Rescue of a Dominant Mutant With RNA Interference

Maize Mucronate1 is a dominant floury mutant based on a misfolded 16-kDa γ-zein protein. To prove its function, we applied RNA interference (RNAi) as a dominant suppressor of the mutant seed phenotype. A γ-zein RNAi transgene was able to rescue the mutation and restore normal seed phenotype. RNA interference prevents gene expression. In most cases, this is used to study gene function by creating a new phenotype. Here, we use it for the opposite purpose. We use it to reverse the creation of a mutant phenotype by restoring the normal phenotype. In the case of the maize Mucronate1 (Mc1) phenotype, interaction of a misfolded protein with other proteins is believed to be the basis for the Mc1 phenotype. If no misfolded protein is present, we can reverse the mutant to the normal phenotype. One can envision using this approach to study complex traits and in gene therapy.TRANSLUCENT or vitreous maize kernels are harder and able to sustain stronger mechanical strength during harvesting, transportation, and storage. There is a direct link between a vitreous seed phenotype and the type of storage proteins in the seed, collectively called zeins in maize. Zeins, encoded by a multigene family, constitute >60% of all maize seed proteins. They are classified into four groups (α-, β-, γ-, and δ-zein) on the basis of their structures (Esen 1987). Zeins are specifically synthesized in the endosperm ∼10 days after pollination (DAP) and deposited into protein bodies (Wolf et al. 1967; Burr and Burr 1976; Lending and Larkins 1992). Irregularly shaped protein bodies are found in floury or opaque kernel phenotypes (Coleman et al. 1997; Kim et al. 2004, 2006; Wu et al. 2010; Wu and Messing 2010). The terms “floury” and “opaque” were originally created on the basis of the genetic behaviors of the mutant allele causing the soft kernel texture. The floury mutants behave as semidominant or dominant mutants, as floury1 and floury2 do, while the opaque mutants are recessive, as opaque1 and opaque2 are (Hayes and East 1915; Lindstrom 1923; Emerson et al. 1935; Maize Genetics Cooperation 1939). Similar to floury2 with a single mutation in the signal peptide of a 22-kDa α-zein resulting in an unprocessed protein (Coleman et al. 1995), De*-B30 produces an unprocessed 19-kDa α-zein (Kim et al. 2004). It was hypothesized that the two mutant proteins with an unprocessed signal peptide are misfolded and docked in the membranes of the rough endoplasmic reticulum (RER), blocking the deposition of other zein proteins (Coleman et al. 1995; Kim et al. 2004). In Mucronate1 (Mc1), a 38-bp deletion in the C terminus of the 16-kDa γ-zein (γ16-zein) gene resulted in a frameshift and a protein with a different amino-acid tail. This modified 16-kDa γ-zein (Δγ16-zein) has altered solubility properties, which would explain the formation of irregular protein bodies. Because De*-B30 and Mc1 are semidominant and dominant, respectively, they belong to the floury mutant class.The γ-zein genes (γ27-zein and γ16-zein) are homologous copies because maize underwent allotetraploidization and both gene copies have been retained during diploidization (Xu and Messing 2008). The two γ-zeins and the 15-kDa β-zein have a redundant function in stabilizing protein-body formation (Wu and Messing 2010). Knockdown of both γ-zeins with a single RNA interference (RNAi) construct conditioned only partial opacity in the crown, the top of the kernel, as opposed to the remainder or gown area of the kernel. Consistent with its light kernel phenotype, protein bodies in such a γ-zein RNAi (γRNAi) mutant exhibited a slight alteration in morphology. This phenotype is clearly distinguishable from the Mc1 phenotype, which is far more severe. Therefore, if Mc1 is caused by a misfolded chimeric 16-kDa γ-zein, preventing its expression should restore normal kernel phenotype. Indeed, a simple cross of Mc1 with a maize line carrying the γRNAi transgene produced a non-floury phenotype, providing an example of RNAi as a dominant suppressor of a dominant phenotype and as a general tool in marker rescue.

