful parents to make brief visits to nearby, occupied nesting burrows. Our results suggest that the decision by Leach's Storm‐Petrels to abandon a nest is not an abrupt one. Rather, failed nesting attempts may be characterized by truncated incubation bouts where individuals pay the energetic cost of travel to and from the burrow, but do not remain long enough to successfully incubate the egg. 相似文献
12.
Barbara Manconi Chiara Fanali Tiziana Cabras Rosanna Inzitari Maria Patamia Emanuele Scarano Antonella Fiorita Alberto Vitali Massimo Castagnola Irene Messana Maria Teresa Sanna 《Journal of peptide science》2010,16(6):269-275
This study describes the identification and structural characterization of Sus scrofa statherin. HPLC–electrospray ionization mass spectrometry analysis on pig parotid secretory granule extracts evidenced a peptide with a molecular mass value of 5381.1 ± 0.6 Da and its truncated form, devoid of the C‐terminal Ala residue, with a molecular mass value of 5310.1 ± 0.6 Da. The complete sequence of pig statherin gene was determined by sequencing the full‐length cDNA obtained by rapid amplification of cDNA ends. The gene is 549 base pairs long and contains an open reading frame of 185 nucleotides, encoding a 42‐amino acid secretory polypeptide with a signal peptide of 19 residues. This sequence presents some typical features of the four statherins characterized till now, showing the highest degree of amino acid identity with bovine (57%) and human statherin (39%). Pig statherin is mono‐phoshorylated on Ser‐3, while primate statherins already characterized are di‐phosphorylated on Ser‐2 and Ser‐3. This difference, probably connected to the Asp‐4 → Glu substitution, suggests the involvement of the Golgi‐casein kinase, which strictly recognizes the SX(E/pS) consensus sequence. Copyright © 2010 European Peptide Society and John Wiley & Sons, Ltd. 相似文献
13.
Transient electric birefringence measurements of the rotational diffusion constant of five short restriction fragments of the plasmid pBR322 show that the hydrodynamic length is independent of sodium ion concentration in the range of 0.2 to 2.5 mM. The fragments are too stiff to be modeled as wormlike molecules. The rotational relaxation times of the fragments, which range from 64 to 124 base pairs, have been used to calculate the rise per base pair using six different theoretical expressions for the length dependence of the rotational diffusion coefficient of straight cylinder. The best estimate for the rise per base pair of Na-DNA in solution is 3.3 ± 0.1 Å. 相似文献
14.
Vigen G. Barkhudaryan Gayane V. Ananyan Yeva B. Dalyan 《Journal of biomolecular structure & dynamics》2013,31(1)
The influence of water-soluble cationic meso-tetra-(4?N-oxyethylpyridyl)porphyrin (H2TOEPyP4) and it’s metallocomplexes with Ni, Cu, Co, and Zn on hydrodynamic and spectral behavior of DNA solutions has been studied by UV/Vis absorption and viscosity measurement. It was shown that the presence of planar porphyrins such as H2TOEPyP4, NiTOEPyP4, and СuTOEPyP4 leads to an increase in viscosity at relatively small concentrations, and then decrease to stable values. Such behavior is explained by intercalation of these porphyrins in DNA structure because the intercalation mode involves the insertion of a planar molecule between DNA base pairs which results in a decrease in the DNA helical twist and lengthening of the DNA. Further decrease of viscosity is explained by the saturation intercalation sites and occurs outside the binding mode. But, in the case of porphyrins with axial ligands such as CoTOEPyP4 and ZnTOEPyP4, the hydrodynamic parameters decrease, which is explained by self-stacking of these porphyrins in DNA surface. This data are proved by spectral measurements. The results obtained from titration experiments were used for calculation of binding parameters: the binding constant K b and the number of binding sites per base pair n. Obtained data reveal that K b varies between 3.4 and 5.4?×?106?M?1 for a planar porphyrins, a range typical for intercalation mode interactions, and 5.6?×?105?M?1 and 1.8?×?106?M?1 for axial porphyrins. In addition, the exclusion parameter n also testifies that at intercalation, (n~2) the adjacent base pairs are removed to place the planar molecules, and for outside binders to pack on the surface needs too few places (n~0.5–1). It is apparent that the binding is somewhat stronger at intercalation. The viscometric and spectrophotometric measurements are in good agreement. 相似文献
15.
