Kinetics of folding and unfolding of alpha alpha-tropomyosin and of nonpolymerizable alpha alpha-tropomyosin.

Stopped flow CD (SFCD) kinetic studies of self-assembly of coiled coils of rabbit alpha alpha-tropomyosin and of nonpolymerizable alpha alpha-tropomyosin (NPTm) are reported. The protein was denatured in 6 M urea buffer, then renatured by 10-fold dilution into benign saline buffer. Folding was monitored by SFCD in the backbone region (222 nm). Protein chains are shown to be totally unfolded (and separated in the reduced species) in the initial denaturing medium and fully folded as two-chain coiled coils in the final benign medium. In all cases of folding in benign buffer of totally unfolded chains, two phases were found in the folding process: a fast phase (less than 0.04 s, the SFCD dead time), in which an intermediate state with about 70% of the equilibrium ellipticity forms; followed by a slower, observable phase that completes the folding. The slow phase is first order (k-1 = 1.6 s at 20 degrees C), signifying that chain association for reduced samples occurs in the fast phase. In contrast, folding in benign buffer from an initial state with 70% of the equilibrium ellipticity is all fast, suggesting that the folding intermediate is not an equilibrium species. Cross-linking at Cys-190 increases the helix content of the fast-formed intermediate state to about 85% of the equilibrium value, but leaves the rate constant of the slow phase unchanged. In NPTm, which does not form high aggregates at low ionic strength, the rate of the observable phase is almost independent of ionic strength in the range of approximately 0.15-0.6 M, but is reduced one to two orders of magnitude by further reduction to 0.026 M. In folding from totally unfolded chains, the rate is reduced less than one order of magnitude by changing the final state to about 50% folded. In contrast to folding, unfolding of alpha alpha-tropomyosin from the native state is all fast.     

Sequence repeats in a polyoma virus DNA region important for gene expression.

The sequenced prototype strains (A2 and A3) of polyoma virus lack sequence duplications characteristic of other papovaviruses. However, we found that five polyoma virus strains (P16, Toronto large plaque, MV, Ts 48, and NG59R) contain tandemly duplicated sequences in a region near the late RNA leader. Although the duplications vary in size (31 to 84 base pairs) and location (between nucleotide [nt] 5068 and nt 5185), the sequence between nt 5114 and nt 5137 is contained within all five duplicated segments. This region is known to be important in polyoma virus early gene expression, and it contains sequences capable of enhancing the expression of nonviral genes. Inspection of the sequences at and around the ends of the repeats indicated that the duplications do not arise by homologous recombination, and there was no indication that a sequence-specific mechanism results in their formation. However, the variation in the structure of the repeats among different polyoma virus strains suggests that these sequence duplications are a recent evolutionary occurrence. The potential biological significance of this variation is discussed.     

Rabbit skeletal alpha-tropomyosin chains are in register.

2-Acetamido-2-deoxy-3-O-(D-2-propionyl-L-alanine)-D-glucopyranose ($\text{5}$) and 2-acetamido-2-deoxy-3-O-(D-2-propionyl-L-alanyl-D-isoglutamine)-D-glucopyranose ($\text{10}$) have been synthesized by condensation of benzyl 2-acetamido-4,6-O-benzylidene-3-O-(D-1-carboxyethyl)-2-deoxy-β-D-glucopyranoside ($\text{1}$) respectively with the L-alanine derivative $\text{2}$ and the dipeptide $\text{7}$, followed by debenzylidenation and hydrogenolysis. Compound $\text{10}$ is adjuvant active, whereas $\text{5}$ is inactive, so that $\text{10}$ is the smallest adjuvant active structure for the time being.     

Unfolding domains of recombinant fusion alpha alpha-tropomyosin.

The thermal unfolding of the coiled-coil alpha-helix of recombinant alpha alpha-tropomyosin from rat striated muscle containing an additional 80-residue peptide of influenza virus NS1 protein at the N-terminus (fusion-tropomyosin) was studied with circular dichroism and fluorescence techniques. Fusion-tropomyosin unfolded in four cooperative transitions: (1) a pretransition starting at 35 degrees C involving the middle of the molecule; (2) a major transition at 46 degrees C involving no more than 36% of the helix from the C-terminus; (3) a major transition at 56 degrees C involving about 46% of the helix from the N-terminus; and (4) a transition from the nonhelical fusion domain at about 70 degrees C. Rabbit skeletal muscle tropomyosin, which lacks the fusion peptide but has the same tropomyosin sequence, does not exhibit the 56 degrees C or 70 degrees C transition. The very stable fusion unfolding domain of fusion-tropomyosin, which appears in electron micrographs as a globular structural domain at one end of the tropomyosin rod, acts as a cross-link to stabilize the adjacent N-terminal domain. The least stable middle of the molecule, when unfolded, acts as a boundary to allow the independent unfolding of the C-terminal domain at 46 degrees C from the stabilized N-terminal unfolding domain at 56 degrees C. Thus, strong localized interchain interactions in coiled-coil molecules can increase the stability of neighboring domains.     