Analysis of the progeny from the cross of Mc1 and γRNAi mutants:

Mc1 seeds (Stock ID U840I) were requested from the Maize Genetics Cooperation Stock Center. The γRNAi transgenic lines have been reported in previous work (Wu et al. 2010; Wu and Messing 2010). Twelve progeny kernels from the cross of the Mc1 mutant [homozygous for the dominant-negative mutant 16-kDa γ-zein alleles (Δγ16/Δγ16) and heterozygous for the γRNAi line (γRNAi/+)] were dissected at 18 DAP for segregation and mRNA accumulation analyses. For each kernel, the embryo and endosperm were separated for DNA and RNA extraction, respectively. As shown in Figure 1A, five and seven kernels were positive and negative for the amplification of the γRNAi gene with a specific primer set, exemplifying a 1:1 segregation of the γRNAi gene.Open in a separate windowFigure 1.—Segregation analysis of the accumulations of mRNAs and proteins from the cross of the Mc1 mutant and the γRNAi line by RT–PCR and SDS–PAGE. (A) γRNAi gene segregation from progeny (Δγ16/Δγ16 x γRNAi/+) by PCR amplification with a specific primer set (GFPF, ACAACCACTACCTGAGCAC and T35SHindIII, ATTAAGCTTTGCAGGTCACTGGATTTTGG). Kernels 3, 8, 9, 10, and 12 are positive for the γRNAi gene and the rest of them are negative. M, DNA markers from top to bottom band are 3, 2, 1.5, 1.4, and 1 kb. (B) RT–PCR analysis of mRNA accumulation from the normal γ16 and mutant Δγ16 alleles in the endosperms with the genotypes corresponding to the embryos analyzed above. Total RNA was extracted by using TRIzol reagent (Invitrogen). Two micrograms of RNA was digested with DNase I (Invitrogen) and then reverse-transcribed. Twenty-five nanograms of cDNA from each of the twelve endosperms was applied for PCR (25 cycles of 30 sec, 94 °C; 30 sec, 58 °C; and 1 min, 72 °C). A specific primer set (γ16F, ATGAAGGTGCTGATCGTTGC and γ16R, TCAGTAGTAGACACCGCCG) was designed for amplification of the full-length γ16-zein coding sequence (552 bp). The lower band (514 bp) from the mutant Δγ16 allele is 38 bp shorter than that from the normal allele (552 bp). Kernels 3, 8, 9, 10, and 12 with the γRNAi gene accumulated significantly less mRNA compared to those without the γRNAi gene (kernels 1, 2, 4, 5, 6, 7, and 11). BA, hybrid of B × A lines. M, DNA markers from top to bottom are 1 kb, 750 bp, and 500 bp. (C) Profile of zein accumulations of 20 kernels from the progeny as described in the text. The zein extraction method has been described elsewhere (Wu et al. 2009). The Δγ16-zein from Mc1 was not extracted by traditional total-zein extraction protocol (70% ethanol and 2% 2-mercaptoethanol). The γ27- and γ16-zeins were knocked down to a nondetectable level in kernels 1, 2, 3, 5, 7, 10, 12, 13, 16, and 20. In γRNAi-gene segregating progeny (kernels 4, 6, 8, 9, 11, 14, 15, 17, 18, and 19), the γ16-zein from the normal γ16 allele is marked by arrowheads. Protein loaded in each lane was equal to 500 μg fresh endosperm at 18 DAP. The size for each band is indicated by the numbers in the “kDa” columns. BA, hybrid of B × A lines; 1–20, kernels from the progeny described above; M, protein markers from top to bottom are 50, 25, 20, and 15 kDa.Due to the 38-bp deletion in the C terminus of the coding region, the Δγ16 allele is shorter than the normal one (Figure 1B). Therefore, most of Δγ16-zein was in the non-zein fraction. In progeny endosperms of another 20 kernels from the same cross described above segregating for the γRNAi gene, two types of γ16-zeins were synthesized: the normal γ16-zein in the ethanol-soluble zein fraction and the Δγ16-zein in the non-zein fraction. In progeny inheriting the γRNAi gene, the γ27- and γ16-zeins were reduced to nondetectable levels (Figure 1C). Although the Δγ16-zein is not in the ethanol-soluble zein fraction, the level of normal γ16-zein is a good indicator of the accumulation of the Δγ16-zein.