The light-induced difference absorption spectra associated to the photo-accumulation of reduced pheophytin a were studied in the isolated D1–D2–Cyt b559 complex in the presence of variable methyl viologen concentrations and different illumination conditions under anaerobiosis.
Depending on the methyl viologen/reaction centre ratio, the relative intensities of the spectral bands at 681.5±0.5, 667.0±0.5
and 542.5±0.5 nm were modified. The reduced pheophytin a located at the D1-branch of the complex absorbs at 681.7±0.5 nm, and at least two additional pigment species contribute to
the Qy band of the difference absorption spectra with maxima at 667.0±0.5 and 680.5±0.5 nm. We propose the additional species correspond
to a peripheral chlorophyll a and the pheophytin a located at the D2-branch of the complex, respectively. The blue absorbing chlorophyll at 667 nm is susceptible to chemical
redox changes with a midpoint reduction potential of +470 mV. The Qx absorption bands of both pheophytins localised at the D2- and D1-branch of the D1–D2–Cyt b559 complex were at 540.7±0.5 and 542.9±0.5, respectively. The results indicated that the two pheophytin molecules can be
photoreduced in the D1–D2–Cyt b559 complex in certain experimental conditions.
This revised version was published online in June 2006 with corrections to the Cover Date. 相似文献
16.
Sequence and conformational effects on imino proton exchange in A.T- and A.U-containing DNA and RNA duplexes 总被引:2,自引:0,他引:2
1H-nmr relaxation has been used to study the effect of sequence and conformation on imino proton exchange in adenine–thymine (A · T) and adenine–uracil (A · U) containing DNA and RNA duplexes. At low temperature, relaxation is caused by dipolar interactions between the imino and the adenine amino and AH2 protons, and at higher temperature, by exchange with the solvent protons. Although room temperature exchange rates vary between 3 and 12s?1, the exchange activation energies (Eα) are insensitive to changes in the duplex sequence (alternating vs homopolymer duplexes), the conformation (B-form DNA vs A-form RNA), and the identity of the pyrimidine base (thymine vs uracil). The average value of the activation energy for the five duplexes studied, poly[d(A-T)], poly[d(A) · d(T)], poly[d(A-U)], Poly[d(A) · d(U)], and poly[r(A) · r(U)], was 16.8 ± 1.3 kcal/mol. In addition, we find that the average Eα for the A.T base pairs in a 43-base-pair restriction fragment is 16.4 ± 1.0 kcal/mol. This result is to be contrasted with the observation that the Eα of cytosine-containing duplexes depends on the sequence, conformation, and substituent groups on the purine and pyrimidine bases. Taken together, the data indicate that there is a common low-energy pathway for the escape of the thymine (uracil) imino protons from the double helix. The absolute values of the exchange rates in the simple sequence polymers are typically 3–10 times faster than in DNAs containing both A · T and G · C base pairs. 相似文献
17.
Isatin-3-isonicotinylhydrazone was synthesized and characterized. The interaction of native calf thymus DNA with isatin-3-isonicotinylhydrazone
(IINH) in 10 mM Tris–HCl aqueous solutions at neutral pH 7.4 has been investigated by spectrophotometric, circular dichroism
(CD), melting temperature (T
m
), spectrofluorimetric, and viscometric techniques. It is found that IINH molecules could intercalate between base pairs of
DNA as are evidenced by: hypochromism in UV absorption band of IINH, induced CD spectral changes, sharp increase in specific
viscosity of DNA, and increase in the fluorescence of methylene blue (MB)-DNA solutions in the presence of increasing amounts
of IINH, which indicates that it is able to release the intercalated MB completely. The binding constants of IINH–DNA complex
at four different temperatures (277, 288, 298, and 310 K) were calculated to be 4.7 × 104, 2.2 × 104, 1.75 × 104 and 1.1 × 104 M−1, respectively. Furthermore, the enthalpy and entropy of the reaction between IINH and CT-DNA showed that the reaction is
enthalpy-favored and entropy- disfavored (∆H = −30.187 kJ mol−1; ∆S = −20.46 J mol−1K−1) which are other evidences to indicate the IINH is able to be intercalated in the DNA base pairs. 相似文献
18.
