Kinetics of folding and unfolding of alpha alpha-tropomyosin and of nonpolymerizable alpha alpha-tropomyosin.

Stopped flow CD (SFCD) kinetic studies of self-assembly of coiled coils of rabbit alpha alpha-tropomyosin and of nonpolymerizable alpha alpha-tropomyosin (NPTm) are reported. The protein was denatured in 6 M urea buffer, then renatured by 10-fold dilution into benign saline buffer. Folding was monitored by SFCD in the backbone region (222 nm). Protein chains are shown to be totally unfolded (and separated in the reduced species) in the initial denaturing medium and fully folded as two-chain coiled coils in the final benign medium. In all cases of folding in benign buffer of totally unfolded chains, two phases were found in the folding process: a fast phase (less than 0.04 s, the SFCD dead time), in which an intermediate state with about 70% of the equilibrium ellipticity forms; followed by a slower, observable phase that completes the folding. The slow phase is first order (k-1 = 1.6 s at 20 degrees C), signifying that chain association for reduced samples occurs in the fast phase. In contrast, folding in benign buffer from an initial state with 70% of the equilibrium ellipticity is all fast, suggesting that the folding intermediate is not an equilibrium species. Cross-linking at Cys-190 increases the helix content of the fast-formed intermediate state to about 85% of the equilibrium value, but leaves the rate constant of the slow phase unchanged. In NPTm, which does not form high aggregates at low ionic strength, the rate of the observable phase is almost independent of ionic strength in the range of approximately 0.15-0.6 M, but is reduced one to two orders of magnitude by further reduction to 0.026 M. In folding from totally unfolded chains, the rate is reduced less than one order of magnitude by changing the final state to about 50% folded. In contrast to folding, unfolding of alpha alpha-tropomyosin from the native state is all fast.     

Sequence repeats in a polyoma virus DNA region important for gene expression.

The sequenced prototype strains (A2 and A3) of polyoma virus lack sequence duplications characteristic of other papovaviruses. However, we found that five polyoma virus strains (P16, Toronto large plaque, MV, Ts 48, and NG59R) contain tandemly duplicated sequences in a region near the late RNA leader. Although the duplications vary in size (31 to 84 base pairs) and location (between nucleotide [nt] 5068 and nt 5185), the sequence between nt 5114 and nt 5137 is contained within all five duplicated segments. This region is known to be important in polyoma virus early gene expression, and it contains sequences capable of enhancing the expression of nonviral genes. Inspection of the sequences at and around the ends of the repeats indicated that the duplications do not arise by homologous recombination, and there was no indication that a sequence-specific mechanism results in their formation. However, the variation in the structure of the repeats among different polyoma virus strains suggests that these sequence duplications are a recent evolutionary occurrence. The potential biological significance of this variation is discussed.     

Rabbit skeletal alpha-tropomyosin chains are in register.

2-Acetamido-2-deoxy-3-O-(D-2-propionyl-L-alanine)-D-glucopyranose ($\text{5}$) and 2-acetamido-2-deoxy-3-O-(D-2-propionyl-L-alanyl-D-isoglutamine)-D-glucopyranose ($\text{10}$) have been synthesized by condensation of benzyl 2-acetamido-4,6-O-benzylidene-3-O-(D-1-carboxyethyl)-2-deoxy-β-D-glucopyranoside ($\text{1}$) respectively with the L-alanine derivative $\text{2}$ and the dipeptide $\text{7}$, followed by debenzylidenation and hydrogenolysis. Compound $\text{10}$ is adjuvant active, whereas $\text{5}$ is inactive, so that $\text{10}$ is the smallest adjuvant active structure for the time being.     

Unfolding domains of recombinant fusion alpha alpha-tropomyosin.

The thermal unfolding of the coiled-coil alpha-helix of recombinant alpha alpha-tropomyosin from rat striated muscle containing an additional 80-residue peptide of influenza virus NS1 protein at the N-terminus (fusion-tropomyosin) was studied with circular dichroism and fluorescence techniques. Fusion-tropomyosin unfolded in four cooperative transitions: (1) a pretransition starting at 35 degrees C involving the middle of the molecule; (2) a major transition at 46 degrees C involving no more than 36% of the helix from the C-terminus; (3) a major transition at 56 degrees C involving about 46% of the helix from the N-terminus; and (4) a transition from the nonhelical fusion domain at about 70 degrees C. Rabbit skeletal muscle tropomyosin, which lacks the fusion peptide but has the same tropomyosin sequence, does not exhibit the 56 degrees C or 70 degrees C transition. The very stable fusion unfolding domain of fusion-tropomyosin, which appears in electron micrographs as a globular structural domain at one end of the tropomyosin rod, acts as a cross-link to stabilize the adjacent N-terminal domain. The least stable middle of the molecule, when unfolded, acts as a boundary to allow the independent unfolding of the C-terminal domain at 46 degrees C from the stabilized N-terminal unfolding domain at 56 degrees C. Thus, strong localized interchain interactions in coiled-coil molecules can increase the stability of neighboring domains.     