Kinetics of folding of alpha alpha-tropomyosin subsequences.

The kinetics of folding random coils of alpha alpha-tropomyson (Tm) subsequences to two-chain coiled coils was studied by stopped-flow CD. Subsequences studied were those comprising residues 11-127 (11Tm127), 142-281 (142Tm281), 1-189 (1Tm189), and 190-284 (190Tm284) of the parent 284-residue alpha-tropomyosin chain. Unlike the parent, subsequences 1Tm189 and 11Tm127 fold within the dead time of the instrument (less than 0.04 s). Like the parent, subsequences 142Tm281 and 190Tm284 fold in two phases. In the fast phase, 45% and 32%, respectively, of the equilibrium helical content form. In the time-resolvable, first-order slow phase (k-1 = 2.7 s at 20 degrees C for 142Tm281 and k-1 = 2.0 s at 15 degrees C for 190Tm284), the remaining structure forms. Neither reduced 142Tm281 nor 190Tm284 show any dependence of the rate on concentration, so chain association occurs in the fast phase. Like the parent 142Tm281 forms more helical content in the fast phase when cross-linked at C-190, and the remaining structure forms slowly with rate parameters similar to those of the reduced species. Comparison of the folding behavior of C- and N-terminal subsequences with that of the parent protein suggests that the slow phase in the parent is caused by a folding bottleneck somewhere nearer the C-terminus. However, rapid association and partial folding near the N-terminus is not necessary for prompt folding, since even 190Tm284 chains associate and partially fold very rapidly (less than 0.04 s), and then complete the folding in seconds.     

Sequence requirements for binding of Rep68 to the adeno-associated virus terminal repeats.

We have used reciprocal competition binding experiments with mutant substrates and chemical modification interference assays to precisely define the sequences within the adeno-associated virus (AAV) terminal repeat (TR) that are involved in site-specific binding to the AAV Rep protein. Mutagenesis experiments were done with a 43-bp oligonucleotide which contained the Rep binding element (RBE) within the A stem of the TR. Experiments in which two adjacent base pairs of the RBE were substituted simultaneously with nucleotides that produced transversions identified a 22-bp sequence (CAGTGAGCGAGCGAGCGCGCAG) in which substitutions measurably affected the binding affinity. Although the 22-bp RBE contains the GAGC motifs that have been found in all known Rep binding sites, our results suggest that the GAGC motifs alone are not the only sequences specifically recognized by Rep. The effects of substitutions within the 22-bp sequence were relatively symmetrical, with nucleotides at the periphery of the RBE having the least effect on binding affinity and those in the middle having the greatest effect. Dinucleotide mutations within 18 (GTGAGCGAGCGAGC) of the 22 bp were found to decrease the binding affinity by at least threefold. Dinucleotide mutations within a 10-bp core sequence (GCGAGCGAGC) were found to decrease binding affinity by more than 10-fold. Single-base substitutions within the 10-bp core sequence lowered the binding affinity by variable amounts (up to fivefold). The results of the mutagenesis analysis suggested that the A-stem RBE contains only a single Rep binding site rather than two or more independent sites. To confirm the results of the mutant analysis and to determine the relative contribution of each base to binding, chemical modification experiments using dimethyl sulfate and hydrazine were performed on both the linear A-stem sequence and the entire AAV TR in both the flip and flop hairpinned configurations. Interference assays on the linear A stem identified the 18-bp sequence described above as essential for binding. G, C, and T residues on both strands contributed to binding, and the interference pattern correlated well with the results of the mutagenesis experiments. Interference assays with complete hairpinned TR substrates also identified the 18-bp sequence as important for binding. However, the interference patterns on the two strands within the RBE and the relative contributions of the individual bases to binding were clearly different between the hairpinned substrates and the linear A-stem binding element. Interference assays also allowed us to search for residues within the small internal palindromes of the TR (B and C) that contribute to binding. The largest effect was seen by modification of two T residues within the sequence CTTTG. This sequence was present in the same position relative to the terminal resolution site (trs) in both the flip and flop orientations of the TR. In addition, the interference pattern suggested that the remaining bases within the CTTTG motif as well as other bases within the B and C palindromes make contacts with the Rep protein, albeit with lower affinities. Regardless of whether the TR was in the flip or flop orientation, most of the contact points were clustered in the small internal palindrome furthest away from the trs. We also determined the relative binding affinity of linear substrates containing a complete RBE with hairpinned substrates and found that linear substrates bound Rep less efficiently. Our results were consistent with our previous model that there are three distinct elements within the hairpinned AAV TR that contribute to binding affinity or to efficient nicking at the trs: the A-stem RBE, the secondary structure element which consists of the B and C palindromes, and the trs.     

