Distinct domains in the CArG-box binding factor A destabilize tetraplex forms of the fragile X expanded sequence d(CGG)n

Formation of hairpin or tetraplex structures of the FMR1 gene d(CGG)_n sequence triggers its expansion, setting off fragile X syndrome. In searching for proteins that destabilize d(CGG)_n secondary structures we purified from rat liver quadruplex telomeric DNA binding protein 42 (qTBP42) that disrupts G′2 bimolecular tetraplex d(CGG)_n while paradoxically stabilizing the G′2 structure of the telomeric sequence d(TTAGGG)_n. Based on peptide sequence homology of qTBP42 and mouse CArG-box binding factor A (CBF-A), we provide direct evidence that recombinant CBF-A protein is physically and immunochemically indistinguishable from qTBP42 and that it too destabilizes G′2 d(CGG)_n while stabilizing G′2 d(TTAGGG)_n. We inquired whether CBF-A employs the same or different domains to differentially interact with G′2 d(CGG)_n and G′2 d(TTAGGG)_n. Mutant CBF-A proteins that lack each or combinations of its five conserved motifs: RNP1₁, RNP1₂, RNP2₁, RNP2₂ and ATP/GTP-binding box were tested for their G′2 d(CGG)_n destabilization and G′2 d(TTAGGG)_n stabilization activities. We find that either RNP1₁ or the ATP/GTP motifs are necessary and sufficient for G′2 d(CGG)_n destabilization whereas RNP2₁ suppresses destabilization by either one of these two motifs. Neither RNP1₁ nor the ATP/GTP motif are required for G′2 d(TTAGGG)_n stabilization. Hence, CBF-A employs different domains to destabilize G′2 d(CGG)_n or stabilize G′2 d(TTAGGG)_n.     

Human werner syndrome DNA helicase unwinds tetrahelical structures of the fragile X syndrome repeat sequence d(CGG)n

Formation of hairpin and tetrahelical structures by a d(CGG) trinucleotide repeat sequence is thought to cause expansion of this sequence and to engender fragile X syndrome. Here we show that human Werner syndrome DNA helicase (WRN), a member of the RecQ family of helicases, efficiently unwinds G'2 bimolecular tetraplex structures of d(CGG)7. Unwinding of d(CGG)7 by WRN requires hydrolyzable ATP and Mg2+ and is proportional to the amount of added helicase and to the time of incubation. The efficiencies of unwinding of G'2 d(CGG)7 tetraplex with 7 nucleotide-long single-stranded tails at their 3' or 5' ends are, respectively, 3.5- and 2-fold greater than that of double-stranded DNA. By contrast, WRN is unable to unwind a blunt-ended d(CGG)7 tetraplex, bimolecular tetraplex structures of a telomeric sequence 5'-d(TAGACATG(TTAGGG)2TTA)-3', or tetramolecular quadruplex forms of an IgG switch region sequence 5'-d(TACAGGGGAGCTGGGGTAGA)-3'. The ability of WRN to selectively unwind specific tetrahelices may reflect a specific role of this helicase in DNA metabolism.     

Interruption of the fragile X syndrome expanded sequence d(CGG)(n) by interspersed d(AGG) trinucleotides diminishes the formation and stability of d(CGG)(n) tetrahelical structures

Fragile X syndrome is caused by expansion of a d(CGG) trinucleotide repeat sequence in the 5′ untranslated region of the first exon of the FMR1 gene. Repeat expansion is thought to be instigated by formation of d(CGG)_n secondary structures. Stable FMR1 d(CGG)_n runs in normal individuals consist of 6–52 d(CGG) repeats that are interrupted every 9–11 triplets by a single d(AGG) trinucleotide. By contrast, individuals having fragile X syndrome premutation or full mutation present >54–200 or >200–2000 monotonous d(CGG) repeats, respectively. Here we show that the presence of interspersed d(AGG) triplets diminished in vitro formation of bimolecular tetrahelical structures of d(CGG)₁₈ oligomers. Tetraplex structures formed by d(CGG)_n oligomers containing d(AGG) interspersions had lower thermal stability. In addition, tetraplex structures of d(CGG)₁₈ oligomers interspersed by d(AGG) triplets were unwound by human Werner syndrome DNA helicase at rates and to an extent that exceeded the unwinding of tetraplex form consisting of monotonous d(CGG)₁₈. Diminished formation and stability of tetraplex structures of d(AGG)-containing FMR1 d(CGG)_2–50 tracts might restrict their expansion in normal individuals.     