Rescue of protein-body morphologies in the Mc1 mutant:

Regular protein bodies are round with distinct membrane boundaries (Figure 2A) and 1–2 μm in diameter at maturity. In homozygous and heterozygous Mc1 mutants (Δγ16/Δγ16 and Δγ16/+), protein bodies were irregularly shaped, some without discrete boundaries (Figure 2, C and D), which is quite different from the absence of normal γ27- or γ16-zeins in maize endosperm (Figure 2B). Indeed, protein bodies of the Mc1 mutant, blocked in the accumulation of Δγ16-zein, showed morphologies with no discernible difference from those in the γRNAi/+ line (Figure 2, B and E).Open in a separate windowFigure 2.—Transmission electron micrographs of protein bodies. The method has been described elsewhere (Wu and Messing 2010). (A) Nontransgenic BA. (B) γRNAi transgenic line (γRNAi/+). (C) Mc1 (Δγ16/Δγ16). (D) Cross of Mc1 mutant and nontransgenic hybrid of B × A lines (Δγ16/+). (E) Cross of Mc1 mutant (Δγ16/Δγ16) and heterologous γRNAi transgenic line (γRNAi/+). PB, protein body; RER, rough endoplasmic reticulum; CW, cell wall; Mt, mitochondria; SG, starch granule. Bars, 500 nm.

Recovery of floury phenotype in progeny:

On the basis of these observations, it is reasoned that irregularly shaped protein bodies (Figure 2, C and D) in the Mc1 mutant cause the floury phenotype (Figure 3, A and B). Because knockdown of γ-zeins caused opacity only in the crown area (Figure 3C), one could envision that once the irregular protein bodies are restored, the kernel would become vitreous in the gown area of the kernel. Indeed, the progeny ear from the cross of Δγ16/Δγ16 and γRNAi/+ showed a 1:1 ratio of floury and vitreous kernels (Figure 3, D and F), and all kernels were vitreous when the Mc1 mutant was pollinated by a homozygous γRNAi line (Figure 3E).Open in a separate windowFigure 3.—Segregation of vitreous and floury kernels from a progeny ear. (A) Mc1 mutant with Δγ16/Δγ16 genotype. (B) The cross of the Mc1 mutant and the nontransgenic hybrid of B × A lines, showing floury phenotype as in A. (C) γRNAi transgenic line with partial opacity only in the crown area. (D) The cross of the Mc1 mutant (Δγ16/Δγ16) and the heterologous γRNAi transgenic line (γRNAi/+), showing a 1:1 ratio of vitreous and floury kernels. A row in the ear is marked with arrowheads and crosses to indicate vitreous and floury gowns of kernels. (E) Cross of the Mc1 mutant (Δγ16/Δγ16) and the γRNAi homozygous transgenic line (γRNAi/γRNAi), showing all vitreous kernels. (F) Truncated kernel phenotype. (Top) Mc1, cross of Mc1 × BA, and γRNAi transgenic line. (Bottom) Three vitreous and floury kernels from D.

Conclusions:

RNAi can be used to rescue mutations that are dominant negative with a single cross, providing a useful tool in genetic analysis, plant breeding, and potentially in gene therapy in general.     

New Methods for Extraction and Quantitation of Zeins Reveal a High Content of gamma-Zein in Modified opaque-2 Maize

We have developed methods for quantitative extraction and analysis of zeins from maize (Zea mays L.) flour. Extraction involved solubilization of total endosperm proteins in an alkaline buffer containing SDS and 2-mercaptoethanol with subsequent precipitation of nonzein proteins by the addition of ethanol to 70%. Analysis of these proteins by SDS-PAGE with Coomassie blue staining and by Western blotting and ELISA assay with zein antibodies revealed that this extraction method is more quantitative than the traditional Landry-Moureaux procedure, especially for the β- and γ-zeins. This method was used to extract and analyze the zein content of several `Quality Protein Maize' (QPM) varieties developed by the International Maize and Wheat Improvement Center. QPM varieties contain `modifier genes' that confer a vitreous phenotype on opaque-2 genotypes, while maintaining the elevated levels of lysine and tryptophan characteristic of this mutant. This analysis revealed that the QPM types contain 2 to 4 times the amount of the γ-zein than unmodified opaque-2 or normal maize varieties. Possible relationships between the high expression of the γ-zein and the modified opaque phenotype are discussed.     

