Synthesis, DNA-binding affinities, and binding mode of berberine dimers

Six novel berberine dimers (3a-f) were synthesized in 37-84% yield from the reaction of berberrubine (2) with dihaloalkanes of varying lengths from two to seven carbons. Their interactions with calf thymus (CT) DNA and three double helical oligodeoxynucleotides, d(AAGAATTCTT)2, d(AAGCATGCTT)2, and d(TAAGAATTCTTA)2, were investigated by means of fluorometric titration and ethidium bromide (EB) displacement experiments. Compared with the monomeric parent berberine (1), these dimers' DNA-binding affinities increased up to approximately 100-fold, suggesting a cooperative interaction of the two berberine subunits in the molecules. Furthermore, these dimers linked by different spacers show a prominent structure-activity relationship when bound with oligodeoxynucleotides. The relative binding affinities are in the order of 3b>3a>3c>3d>3e>3f with d(AAGAATTCTT)2 and d(TAAGAATTCTTA)2, and 3b>3c>3a>3d>3e>3f with d(AAGCATGCTT)2. Dimer 3b, linked with a propyl chain, exhibits the highest binding affinity. This suggests that a propyl chain may be the most suitable spacer to bridge the two berberine units for DNA binding. Spectrophotometric titration and competitive EB displacement of berberine (1) and dimer 3b indicate that both berberine and its dimers form intercalating complexes with duplex DNA. A larger redshift, a stronger hypochromic effect, and a much higher EB displacement ratio, observed in 3b, indicate that the dimer is in more intimate contact with DNA than berberine. In addition, no obvious binding of canadine (4), a hydrogenated product of berberine, with CT DNA was observed, suggesting critical roles of the quaternary ammonium cation and planar structure in the DNA-binding of berberine.     

Spacer length and attaching position-dependent binding of synthesized protoberberine dimers to double-stranded DNA

Six jatrorrhizine homodimers and berberine-jatrorrhizine heterodimers have been synthesized in moderate to good yields from the reaction of jatrorrhizine with alpha,omega-dibromoalkanes and 9-O-(omega-bromoalkyl)berberines, respectively. Their binding activities toward calf thymus (CT) DNA and three double-stranded oligodeoxynucleotides, d(AAGAATTCTT)(2), d(TAAGAATTCTTA)(2), and d(TTAAGAATTCTTAA)(2), were investigated by means of spectrofluorimetric and spectrophotometric titrations. The results indicate that these dimers exhibit enhanced DNA-binding affinities due to the cooperative interaction of the two protoberberine subunits. A comparative study of the DNA-binding behaviors of berberine homodimers, jatrorrhizine homodimers, and berberine-jatrorrhizine heterodimers suggests that spacer length and attaching position are of great importance in modulating their DNA-binding affinities.     

Study on noncovalent complexes of cytotoxic protoberberine alkaloids with double-stranded DNA by using electrospray ionization mass spectrometry

The noncovalent complexes of four cytotoxic protoberberine alkaloids that is, berberine, palmatine, jatrorrhizine, and coptisine with double-stranded oligodeoxynucleotides d(AAGAATTCTT)(2) were investigated by electrospray ionization mass spectrometry. These four active components from Chinese herbal medicines showed both 1:1 and 1:2 binding stoichiometries, independent on the alkaloid-to-DNA ratios. Binding affinities in the order of palmatine> or =jatrorrhizine>coptisine>berberine with d(AAGAATTCTT)(2) were obtained. Additionally, the preliminary results indicated that berberine had some sequence selectivities.     

Spectrometric studies of cytotoxic protoberberine alkaloids binding to double-stranded DNA

The noncovalent complexes of five cytotoxic protoberberine alkaloids, that is, berberine, palmatine, jatrorrhizine, coptisine, and berberrubine with several double-stranded oligodeoxynucleotides were systematically investigated by using electrospray ionization mass (ESI-MS) and fluorescence spectrometric methods, with the aim of establishing the structure-activity relationships. ESI-MS spectrometric studies indicated that these five alkaloids showed both 1:1 and 1:2 binding stoichiometries with d(AAGAATTCTT)(2), d(AAGGATCCTT)(2), and d(AAGCATGCTT)(2). Their relative binding affinities toward these three double-stranded DNA were semi-quantitatively evaluated by measuring the ratios of the complex signals ([ds+alkaloid-5H](4-)+[ds+2alkaloid-6H](4-)) to those of the duplexes ([ds-4H](4-)) and also by ESI-MS competitive binding experiments. These experiments established the relative binding affinities of five protoberberine alkaloids in the order of palmatine>jatrorrhizine>coptisine>berberine>berberrubine with d(AAGAATTCTT)(2), palmatinecoptisine>jatrorrhizineberberine>berberrubine with d(AAGGATCCTT)(2) and palmatine>jatrorrhizinecoptisine>berberine>berberrubine with d(AAGCATGCTT)(2). Significantly, these alkaloids except berberrubine bound to d(AAGGATCCTT)(2) and d(AAGCATGCTT)(2) with the affinities comparable to Hoechst 33258, a typical DNA minor groove binder. The relative binding preferences of berberine, palmatine, and coptisine with these three double-stranded DNA were further quantitatively assessed by their association constants obtained from fluorescence titration experiments. The values revealed the order of relative binding affinities as berberine>coptisine>palmatine with d(AAGAATTCTT)(2) and coptisine>berberine>palmatine with d(AAGGATCCTT)(2) and d(AAGCATGCTT)(2). These results were not in full agreement with those obtained from ESI-MS experiments, maybe due to the different measuring solution conditions. The results from ESI-MS and fluorescence titration experiments indicated that the sequence selectivities of these five alkaloids were not significant and remarkable AT- or GC-rich DNA binding preferences were not obtained, in contrast to the report that berberine binds preferentially to AT-rich DNA. To provide further insight into the sequence selectivities, the association constants of berberine with d(AAGATATCTT)(2), 5'-AAGTAATCTT-3'/5'-AAGATTACTT-3', d(AAGGGCCCTT)(2), d(AAGGCGCCTT)(2), and 5'-AAGGCCGCTT-3'/5'-AAGCGGCCTT-3', that is double helical DNA from AT-rich to GC-rich sequences, were further measured by fluorescence titration methods. No significant differences in their association constants were observed, suggesting that berberine showed no remarkable sequence selectivities.     