Interactions between the Werner syndrome helicase and DNA polymerase delta specifically facilitate copying of tetraplex and hairpin structures of the d(CGG)n trinucleotide repeat sequence

Werner syndrome (WS) is an inherited disorder characterized by premature aging and genomic instability. The protein encoded by the WS gene, WRN, possesses intrinsic 3' --> 5' DNA helicase and 3' --> 5' DNA exonuclease activities. WRN helicase resolves alternate DNA structures including tetraplex and triplex DNA, and Holliday junctions. Thus, one function of WRN may be to unwind secondary structures that impede cellular DNA transactions. We report here that hairpin and G'2 bimolecular tetraplex structures of the fragile X expanded sequence, d(CGG)(n), effectively impede synthesis by three eukaryotic replicative DNA polymerases (pol): pol alpha, pol delta, and pol epsilon. The constraints imposed on pol delta-catalyzed synthesis are relieved, however, by WRN; WRN facilitates pol delta to traverse these template secondary structures to synthesize full-length DNA products. The alleviatory effect of WRN is limited to pol delta; neither pol alpha nor pol epsilon can traverse template d(CGG)(n) hairpin and tetraplex structures in the presence of WRN. Alleviation of pausing by pol delta is observed with Escherichia coli RecQ but not with UvrD helicase, suggesting a concerted action of RecQ helicases and pol delta. Our findings suggest a possible role of WRN in rescuing pol delta-mediated replication at forks stalled by unusual DNA secondary structures.     

Recurrent and unexpected segregation of the FMR1 CGG repeat in a family with fragile X syndrome

Fragile X syndrome, the most common cause of hereditary mental retardation, results from amplification of a CGG trinucleotide repeat in the FMR1 gene. The transmission of the CGG repeat from premutated individuals to their premutated descendants is usually unstable, showing an increase in the size of the repeat. We report here a family which exhibits recurrent and unexpected transmission of the maternal premutation to three daughters. The first daughter exhibited mosaicism with two premutated alleles, one contracted and the other expanded. The second daughter showed a reversion from the maternal premutation to the normal range, and the third carried an expanded premutated allele associated with an expanded paternal allele within the normal range. These variations in the size of the CGG repeat may result from many different mechanisms such as DNA polymerase slippage on the leading or lagging strand during replication, large contractions of repeats on the parental strand during replication, or recombination through unequal crossover between sister chromatids. Our results suggest that the variation of the CGG premutated alleles in this family may be the result of intrinsic instability associated with a trans-acting factor such as a mismatch repair gene product. Received: 21 August 1995 / Revised: 21 September 1995     

The fragile X chromosome (GCC) repeat folds into a DNA tetraplex at neutral pH

UV absorption and CD spectroscopy, along with polyacrylamide gel electrophoresis, were used to study conformational properties of DNA fragments containing the trinucleotide repeat (GCC)_n (n = 4, 8 or 16), whose expansion is correlated with the fragile X chromosome syndrome. We have found that the conformational spectrum of the (GCC)_n strand is wider than has been shown so far. (GCC)_n strands adopt the hairpin described in the literature under a wide range of salt concentrations, but only at alkaline (>7.5) pH values. However, at neutral and slightly acid pH (GCC)₄ and (GCC)₈ strands homodimerize. Our data suggest that the homodimer is a bimolecular tetraplex formed by two parallel-oriented hairpins held together by hemi-protonated intermolecular C·C⁺ pairs. The (GCC)₁₆ strand forms the same tetraplex intramolecularly. We further show that below pH 5 (GCC)_n strands generate intercalated cytosine tetraplexes, whose molecularity depends on DNA strand length. They are tetramolecular with (GCC)₄, bimolecular with (GCC)₈ and monomolecular with (GCC)₁₆. i-Tetraplex formation is a complex and slow process. The neutral tetraplex, on the other hand, arises with fast kinetics under physiological conditions. Thus it is a conformational alternative of the (GCC)_n strand duplex with a complementary (GGC)_n strand.     