Lithium Chloride Dependent Glycogen Synthase Kinase 3 Inactivation Links Oxidative DNA Damage,Hypertrophy and Senescence in Human Articular Chondrocytes and Reproduces Chondrocyte Phenotype of Obese Osteoarthritis Patients

Introduction

Recent evidence suggests that GSK3 activity is chondroprotective in osteoarthritis (OA), but at the same time, its inactivation has been proposed as an anti-inflammatory therapeutic option. Here we evaluated the extent of GSK3β inactivation in vivo in OA knee cartilage and the molecular events downstream GSK3β inactivation in vitro to assess their contribution to cell senescence and hypertrophy.

Methods

In vivo level of phosphorylated GSK3β was analyzed in cartilage and oxidative damage was assessed by 8-oxo-deoxyguanosine staining. The in vitro effects of GSK3β inactivation (using either LiCl or SB216763) were evaluated on proliferating primary human chondrocytes by combined confocal microscopy analysis of Mitotracker staining and reactive oxygen species (ROS) production (2'',7''-dichlorofluorescin diacetate staining). Downstream effects on DNA damage and senescence were investigated by western blot (γH2AX, GADD45β and p21), flow cytometric analysis of cell cycle and light scattering properties, quantitative assessment of senescence associated β galactosidase activity, and PAS staining.

Results

In vivo chondrocytes from obese OA patients showed higher levels of phosphorylated GSK3β, oxidative damage and expression of GADD45β and p21, in comparison with chondrocytes of nonobese OA patients. LiCl mediated GSK3β inactivation in vitro resulted in increased mitochondrial ROS production, responsible for reduced cell proliferation, S phase transient arrest, and increase in cell senescence, size and granularity. Collectively, western blot data supported the occurrence of a DNA damage response leading to cellular senescence with increase in γH2AX, GADD45β and p21. Moreover, LiCl boosted 8-oxo-dG staining, expression of IKKα and MMP-10.

Conclusions

In articular chondrocytes, GSK3β activity is required for the maintenance of proliferative potential and phenotype. Conversely, GSK3β inactivation, although preserving chondrocyte survival, results in functional impairment via induction of hypertrophy and senescence. Indeed, GSK3β inactivation is responsible for ROS production, triggering oxidative stress and DNA damage response.     

Horizontal Gene Transfer and Gene Duplication of β-Fructofuranosidase Confer Lepidopteran Insects Metabolic Benefits

Horizontal gene transfer (HGT) is a potentially critical source of material for ecological adaptation and the evolution of novel genetic traits. However, reports on posttransfer duplication in organism genomes are lacking, and the evolutionary advantages conferred on the recipient are generally poorly understood. Sucrase plays an important role in insect physiological growth and development. Here, we performed a comprehensive analysis of the evolution of insect β-fructofuranosidase transferred from bacteria via HGT. We found that posttransfer duplications of β-fructofuranosidase were widespread in Lepidoptera and sporadic occurrences of β-fructofuranosidase were found in Coleoptera and Hymenoptera. β-fructofuranosidase genes often undergo modifications, such as gene duplication, differential gene loss, and changes in mutation rates. Lepidopteran β-fructofuranosidase gene (SUC) clusters showed marked divergence in gene expression patterns and enzymatic properties in Bombyx mori (moth) and Papilio xuthus (butterfly). We generated SUC1 mutations in B. mori using CRISPR/Cas9 to thoroughly examine the physiological function of SUC. BmSUC1 mutant larvae were viable but displayed delayed growth and reduced sucrase activities that included susceptibility to the sugar mimic alkaloid found in high concentrations in mulberry. BmSUC1 served as a critical sucrase and supported metabolic homeostasis in the larval midgut and silk gland, suggesting that gene transfer of β-fructofuranosidase enhanced the digestive and metabolic adaptation of lepidopteran insects. These findings highlight not only the universal function of β-fructofuranosidase with a link to the maintenance of carbohydrate metabolism but also an underexplored function in the silk gland. This study expands our knowledge of posttransfer duplication and subsequent functional diversification in the adaptive evolution and lineage-specific adaptation of organisms.     

