The structure of rat 28S ribosomal ribonucleic acid inferred from the sequence of nucleotides in a gene.

The nucleotide sequence of a rat 28S rRNA gene was determined. The 28S rRNA encoded in the gene contains 4718 nucleotides and the molecular weight estimated from the sequence is 1.53 x 10(6). The guanine and cytosine content is 67%. The sequence of rat 28S rRNA diverges appreciably from that of Saccharomyces carlsbergensis 26S rRNA (about 50% identity), but more closely approximates that of Xenopus laevis 28S rRNA (about 75% identity). Rat 28S rRNA is larger than the analogous nucleic acids from yeast (3393 nucleotides) and X, laevis (4110 nucleotides) ribosomes. The additional bases are inserted in specific regions and tend to be rich in guanine and cytosine. 5.8S rRNA can interact with 28S rRNA by extensive hydrogen bonding at two sites near the 5' end of the latter.     

Independent binding sites in mouse 5.8S ribosomal ribonucleic acid for 28S ribosomal ribonucleic acid

Limited digestion of mouse 5.8S ribosomal RNA (rRNA) with RNase T2 generates 5'- and 3'-terminal "half-molecules". These fragments are capable of independently and specifically binding to 28S rRNA, so there exist at least two contacts in the 5.8S rRNA for the 28S rRNA. The dissociation constants for the 5.8S/28S, 5' 5.8S fragment/28S, and 3' 5.8S fragment/28S complexes are 9 x 10(-8) M, 6 x 10(-8) M, and 13 x 10(-8) M, respectively. Thus, each of the fragment binding sites contributes about equally to the overall binding energy of the 5.8S/28S rRNA complex, and the binding sites act independently, rather than cooperatively. The dissociation constants suggest that the 5.8S rRNA termini from short, irregular helices with 28S rRNA. Thermal denaturation data on complexes containing 28S rRNA and each of the half-molecules of 5.8S rRNA indicate that the 5'-terminal binding site(s) exist(s) in a single conformation while the 3'-terminal site exhibits two conformational alternatives. The functional significance of the different conformational states is presently indeterminate, but the possibility they may represent alternative forms of a conformational switch operative during ribosome function is discussed.     

The sequence ofTetrahymena thermophila 5S ribosomal ribonucleic acid

The primary structure ofTetrahymena thermophila 5S rRNA is reported. A secondary structure model is presented which can encompass most published eukaryotic 5S rRNA sequences. Unlike other eukaryotic 5S rRNAs,Tetrahymena is found to contain the sequence-CGAAC- beginning at position 40. The presence of this segment had previously been thought to be an exclusive characteristic of eubacterial 5S rRNAs.     

Effect of point mutations on 5.8S ribosomal ribonucleic acid secondary structure and the 5.8S--28S ribosomal ribonucleic acid junction

Naturally occurring differences in the nucleotide sequences of 5.8S ribosomal ribonucleic acids (rRNAs) from a variety of organisms have been used to study the role of specific nucleotides in the secondary structure and intermolecular interactions of this RNA. Significant differences in the electrophoretic mobilities of free 5.8S RNAs and the thermal stabilities of 5.8S--28S rRNA complexes were observed even in such closely related sequences as those of man, rat, turtle, and chicken. A single base transition from a guanylic acid residue in position 2 in mammalian 5.8S rRNA to an adenylic acid residue in turtle and chicken 5.8S rRNA results both in a more open molecular conformation and in a 5.8S--28S rRNA junction which is 3.5 degrees C more stable to thermal denaturation. Other changes such as the deletion of single nucleotides from either the 5' or the 3' terminals have no detectable effect on these features. The results support secondary structure models for free 5.8S rRNA in which the termini interact to various degrees and 5.8S--28S rRNA junctions in which both termini of the 5.8S molecule interact with the cognate high molecular weight RNA component.     

Alpha-sarcin cleaves ribosomal RNA at the alpha-sarcin site in the absence of ribosomal proteins

alpha-Sarcin is capable of specifically cleaving the single phosphodiester bond in the "alpha-sarcin site" of both Escherichia coli and Saccharomyces cerevisiae large rRNAs in the absence of ribosomal proteins. With both sources of rRNA, the rate of cleavage was comparable with and without ribosomal proteins but more complete cleavage was observed in the absence of ribosomal proteins. These observations contrast with earlier findings and indicate that ribosomal proteins are not essential to the unique specificity of the cleavage of rRNA by alpha-sarcin.     

Structural analyses of mammalian ribosomal ribonucleic acid and its precursors. Nucleotide sequence of ribosomal 5.8 S ribonucleic acid.

The nucleotide sequence of ribosomal 5.8 S RNA (also known as 7 S or 5.5 S rRNA) from Novikoff hepatoma ascites cells has been determined to be (see article). Estimations of the secondary structure based upon maximized base pairing and the fragments of partial ribonuclease digestion indicate that there may be five base-paired regions in the molecule, three forming a folding of the termini and two forming secondary hairpin loops. The sequence of Novikoff hepatoma 5.8 S rRNA is about 75% homologous with that of yeast 5.8 S rRNA (Rubin, G.M. (1973) J. Biol. Chem. 248, 3860-3875) and similar models for secondary structure are proposed. Both models contain a very stable G-C rich hairpin loop (residues 116 to 138), a less stable A-U-rich hairpin loop (residues 64 to 91) and two symmetrical bulges (residues 15 to 25 and 40 to 44).     

Binding of rat ribosomal proteins to yeast 5.8S ribosomal ribonucleic acid.

5.8 S RNA-protein complexes were prepared using purified yeast 5.8 S RNA and proteins from the large ribosomal subunit of rat liver. Formation of such hybrid complexes, as measured by Millipore filtration, was dependent on protein concentration. Binding of proteins to the RNA could approach saturation. Such complexes were isolated from sucrose density gradient centrifugation and shown to contain proteins L6, L8, L19, L35 and L35a. These proteins were identified by their molecular weights on polyacrylamide gels containing dodecylsulfate and their mobilities on two dimensional polyacrylamide gels.     

Nucleotide sequence of Crithidia fasciculata cytosol 5S ribosomal ribonucleic acid.

The complete nucleotide sequence of the cytosol 5S ribosomal ribonucleic acid of the trypanosomatid protozoan Crithidia fasciculata has been determined by a combination of T1-oligonucleotide catalog and gel sequencing techniques. The sequence is: GAGUACGACCAUACUUGAGUGAAAACACCAUAUCCCGUCCGAUUUGUGAAGUUAAGCACC CACAGGCUUAGUUAGUACUGAGGUCAGUGAUGACUCGGGAACCCUGAGUGCCGUACUCCCOH. This 5S ribosomal RNA is unique in having GAUU in place of the GAAC or GAUC found in all other prokaryotic and eukaryotic 5S RNAs, and thought to be involved in interactions with tRNAs. Comparisons to other eukaryotic cytosol 5S ribosomal RNA sequences indicate that the four major eukaryotic kingdoms (animals, plants, fungi, and protists) are about equally remote from each other, and that the latter kingdom may be the most internally diverse.