Expansion of the fragile X CGG repeat in females with premutation or intermediate alleles

The CGG repeat in the 5' untranslated region of the fragile X mental retardation 1 gene (FMR1) exhibits remarkable instability upon transmission from mothers with premutation alleles. A collaboration of 13 laboratories in eight countries was established to examine four issues concerning FMR1 CGG-repeat instability among females with premutation (approximately 55-200 repeats) and intermediate (approximately 46-60 repeats) alleles. Our central findings were as follows: (1) The smallest premutation alleles that expanded to a full mutation (>200 repeats) in one generation contained 59 repeats; sequence analysis of the 59-repeat alleles from these two females revealed no AGG interruptions within the FMR1 CGG repeat. (2) When we corrected for ascertainment and recalculated the risks of expansion to a full mutation, we found that the risks for premutation alleles with <100 repeats were lower than those previously published. (3) When we examined the possible influence of sex of offspring on transmission of a full mutation-by analysis of 567 prenatal fragile X studies of 448 mothers with premutation and full-mutation alleles-we found no significant differences in the proportion of full-mutation alleles in male or female fetuses. (4) When we examined 136 transmissions of intermediate alleles from 92 mothers with no family history of fragile X, we found that, in contrast to the instability observed in families with fragile X, most (99/136 [72.8%]) transmissions of intermediate alleles were stable. The unstable transmissions (37/136 [27.2%]) in these families included both expansions and contractions in repeat size. The instability increased with the larger intermediate alleles (19% for 49-54 repeats, 30.9% for 55-59, and 80% for 60-65 repeats). These studies should allow improved risk assessments for genetic counseling of women with premutation or intermediate-size alleles.     

Tetrahelical forms of the fragile X syndrome expanded sequence d(CGG)(n) are destabilized by two heterogeneous nuclear ribonucleoprotein-related telomeric DNA-binding proteins

Formations of hairpin and tetrahelical structures by the trinucleotide repeat sequence d(CGG)(n) might contribute to its expansion in fragile X syndrome. Here we show that tetraplex structures of d(CGG)(n) are destabilized by two mammalian heterogeneous nuclear ribonucleoprotein-related tetraplex telomeric DNA-binding and -stabilizing proteins, quadruplex telomeric DNA-binding protein 42 (qTBP42) (Sarig, G., Weisman-Shomer, P., Erlitzki, R., and Fry, M. (1997) J. Biol. Chem. 272, 4474-4482) and unimolecular quadruplex telomeric DNA-binding protein 25 (uqTBP25) (Erlitzki, R., and Fry, M. (1997) J. Biol. Chem. 272, 15881-15890). Blunt-ended and 3'-tailed or 3'- and 5'-tailed bimolecular tetraplex structures of d(CGG)(n) and guanine-sparse 20-/46-mer partial DNA duplex were progressively destabilized by increasing amounts of qTBP42 or uqTBP25 in time-dependent and ATP- or Mg(2+)-independent reactions. By contrast, tetraplex structures of telomeric and IgG sequences or guanine-rich double-stranded DNA resisted destabilization by qTBP42 or uqTBP25. Increased stability of tetraplex d(CGG)(n) in the presence of K(+) or Na(+) ions or at lowered reaction temperature diminished the destabilizing activity of uqTBP25. The contrasting stabilization of tetraplex telomeric DNA and destabilization of tetraplex d(CGG)(n) by qTBP42 and uqTBP25 suggested that sequence or structural differences between these tetraplexes might serve as cues for the differential stabilizing/destabilizing activities.     