CDK5RAP2 loss-of-function causes premature cell senescence via the GSK3β/β-catenin-WIP1 pathway

Developmental disorders characterized by small body size have been linked to CDK5RAP2 loss-of-function mutations, but the mechanisms underlying which remain obscure. Here, we demonstrate that knocking down CDK5RAP2 in human fibroblasts triggers premature cell senescence that is recapitulated in Cdk5rap2^an/an mouse embryonic fibroblasts and embryos, which exhibit reduced body weight and size, and increased senescence-associated (SA)-β-gal staining compared to Cdk5rap2^+/+ and Cdk5rap2^+/an embryos. Interestingly, CDK5RAP2-knockdown human fibroblasts show increased p53 Ser15 phosphorylation that does not correlate with activation of p53 kinases, but rather correlates with decreased level of the p53 phosphatase, WIP1. Ectopic WIP1 expression reverses the senescent phenotype in CDK5RAP2-knockdown cells, indicating that senescence in these cells is linked to WIP1 downregulation. CDK5RAP2 interacts with GSK3β, causing increased inhibitory GSK3β Ser9 phosphorylation and inhibiting the activity of GSK3β, which phosphorylates β-catenin, tagging β-catenin for degradation. Thus, loss of CDK5RAP2 decreases GSK3β Ser9 phosphorylation and increases GSK3β activity, reducing nuclear β-catenin, which affects the expression of NF-κB target genes such as WIP1. Consequently, loss of CDK5RAP2 or β-catenin causes WIP1 downregulation. Inhibition of GSK3β activity restores β-catenin and WIP1 levels in CDK5RAP2-knockdown cells, reducing p53 Ser15 phosphorylation and preventing senescence in these cells. Conversely, inhibition of WIP1 activity increases p53 Ser15 phosphorylation and senescence in CDK5RAP2-depleted cells lacking GSK3β activity. These findings indicate that loss of CDK5RAP2 promotes premature cell senescence through GSK3β/β-catenin downregulation of WIP1. Premature cell senescence may contribute to reduced body size associated with CDK5RAP2 loss-of-function.Subject terms: Senescence, Diseases     

Development and Characterization of a Gene Expression Reporter System for Clostridium acetobutylicum ATCC 824

A gene expression reporter system (pHT3) for Clostridium acetobutylicum ATCC 824 was developed by using the lacZ gene from Thermoanaerobacterium thermosulfurogenes EM1 as the reporter gene. In order to test the reporter system, promoters of three key metabolic pathway genes, ptb (coding for phosphotransbutyrylase), thl (coding for thiolase), and adc (coding for acetoacetate decarboxylase), were cloned upstream of the reporter gene in pHT3 in order to construct vectors pHT4, pHT5, and pHTA, respectively. Detection of β-galactosidase activity in time course studies performed with strains ATCC 824(pHT4), ATCC 824(pHT5), and ATCC 824(pHTA) demonstrated that the reporter gene produced a functional β-galactosidase in C. acetobutylicum. In addition, time course studies revealed differences in the β-galactosidase specific activity profiles of strains ATCC 824(pHT4), ATCC 824(pHT5), and ATCC 824(pHTA), suggesting that the reporter system developed in this study is able to effectively distinguish between different promoters. The stability of the β-galactosidase produced by the reporter gene was also examined with strains ATCC 824(pHT4) and ATCC 824(pHT5) by using chloramphenicol treatment to inhibit protein synthesis. The data indicated that the β-galactosidase produced by the lacZ gene from T. thermosulfurogenes EM1 was stable in the exponential phase of growth. In pH-controlled fermentations of ATCC 824(pHT4), the kinetics of β-galactosidase formation from the ptb promoter and phosphotransbutyrylase formation from its own autologous promoter were found to be similar.     

Inducible RNA Interference of brlAbeta in Aspergillus nidulans

An inducible RNA interference (RNAi) construct composed of inverted repeating alcA promoters flanking the developmental regulatory gene brlAβ was tested in Aspergillus nidulans. On inducing medium, the RNAi strains failed to sporulate and lacked brlAα and brlAβ expression. RNAi was specific for brlAβ, but not brlAα, silencing, indicating brlAα regulation by brlAβ.     