High-level production of functional muscle alpha-tropomyosin in Pichia pastoris.

Although numerous studies have reported the production of skeletal muscle alpha-tropomyosin in E. coli, the protein needs to be modified at the amino terminus in order to be active. Without these modifications the protein does not bind to actin, does not exhibit head-to-tail polymerization, and does not inhibit the actomyosin Mg(2+)-ATPase in the absence of troponin. On the other hand, the protein produced in insect cells using baculovirus as an expression vector (Urbancikova, M., and Hitchcock-DeGregori, S. E., J. Biol. Chem., 269, 24310-24315, 1994) is only partially acetylated at its amino terminal and therefore is not totally functional. In an attempt to produce an unmodified functional recombinant muscle alpha-tropomyosin for structure-function correlation studies we have expressed the chicken skeletal alpha-tropomyosin cDNA in the yeast Pichia pastoris. Recombinant protein was produced at a high level (20 mg/L) and was similar to the wild type muscle protein in its ability to polymerize, to bind to actin and to regulate the actomyosin S1 Mg(2+)-ATPase.     

Sequence of the short unique region, short repeats, and part of the long repeats of human cytomegalovirus

We have determined the DNA sequence (46 kilobases) of the short unique region, the short repeat, and part of the long repeat of human cytomegalovirus strain AD169. Analysis of the sequence has revealed at least 38 possible regions that may code for protein. Many of these open reading frames show homology to each other, and five groups of homologous reading frames are identified. Half of the predicted translation products appear to be membrane proteins, and fall into two distinct classes; those that have potential signal and anchor sequences, and those that have seven potential membrane-spanning regions and appear to be integral membrane proteins. A number of the former class contain sites for N-linked glycosylation and may therefore be glycoproteins. None of the 38 open reading frames shows homology to other known herpesvirus proteins.     

Sequence of 1019 nucleotides encompassing one of the inverted repeats from the yeast 2 micrometer plasmid.

A sequence of 1019 nucleotides encompassing one of the 600 base inverted repeats and non-repeated flanking regions has been determined in the type A yeast 2 micrometers plasmid cloned in pMB9. Methods are described for applying the Maxam-Gilbert sequencing procedure to DNA fragments labelled at the 3'-end using a T4-polymerase exchange/repair reaction and for sequencing 5'-end labelled fragments using dideoxy-nucleotides as chain terminators in the presence of E. coli DNA polymerase (nach Klenow). A notable feature of the sequence is its unusual content of symmetry elements. In one region of 140 nucleotides, 137 are involved in a complex arrangement of direct and inverted repeats linked by palindromic sequences.     

Sequence instability in the long terminal repeats of avian spleen necrosis virus and reticuloendotheliosis virus

Summary Sequence divergence between the 3 long terminal repeats (LTR) of avian reticuloendotheliosis virus (REV), deletion variant proviral clone 2-20-4, and spleen necrosis virus (SNV)—proviral clones 14-44, 60, and 70—was found to involve two classes of base substitutions: low-frequency interspersed and high-frequency clustered substitutions. Clones 2-20-4 and 14-44 have diverged 4.4% owing to low-frequency substitutions. In contrast, two high-frequency substitution segments have diverged by 30% and 29%, respectively. Clustered substitutions appear to be located either within or next to tandem repeats, suggesting their introduction concomitant with sequence deletions and duplications commonly associated with such repeats. A new 19-bp tandem repeat is found in clone 2-20-4. Its sequence could have evolved from the 26-bp repeats found in the SNV clones.     