Trinucleotide repeats (CGG)22TGG(CGG)43TGG(CGG)21 from the fragile X gene remain stable in transgenic mice

Unstable premutation alleles in fragile X contain CGG repeats ranging from 34 to about 200. To study the mechanism of formation and the behavior of dynamic mutations, we constructed and cloned 88 trinucleotide repeats including 43 uninterrupted CGGs and injected them into mouse fertilized oocytes. We analyzed 342 transgenic animals obtained from 6 different founders after one to four generations, and found that the repeats remained stable regardless of the sex of the transmitting mouse. Therefore, we may need to consider factors other than trinucleotide repeat length alone to explain CGG instability and create an animal model. Received: 17 January 1997 / Accepted: 14 April 1997     

Molecular analysis of the (CGG)n expansion in the FMR-1 gene in 59 Spanish fragile X syndrome families

The fragile X mental retardation syndrome is caused by an expansion of a trinucleotide repeat (CGG)_n in the FMR-1 gene. Molecular genetic study of fragile X provides accurate diagnosis and facilitates genetic counseling in families with affected members. We present here the molecular study of 59 Spanish fragile X syndrome families using probe StB 12.3 and the polymerase chain reaction (PCR) of the (CGG)_n repeat sequence of the FMR-1 gene. The results obtained have allowed us to characterize 455 individuals, including eight prenatal diagnoses. The clinical diagnosis of fragile X in 89 affected males was confirmed, 137 female carriers were identified (48 of whom were mentally retarded), 176 individuals at risk were found not to have the expansion, and 12 cases of normal transmitting males (NTM) were detected. In the sample studied, no de novo mutations were detected, nor any mutation different from that described for the (CGG)_n expansion. One nonmentally retarded male was detected as having an unmethylated CpG island for the FMR-1 gene, but with more than 200 CGG repeats (high functioning male). The analysis of the (CGG)_n repeat in 208 normal chromosomes gave an allele distribution similar to that in other Caucasoid population groups, with alleles of 29 and 30 CGG repeats accounting for 46% of the chromosomes. The combination of Southern analysis and PCR of the (CGG)_n repeat is highly efficient for diagnosis, compared with cytogenetic techniques, especially in the detection of female carriers, NTMs, and prenatal diagnosis, enabling accurate genetic counseling to be provided in all cases.     

Secondary structure and dynamics of the r(CGG) repeat in the mRNA of the fragile X mental retardation 1 (FMR1) gene.

The CGG triplet repeat found within the 5'UTR of the FMR1 gene is involved in the pathogenesis of both fragile X syndrome and fragile X-associated tremor/ataxia syndrome (FXTAS). The repeat has been shown to form both hairpins and tetraplexes in DNA; however, the secondary structure of CGG-repeat RNA has not been well defined. To this end, we have performed NMR spectroscopy on in vitro transcribed CGG-repeat RNAs and see clear evidence of intramolecular hairpins, with no evidence of tetraplex structures. Both C*G and G*G base pairs form in the hairpin stem, though in a dynamic equilibrium of conformations. In addition, we investigated the effect of an AGG repeat interruption on hairpin stability; such interruptions are often interspersed within the CGG repeat element and are thought to modulate secondary structure of the RNA. While the AGG repeat lowers the Tm of the hairpin at low Mg2+ concentrations, this difference disappears at physiological Mg2+ levels.     

Survey of the fragile X syndrome CGG repeat and the short-tandem-repeat and single-nucleotide-polymorphism haplotypes in an African American population

Previous studies have shown that specific short-tandem-repeat (STR) and single-nucleotide-polymorphism (SNP)-based haplotypes within and among unaffected and fragile X white populations are found to be associated with specific CGG-repeat patterns. It has been hypothesized that these associations result from different mutational mechanisms, possibly influenced by the CGG structure and/or cis-acting factors. Alternatively, haplotype associations may result from the long mutational history of increasing instability. To understand the basis of the mutational process, we examined the CGG-repeat size, three flanking STR markers (DXS548-FRAXAC1-FRAXAC2), and one SNP (ATL1) spanning 150 kb around the CGG repeat in unaffected (n=637) and fragile X (n=63) African American populations and compared them with unaffected (n=721) and fragile X (n=102) white populations. Several important differences were found between the two ethnic groups. First, in contrast to that seen in the white population, no associations were observed among the African American intermediate or "predisposed" alleles (41-60 repeats). Second, two previously undescribed haplotypes accounted for the majority of the African American fragile X population. Third, a putative "protective" haplotype was not found among African Americans, whereas it was found among whites. Fourth, in contrast to that seen in whites, the SNP ATL1 was in linkage equilibrium among African Americans, and it did not add new information to the STR haplotypes. These data indicate that the STR- and SNP-based haplotype associations identified in whites probably reflect the mutational history of the expansion, rather than a mutational mechanism or pathway.     