Regulations of Reversal of Senescence by PKC Isozymes in Response to 12-O-Tetradecanoylphorbol-13-Acetate via Nuclear Translocation of pErk1/2

The mechanism by which 12-O-tetradecanoylphorbol-13-acetate (TPA) bypasses cellular senescence was investigated using human diploid fibroblast (HDF) cell replicative senescence as a model. Upon TPA treatment, protein kinase C (PKC) α and PKCβ1 exerted differential effects on the nuclear translocation of cytoplasmic pErk1/2, a protein which maintains senescence. PKCα accompanied pErk1/2 to the nucleus after freeing it from PEA-15pS¹⁰⁴ via PKCβ1 and then was rapidly ubiquitinated and degraded within the nucleus. Mitogen-activated protein kinase docking motif and kinase activity of PKCα were both required for pErk1/2 transport to the nucleus. Repetitive exposure of mouse skin to TPA downregulated PKCα expression and increased epidermal and hair follicle cell proliferation. Thus, PKCα downregulation is accompanied by in vivo cell proliferation, as evidenced in 7, 12-dimethylbenz(a)anthracene (DMBA)-TPA-mediated carcinogenesis. The ability of TPA to reverse senescence was further demonstrated in old HDF cells using RNA-sequencing analyses in which TPA-induced nuclear PKCα degradation freed nuclear pErk1/2 to induce cell proliferation and facilitated the recovery of mitochondrial energy metabolism. Our data indicate that TPA-induced senescence reversal and carcinogenesis promotion share the same molecular pathway. Loss of PKCα expression following TPA treatment reduces pErk1/2-activated SP1 biding to the p21^WAF1 gene promoter, thus preventing senescence onset and overcoming G1/S cell cycle arrest in senescent cells.     

Exonic Sequences in the 5′ Untranslated Region of α-Tubulin mRNA Modulate trans Splicing in Trypanosoma brucei

Previous studies have identified a conserved AG dinucleotide at the 3′ splice site (3′SS) and a polypyrimidine (pPy) tract that are required for trans splicing of polycistronic pre-mRNAs in trypanosomatids. Furthermore, the pPy tract of the Trypanosoma brucei α-tubulin 3′SS region is required to specify accurate 3′-end formation of the upstream β-tubulin gene and trans splicing of the downstream α-tubulin gene. Here, we employed an in vivo cis competition assay to determine whether sequences other than those of the AG dinucleotide and the pPy tract were required for 3′SS identification. Our results indicate that a minimal α-tubulin 3′SS, from the putative branch site region to the AG dinucleotide, is not sufficient for recognition by the trans-splicing machinery and that polyadenylation is strictly dependent on downstream trans splicing. We show that efficient use of the α-tubulin 3′SS is dependent upon the presence of exon sequences. Furthermore, β-tubulin, but not actin exon sequences or unrelated plasmid sequences, can replace α-tubulin exon sequences for accurate trans-splice-site selection. Taken together, these results support a model in which the informational content required for efficient trans splicing of the α-tubulin pre-mRNA includes exon sequences which are involved in modulation of trans-splicing efficiency. Sequences that positively regulate trans splicing might be similar to cis-splicing enhancers described in other systems.     

Corneal Wound Healing Requires IKB kinase β Signaling in Keratocytes

IkB kinase β (IKKβ) is a key signaling kinase for inflammatory responses, but it also plays diverse cell type-specific roles that are not yet fully understood. Here we investigated the role of IKKβ in the cornea using Ikkβ^ΔCS mice in which the Ikkβ gene was specifically deleted in the corneal stromal keratocytes. The Ikkβ^ΔCS corneas had normal morphology, transparency and thickness; however, they did not heal well from mild alkali burn injury. In contrast to the Ikkβ^F/F corneas that restored transparency in 2 weeks after injury, over 50% of the Ikkβ^ΔCS corneas failed to fully recover. They instead developed recurrent haze with increased stromal thickness, severe inflammation and apoptosis. This pathogenesis correlated with sustained myofibroblast transformation with increased α smooth muscle actin (α-SMA) expression, higher levels of senescence β-Gal activity and scar tissue formation at the late stage of wound healing. In addition, the Ikkβ^ΔCS corneas displayed elevated expression of hemo-oxygenase-1 (HO-1), a marker of oxidative stress, and activation of stress signaling pathways with increased JNK, c-Jun and SMAD2/3 phosphorylation. These data suggest that IKKβ in keratocytes is required to repress oxidative stress and attenuate fibrogenesis and senescence in corneal wound healing.