Sequence requirements for binding of Rep68 to the adeno-associated virus terminal repeats.

We have used reciprocal competition binding experiments with mutant substrates and chemical modification interference assays to precisely define the sequences within the adeno-associated virus (AAV) terminal repeat (TR) that are involved in site-specific binding to the AAV Rep protein. Mutagenesis experiments were done with a 43-bp oligonucleotide which contained the Rep binding element (RBE) within the A stem of the TR. Experiments in which two adjacent base pairs of the RBE were substituted simultaneously with nucleotides that produced transversions identified a 22-bp sequence (CAGTGAGCGAGCGAGCGCGCAG) in which substitutions measurably affected the binding affinity. Although the 22-bp RBE contains the GAGC motifs that have been found in all known Rep binding sites, our results suggest that the GAGC motifs alone are not the only sequences specifically recognized by Rep. The effects of substitutions within the 22-bp sequence were relatively symmetrical, with nucleotides at the periphery of the RBE having the least effect on binding affinity and those in the middle having the greatest effect. Dinucleotide mutations within 18 (GTGAGCGAGCGAGC) of the 22 bp were found to decrease the binding affinity by at least threefold. Dinucleotide mutations within a 10-bp core sequence (GCGAGCGAGC) were found to decrease binding affinity by more than 10-fold. Single-base substitutions within the 10-bp core sequence lowered the binding affinity by variable amounts (up to fivefold). The results of the mutagenesis analysis suggested that the A-stem RBE contains only a single Rep binding site rather than two or more independent sites. To confirm the results of the mutant analysis and to determine the relative contribution of each base to binding, chemical modification experiments using dimethyl sulfate and hydrazine were performed on both the linear A-stem sequence and the entire AAV TR in both the flip and flop hairpinned configurations. Interference assays on the linear A stem identified the 18-bp sequence described above as essential for binding. G, C, and T residues on both strands contributed to binding, and the interference pattern correlated well with the results of the mutagenesis experiments. Interference assays with complete hairpinned TR substrates also identified the 18-bp sequence as important for binding. However, the interference patterns on the two strands within the RBE and the relative contributions of the individual bases to binding were clearly different between the hairpinned substrates and the linear A-stem binding element. Interference assays also allowed us to search for residues within the small internal palindromes of the TR (B and C) that contribute to binding. The largest effect was seen by modification of two T residues within the sequence CTTTG. This sequence was present in the same position relative to the terminal resolution site (trs) in both the flip and flop orientations of the TR. In addition, the interference pattern suggested that the remaining bases within the CTTTG motif as well as other bases within the B and C palindromes make contacts with the Rep protein, albeit with lower affinities. Regardless of whether the TR was in the flip or flop orientation, most of the contact points were clustered in the small internal palindrome furthest away from the trs. We also determined the relative binding affinity of linear substrates containing a complete RBE with hairpinned substrates and found that linear substrates bound Rep less efficiently. Our results were consistent with our previous model that there are three distinct elements within the hairpinned AAV TR that contribute to binding affinity or to efficient nicking at the trs: the A-stem RBE, the secondary structure element which consists of the B and C palindromes, and the trs.     

High-level production of functional muscle alpha-tropomyosin in Pichia pastoris.

Although numerous studies have reported the production of skeletal muscle alpha-tropomyosin in E. coli, the protein needs to be modified at the amino terminus in order to be active. Without these modifications the protein does not bind to actin, does not exhibit head-to-tail polymerization, and does not inhibit the actomyosin Mg(2+)-ATPase in the absence of troponin. On the other hand, the protein produced in insect cells using baculovirus as an expression vector (Urbancikova, M., and Hitchcock-DeGregori, S. E., J. Biol. Chem., 269, 24310-24315, 1994) is only partially acetylated at its amino terminal and therefore is not totally functional. In an attempt to produce an unmodified functional recombinant muscle alpha-tropomyosin for structure-function correlation studies we have expressed the chicken skeletal alpha-tropomyosin cDNA in the yeast Pichia pastoris. Recombinant protein was produced at a high level (20 mg/L) and was similar to the wild type muscle protein in its ability to polymerize, to bind to actin and to regulate the actomyosin S1 Mg(2+)-ATPase.     