Solution structures of the individual single strands of the fragile X DNA triplets (GCC)n.(GGC)n.

Three-dimensional structures of the fragile X triplet repeats (GCC)n and (GGC)n are derived by using one- dimensional/two-dimensional NMR. Under a wide range of solution conditions (10-150 mM NaCl,pH6-7)(GCC)5-7 strands form exclusively slipped hairpins with a 3' overhanging C. The slipped hairpins of (GCC)n strands show the following structural characteristics: (i) maximization of Watson-Crick G.C pairs; (ii) formation of C.C mispairs at the CpG steps in the stem; (iii) C2'-endo, anti conformations for all the nucleotides. The ability of (GCC)n strands to form hairpin structures more readily than complementary (GGC)n strands suggests preferential slippage during replication and subsequent expansion of the (GCC)n strands. In addition, the C.C. mispairs at the CpG site of (GCC)n hairpins account for their exceptional substrate efficiencies for human methyltransferase. Gel electrophoresis data show that (GGC)n strands form both hairpin and mismatched duplex structures in 10-150 mM NaCl (ph 6-7) for n < 10, but for n > or + 11 hairpin structures are exclusively present. However, (GGC)n strands remain predominantly in the duplex state for n=4-11 under NMR solution conditions, which require DNA concentrations 100- to 1000-fold higher than in gel electrophoresis. NMR analyses of [(GGC)n]2 duplexes for n=4-6 show the presence of Watson-Crick G.C and mismatched G anti G syn pairs. The mismatches adjacent to the CpG step introduce local structural flexibility in these duplexes. Similar structural properties are also expected in the stem of the hairpins formed by (GGC)n strands.     

Methylation mosaicism of 5'-(CGG)(n)-3' repeats in fragile X, premutation and normal individuals

Fragile X syndrome (FRAXA) is characterized at the molecular level by an expansion of a naturally occurring 5′-(CGG)_n-3′ repeat in the promoter and 5′-untranslated region (5′-UTR) of the fragile X mental retardation (FMR1) gene on human chromosome Xq27.3. When expanded, this region is usually hypermethylated. Inactivation of the FMR1 promoter and absence of the FMR1 protein are the likely cause of the syndrome. By using the bisulfite protocol of the genomic sequencing method, we have determined the methylation patterns in this region on single chromosomes of healthy individuals and of selected premutation carriers and FRAXA patients. In control experiments with unmethylated or M-SssI-premethylated DNAs, this protocol has been ascertained to reliably detect all cytidines or 5-methylcytidines as unmethylated or methylated nucleotides, respectively. Analyses of the DNA from FRAXA patients reveal considerable variability in the lengths of the 5′-(CGG)_n-3′ repeats and in the levels of methylation in the repeat and the 5′-UTR. In one patient (OEl) with high repeat length heterogeneity (n = 15 to >200), shorter repeats (n = 20–80) were methylated or unmethylated, longer repeats (n = 100–150) were often completely methylated, but one repeat with n = 160 proved to be completely unmethylated. This type of methylation mosaicism was observed in several FRAXA patients. In healthy females, methylated 5′-CG-3′ sequences were found in some repeats and 5′-UTRs, as expected for the sequences from one of the X chromosomes. The natural FMR1 promoter is methylation sensitive, as demonstrated by the loss of activity in transfection experiments using the unmethylated or M-SssI-premethylated FMR1 promoter fused to the luciferase gene as an activity indicator.     

Expansion of the CGG repeat in fragile X in the FMR1 gene depends on the sex of the offspring.