Helix-coil transition in nucleoprotein: renaturation of polylysine-DNA and polylysine-nucleohistone complexes 总被引:3,自引:0,他引:3
Thermal denaturation and renaturation of directly mixed and reconstituted polylysine–DNA, directly mixed polylysine–nucleohistone complexes, and NaCl-treated nucleohistones in 2.5 × 10?4 M EDTA, pH 8.0 have been studied. At the same input ratio of polylysine to DNA, the percent of renaturation of free base pairs in a directly mixed polylysine–DNA complex is higher than that in a reconstituted complex. For a directly mixed complex, the renaturation of free base pairs is proportional to the fraction of DNA bound by polylysine or inversely proportional to the sizes of free DNA loops. A of large amount of renaturation of free base pairs has also been observed for 0.6 M and 1.6 M NaCl-treated nucleohistones. The binding of polylysine to nucleohistone enhances the renaturation of histone-bound base pairs. The percent of renaturation of polylysine–bound base pairs is high and is approximately independent of the extent of binding on DNA by polylysine. This is true in polylysine–DNA complexes prepared either by reconstitution or by directly mixing. It also applies for polylysine–nucleohistone complexes. The model where polylysine-bound base pairs collapse at Tm′ with two complementary strands still bound by polylysine is favored over the model where polylysine is dissociated from DNA during melting. The low renaturation of histone-bound base pairs in nucleo-histone indicates that either histones do not hold two complementary strands of DNA tightly or that histones are fully or partially dissociated from DNA when the nucleo-histone is fully denatured. 相似文献
19.
Infrared spectra of transfer ribonucleic acids. 3. Fragments of formyl-methionine tRNA from Escherichia coli 总被引:1,自引:0,他引:1
Four fragments (named K, L, M, and N) of Escherichia coli formylmethionine transfer RNA have been prepared by a partial digestion with ribonuclease T1 followed by a chromatographic separation with a DEAE–Sphadex (A-25) column and then a DEAE–cellulose column. The fragment K is the anticodon fragment with 19 nucleotides (previously reported). L is a fragment with 57 nucleotides involving the 3′-terminal (CCA). M is a fragment with 51 nucleotides which is equal to L except that M lacks 6 nucleotides at the 3′-terminal. N is a fragment with 20 nucleotides which involved the 5′-terminal and corresponds to the complementary half to L. The infrared absorption spectrum has been observed of each of these fragments and two equimolar mixtures L + N and M + N in D2O solutions at several temperatures. The results indicate that at 37°C, K has about 4 hydrogen-bonded base-pairs, L about 11, and M about 13. On the other hand, fragment N is found to have only three weak G-C pairs. For both L + N and M + N, 15–17 strong base pairs are found. The observations give direct support to the clover-leaf structure and at the same time provide information on the stability of each of the four arms in the structure. 相似文献
20.
Studies on poly(L-lysine50, L-tyrosine50)-DNA interaction 总被引:3,自引:0,他引:3
Interaction between poly(Lys50, Tyr50) and DNA has been studied by absorption, circular dichroism (CD), and fluorescence spectroscopy and thermal denaturation in 0.001M Tris, pH 6.8. The binding of this copolypeptide to DNA results in an absorbance enhancement and fluorescence quenching on tyrosine. There is also an increase in the tyrosine CD at 230 nm. The CD of DNA above 250 nm is slightly shifted to the longer wavelength which is qualitatively similar to, but quantitatively much smaller than, that induced by polylysine binding. At physiological pH the poly(Lys50, Tyr50)–DNA complex is soluble until there is one lysine and one tyrosine per nucleotide in the complex. The same ratio of amino acid residues to nucleotide has also been observed in copolypeptide-bound regions of the complex. The addition of more poly(Lys50, Tyr50) to DNA yields a constant melting temperature, Tm′, for bound base pairs at 90°C which is close to that of polylysine-bound DNA under the same condition. The melting temperature, Tm, of free base pairs at about 60°C on the other hand, is increased by 10°C as more copolypeptide is bound to DNA. As the temperature is raised, both absorption and CD spectra of the complexes with high coverage are changed, suggesting structural alteration, perhaps deprotonation, on bound tyrosine. The results in this report also suggest that intercalation of tyrosine in DNA is unlikely to be the mode of binding. 相似文献