Sequence of 1019 nucleotides encompassing one of the inverted repeats from the yeast 2 micrometer plasmid.

A sequence of 1019 nucleotides encompassing one of the 600 base inverted repeats and non-repeated flanking regions has been determined in the type A yeast 2 micrometers plasmid cloned in pMB9. Methods are described for applying the Maxam-Gilbert sequencing procedure to DNA fragments labelled at the 3'-end using a T4-polymerase exchange/repair reaction and for sequencing 5'-end labelled fragments using dideoxy-nucleotides as chain terminators in the presence of E. coli DNA polymerase (nach Klenow). A notable feature of the sequence is its unusual content of symmetry elements. In one region of 140 nucleotides, 137 are involved in a complex arrangement of direct and inverted repeats linked by palindromic sequences.     

Sequence instability in the long terminal repeats of avian spleen necrosis virus and reticuloendotheliosis virus

Summary Sequence divergence between the 3 long terminal repeats (LTR) of avian reticuloendotheliosis virus (REV), deletion variant proviral clone 2-20-4, and spleen necrosis virus (SNV)—proviral clones 14-44, 60, and 70—was found to involve two classes of base substitutions: low-frequency interspersed and high-frequency clustered substitutions. Clones 2-20-4 and 14-44 have diverged 4.4% owing to low-frequency substitutions. In contrast, two high-frequency substitution segments have diverged by 30% and 29%, respectively. Clustered substitutions appear to be located either within or next to tandem repeats, suggesting their introduction concomitant with sequence deletions and duplications commonly associated with such repeats. A new 19-bp tandem repeat is found in clone 2-20-4. Its sequence could have evolved from the 26-bp repeats found in the SNV clones.     

Heat denaturation of alpha-tropomyosin and its fragments

The reasons for three heterogeneity of tropomyosin melting curves are considered. It is shown that this phenomenon is due to the molecular heterogeneity of the preparation. Different states of the SH-groups as well as the different stability of molecule regions. The melting curves of alpha-tropomyosin and two of its fragments are obtained. The thermodynamic parameters stabilizing their helical structure are determined. The existence of a thermodynamical transition at 31 degrees C is shown for alpha-tropomyosin leading to the loss of the ability of the molecule to form supra-molecular structures.     

Construction of bacterial plasmids containing sequences complementary to chicken alpha-tropomyosin mRNA.

Recombinant plasmids have been constructed with contain sequences complementary to the mRNA coding for skeletal muscle alpha-tropomyosin. These recombinants were detected initially using a selective cDNA probe and subsequently using a messenger RNA selection assay. alpha-TM plasmids hybridize to a singly mRNA species smaller than 18S ribosomal RNA and found only in skeletal muscle. Cross-hybridization with mRNA's coding for other tropomyosins could not be detected under normal conditions. However, under conditions of reduced stringency alpha- TM plasmids cross-hydridize with an RNA species in heart muscle which may code for cardiac tropomyosin.     

Sequence analysis of genomic regions containing trinucleotide repeats isolated by a novel cloning method

A method was developed for effective isolation of trinucleotide repeats from genomic DNA. This method is based on the DNA polymerase reaction, which is restricted with only two or three nucleotide substrates and primed by biotinylated oligonucleotide probes. Sequences are then isolated by a streptavidin biotin-trapping method. More than 80% of the clones from each library contained more than eight trinucleotide repeats. Sequence analysis showed that the characteristic dinucleotide flanking sequences usually confronting various trinucleotide repeats are not found in the vicinity of CAG repeats, suggesting that CAG repeats may have been generated through a mechanism different from that of other trinucleotide repeats.     