Analysis of 139 mother-to-offspring transmissions of fragile X CGG triplet repeats revealed that the repeat expansion is enhanced in mother-to-son transmissions compared with mother-to-daughter transmissions. Evidence has been based on analysis of mother-offspring differences in the size of repeat (in kb), as well as on comparisons between proportions of male and female offspring with premutations, and full mutations, inherited from mothers carrying a premutation. Mean difference in the repeat size from mother-son transmissions was 1.45 kb, compared with mother-daughter transmissions of 0.76 kb. The difference is due primarily to a greater proportion of male than female offspring with full mutation from the premutation mothers and also to a higher frequency of reduction in repeat size from mothers to daughters than from mothers to sons. Our findings suggest the possibility of an interaction of the normal X homologue in a female zygote with the FMR1 sequence on the fragile X during replication to account for the lower level of expansion in mother-to-daughter transmissions relative to mother-to-son transmissions.     

Variation of the CGG repeat at the fragile X site results in genetic instability: resolution of the Sherman paradox.

Fragile X syndrome results from mutations in a (CGG)n repeat found in the coding sequence of the FMR-1 gene. Analysis of length variation in this region in normal individuals shows a range of allele sizes varying from a low of 6 to a high of 54 repeats. Premutations showing no phenotypic effect in fragile X families range in size from 52 to over 200 repeats. All alleles with greater than 52 repeats, including those identified in a normal family, are meiotically unstable with a mutation frequency of one, while 75 meioses of alleles of 46 repeats and below have shown no mutation. Premutation alleles are also mitotically unstable as mosaicism is observed. The risk of expansion during oogenesis to the full mutation associated with mental retardation increases with the number of repeats, and this variation in risk accounts for the Sherman paradox.     

Analysis of a CGG sequence at the FMR-1 locus in fragile X families and in the general population.

In this study, we have characterized a CGG repeat at the FMR-1 locus in more than 100 families (more than 500 individuals) presenting for fragile X testing and in 247 individuals from the general population. Both Southern blot and PCR-based assays were evaluated for their ability to detect premutations, full mutations, and variability in normal allele sizes. Among the Southern blot assays, the probes Ox1.9 or StB12.3 with a double restriction-enzyme digest were the most sensitive in detecting both small and large amplifications and, in addition, provided information on methylation of an adjacent CpG island. In the PCR-based assays, analysis of PCR products on denaturing DNA sequencing gels allowed the most accurate determination of CGG repeat number up to approximately 130 repeats. A combination of a Southern blot assay with a double digest and the PCR-sequencing-gel assay detected the spectrum of amplification-type mutations at the FMR-1 locus. In the patient population, a CGG repeat of 51 was the largest to be stably inherited, and a repeat of 57 was the smallest size of premutation to be unstably inherited. When premutations were transmitted by females, the size of repeat correlated with risk of expansion to a full mutation in the next generation. Full mutations (large repeats typically associated with an abnormal methylation pattern and mitotic instability) were associated with clinical and cytogenetic manifestations in males but not necessarily in females. In the control population, the CGG repeat ranged from 13 to 61, but 94% of alleles had fewer than 40 repeats. The most frequent allele (34%) was a repeat of 30. One female had an allele (61 repeats) within a range consistent with fragile X premutations, while two other individuals each had a repeat of 52. This suggests that the frequency of unstable alleles in the general population may be approximately 1%.     

Mutation spectra in fragile X syndrome induced by deletions of CGG*CCG repeats

The fragile X syndrome results from expansions as well as deletions of the repeating CGG.CCG DNA sequence in the 5'-untranslated region of the FMR1 gene on the X chromosome. The relative frequency of disease cases promoted by these two types of mutations cannot be ascertained at present because the routine clinical assay monitors only expansions. At least 30 articles have been reviewed that document the involvement of deletions of part or all of the CGG.CCG repeats along with varying extents of DNA flanking regions as well as very small mutations including single base pair changes. Studies of deletion mutants of CGG.CCG tracts in Escherichia coli plasmids revealed a similar spectrum of mutagenic products. The triplet repeat tract in a non-B conformation is the mutagen, not the sequence per se in the right-handed B helix. Hence, molecular investigations in a simple model organism may generate useful initial information toward therapeutic strategies for this disease.