Heat denaturation of alpha-tropomyosin and its fragments

The reasons for three heterogeneity of tropomyosin melting curves are considered. It is shown that this phenomenon is due to the molecular heterogeneity of the preparation. Different states of the SH-groups as well as the different stability of molecule regions. The melting curves of alpha-tropomyosin and two of its fragments are obtained. The thermodynamic parameters stabilizing their helical structure are determined. The existence of a thermodynamical transition at 31 degrees C is shown for alpha-tropomyosin leading to the loss of the ability of the molecule to form supra-molecular structures.     

Construction of bacterial plasmids containing sequences complementary to chicken alpha-tropomyosin mRNA.

Recombinant plasmids have been constructed with contain sequences complementary to the mRNA coding for skeletal muscle alpha-tropomyosin. These recombinants were detected initially using a selective cDNA probe and subsequently using a messenger RNA selection assay. alpha-TM plasmids hybridize to a singly mRNA species smaller than 18S ribosomal RNA and found only in skeletal muscle. Cross-hybridization with mRNA's coding for other tropomyosins could not be detected under normal conditions. However, under conditions of reduced stringency alpha- TM plasmids cross-hydridize with an RNA species in heart muscle which may code for cardiac tropomyosin.     

Sequence analysis of genomic regions containing trinucleotide repeats isolated by a novel cloning method

A method was developed for effective isolation of trinucleotide repeats from genomic DNA. This method is based on the DNA polymerase reaction, which is restricted with only two or three nucleotide substrates and primed by biotinylated oligonucleotide probes. Sequences are then isolated by a streptavidin biotin-trapping method. More than 80% of the clones from each library contained more than eight trinucleotide repeats. Sequence analysis showed that the characteristic dinucleotide flanking sequences usually confronting various trinucleotide repeats are not found in the vicinity of CAG repeats, suggesting that CAG repeats may have been generated through a mechanism different from that of other trinucleotide repeats.     

Alternative splicing of a human alpha-tropomyosin muscle-specific exon: identification of determining sequences.

The human alpha-tropomyosin gene hTMnm has two mutually exclusive versions of exon 5 (NM and SK), one of which is expressed specifically in skeletal muscle (exon SK). A minigene construct expresses only the nonmuscle (NM) isoform when transfected into COS-1 cells and both forms when transfected into myoblasts. Twenty-four mutants were produced to determine why the SK exon is not expressed in COS cells. The results showed that exons NM and SK are not in competition for splicing to the flanking exons and that there is no intrinsic barrier to splicing between the exons. Instead, exon SK is skipped whenever there are flanking introns. Splicing of exon SK was induced when the branch site sequence 70 nucleotides upstream of the exon was mutated to resemble the consensus and when the extremities of the exon itself were changed to the corresponding NM sequence. Precise swaps of the NM and SK exon sequences showed that the exon sequence effect was dominant to that of intron sequences. The mechanism of regulation appears to be unlike that of other tropomyosin genes. We propose that exclusion of exon SK arises because its 3' splicing signals are weak and are prevented by an exon-specific repressor from competing for splice site recognition.     

Enhancer elements activate the weak 3' splice site of alpha-tropomyosin exon 2.

We have identified four purine-rich sequences that act as splicing enhancer elements to activate the weak 3' splice site of alpha-tropomyosin exon 2. These elements also activate the splicing of heterologous substrates containing weak 3' splice sites or mutated 5' splice sites. However, they are unique in that they can activate splicing whether they are placed in an upstream or downstream exon, and the two central elements can function regardless of their position relative to one another. The presence of excess RNAs containing these enhancers could effectively inhibit in vitro pre-mRNA splicing reactions in a substrate-dependent manner and, at lower concentrations of competitor RNA, the addition of SR proteins could relieve the inhibition. However, when extracts were depleted by incubation with biotinylated exon 2 RNAs followed by passage over streptavidin agarose, SR proteins were not sufficient to restore splicing. Instead, both SR proteins and fractions containing a 110-kD protein were necessary to rescue splicing. Using gel mobility shift assays, we show that formation of stable enhancer-specific complexes on alpha-tropomyosin exon 2 requires the presence of both SR proteins and the 110-kD protein. By analogy to the doublesex exon enhancer elements in Drosophila, our results suggest that assembly of mammalian exon enhancer complexes requires both SR and non-SR proteins to activate selection of weak splice sites.