The binding site of skeletal alpha-tropomyosin on troponin-T

The binding site for rabbit skeletal alpha-tropomyosin on troponin-T has been localized to the cyanogen bromide fragment, CB2 (residues 71-151), using affinity chromatography. The entire fragment is required to bring about the correct secondary structure conducive to binding. CB2 contains about 80% alpha-helix and accounts for most of the helical content found in troponin-T (35%). The molecular weight of CB2 obtained by sedimentation equilibrium (9700) agrees closely with the value calculated from sequence analysis (9850). Circular dichroism and sedimentation velocity experiments indicate that the helix is stable and not affected by salt concentrations of 0.1 to 1.6 M KCl nor by composition of the buffer. The helical content is unaffected by pH from 3.3 to 9.1 but decreases at pH 10-11. Temperature denaturation studies CB2 and troponin-T show that both are similarly heat labile, with loss of 50% of the ellipticity at 39 degrees C. Binding of CB2 to alpha-tropomyosin occurs in the pH range of 5.0 to 9.1, but not at pH 3-4 or 10-11. It is concluded that the helical region of CB2, and perhaps the carboxyl side chains of aspartic and glutamic acids, may be involved in binding over a limited surface area of the double-stranded coiled coil of alpha-tropomyosin.     

Sequence variations of simple sequence repeats on chromosome-4 in two subspecies of the Asian cultivated rice

Computational screening of the chromosome-4 sequence of the rice cultivar Nipponbare (Oryza sativa L. japonica) revealed 1,844 tandem simple sequence repeats (SSRs) or microsatellites with SSR motifs 20 bp and repeated unit length of 1–6 base pairs. Thus SSRs occur once in every 18.8 kb, on the average, on the chromosome with one SSR per 23.8 kb and 16 kb on the short and long arms, respectively. No SSR was detected in the core region of the centromere. Poly(AT) _n repeats represented the most abundant and length polymorphic class of SSRs on the chromosome, but it did not occur in the exons. GC-rich trinucleotide repeats were most abundant in the coding regions, representing 71.69% of the SSRs identified in the exons. Two hundred and twenty four SSRs were associated with the repetitive DNA sequences, most of them were poly(AT) _n tracts. Sequence variations of SSRs between two cultivars, representing the two subspecies of the Asian cultivated rice indica and japonica, were identified, revealing that divergence and convergence of the two subspecies could be traced by the analysis of SSRs. These results provide a great opportunity for SSR-based marker development and comparative genome analysis of the two subspecies of the Asian cultivated rice.Electronic Supplementary Material Supplementary material is available in the online version of this article at .Communicated by Q. Zhang     

Sequence requirements for stable binding and function of Rep68 on the adeno-associated virus type 2 inverted terminal repeats.

Replication of the palindromic inverted terminal repeats (ITRs) of adeno-associated virus type 2 requires several functions of the viral nonstructural Rep proteins. These include binding to the ITR, nicking of the double-stranded replication intermediate at the terminal resolution site (trs), and then strand displacement and synthesis from the nick. This report demonstrates the ability of both recombinant fusion maltose-binding protein (MBP)-Rep68 delta produced in Escherichia coli and wild-type (wt) Rep68 to bind to a linear truncated form of the ITR, delta 57 ITR, with similar affinity as to the wt hairpin ITR. A dissociation constant for MBP-Rep68 delta of approximately 8 x 10(-10) M was determined for the wt ITR and delta 57 ITR probes. Truncation of delta 57 ITR to generate delta 28 ITR, which retains the GCTC repeat motif but not the trs, bound at least 10 times less efficiently than delta 57 ITR. Extension of delta 28 ITR with nonspecific sequence restored the ability of MBP-Rep68 delta to bind to delta 28 ITR. Thus, high-affinity binding would appear to require stabilization by flanking sequence as well as the intact GCTC repeat motif. Cleavage of the delta 57 ITR probe with DdeI, which truncates the flanking sequence and was previously shown to inhibit binding by Rep68, also inhibited the binding of MBP-Rep68 delta. The requirements for stable binding were further defined with a series of oligonucleotide probes which spanned the region protected by MBP-Rep78 in DNase I footprinting. The binding activity of either MBP-Rep68 delta or wt Rep68 to hairpin ITR or delta 57 ITR was indistinguishable. However, the binding activity of MBP-Rep68 delta to DNA does not appear to correlate with trs endonuclease activity. The nicking and covalent linkage of MBP-Rep68 delta to the nonhairpin delta 57 ITR was approximately 100-fold less efficient than its linkage to a hairpin-containing ITR. Therefore, although the hairpin portion of the ITR does not appear to play a role in recognition and stabilization of MBP-Rep68 delta binding, its presence does affect the trs cleavage activity of the protein.