Synthesis and DNA-binding affinities of protoberberine-based multivalent agents

Three novel berberine derivatives bearing two, three, and four primary amino groups at C(9), respectively, were synthesized and characterized on the basis of 1H- and 13C-NMR, MS, and HR-MS data. Their non-covalent binding with calf thymus (CT) DNA was investigated by means of spectrophotometric titration and ethidium bromide (EB) displacement experiments. The results indicated that these multivalent berberine derivatives exhibited up to 130-fold enhanced binding affinities relative to berberine, and thus, may be exploitable as potent DNA-binding agents.     

Gbetagamma affinity for bovine rhodopsin is determined by the carboxyl-terminal sequences of the gamma subunit

Two native betagamma dimers, beta(1)gamma(1) and beta(1)gamma(2), display very different affinities for receptors. Since these gamma subunits differ in both primary structure and isoprenoid modification, we examined the relative contributions of each to Gbetagamma interaction with receptors. We constructed baculoviruses encoding gamma(1) and gamma(2) subunits with altered CAAX (where A is an aliphatic amino acid) motifs to direct alternate or no prenylation of the gamma chains and a set of gamma(1) and gamma(2) chimeras with the gamma(2) CAAX motif at the carboxyl terminus. All the gamma constructs coexpressed with beta(1) in Sf9 cells yielded beta(1)gamma dimers, which were purified to near homogeneity, and their affinities for receptors and Galpha were quantitatively determined. Whereas alteration of the isoprenoid of gamma(1) from farnesyl to geranylgeranyl and of gamma(2) from geranylgeranyl to farnesyl had no impact on the affinities of beta(1)gamma dimers for Galpha(t), the non-prenylated beta(1)gamma(2) dimer had significantly diminished affinity. Altered prenylation resulted in a <2-fold decrease in affinity of the beta(1)gamma(2) dimer for rhodopsin and a <3-fold change for the beta(1)gamma(1) dimer. In each case with identical isoprenylation, the beta(1)gamma(2) dimer displayed significantly greater affinity for rhodopsin compared with the beta(1)gamma(1) dimer. Furthermore, dimers containing chimeric Ggamma chains with identical geranylgeranyl modification displayed rhodopsin affinities largely determined by the carboxyl-terminal one-third of the protein. These results indicate that isoprenoid modification of the Ggamma subunit is essential for binding to both Galpha and receptors. The isoprenoid type influences the binding affinity for receptors, but not for Galpha. Finally, the primary structure of the Ggamma subunit provides a major contribution to receptor binding of Gbetagamma, with the carboxyl-terminal sequence conferring receptor selectivity.     

DNA-binding affinities and sequence specificities of protoberberine alkaloids and their demethylated derivatives: a comparative study

Berberrubine (1a), jatrorubine (2a), and palmatrubine (3a) have been chemically prepared by partial demethylation of berberine (1), jatrorrhizine (2), and palmatine (3), respectively. Their interactions with calf thymus (CT) DNA, poly(dA-dT)poly(dA-dT), poly(dG-dC)poly(dG-dC), and eight AT-rich 12-mer double-stranded DNAs have been investigated by means of competitive ethidium bromide (EB) displacement experiments. The results showed that DNA-binding affinities of these protoberberine alkaloids have been significantly improved by partial demethylation, and that all of these alkaloids have the preferable binding affinities with AT-rich DNA. Especially, the sequence specificities of DNA-binding of demethylated derivatives 1a, 2a, and 3a had changed to a certain extent when compared with the parent alkaloids 1, 2, and 3, respectively. The binding mode of these alkaloids was further confirmed by UV spectroscopic titration experiments. All the compounds bind to double-stranded DNA most probably via an intercalating mode.     

Kinetic investigations of the quaternary enhancement effect and alpha/beta differences in binding the last oxygen to hemoglobin tetramers and dimers

Analysis of O2 binding equilibria by two independent groups has suggested that the affinity for binding the fourth O2 to Hb tetramers is very high, about 800-1200 cal/mol higher than that of dimers (Chu, A. H., Turner, B. W., and Ackers, G. K. (1984) Biochemistry 23, 604-167; Di Cera, E., Robert, C. H., and Gill, S. J. (1987) Biochemistry 26, 4003-4008). Recently, Gibson and Edelstein challenged the reality of the quaternary enhancement effect, based on kinetic data (Gibson, Q. H., and Edelstein, S. J. (1987) J. Biol. Chem. 262, 516-519). However, these studies failed to directly address the key issue of the relative affinities of dimers and alpha 2 beta 2(O2)3. Furthermore, the extent to which alpha/beta differences influence these results remains an open question. Using partial laser photolysis and O2/CO replacement techniques we have, for the first time, resolved the rates of O2 association and dissociation to both alpha and beta chains within "R state" tetramers and dimers. We find that the beta chains are faster than alpha for both O2 binding (approximately 2-fold) and release (approximately 3-fold). The kinetically determined O2 affinities derived from these data are essentially identical for dimers and alpha 2 beta 2(O2)3. That is, the data do not show significant quaternary enhancement and suggest that the equilibrium data have both overestimated the affinity of alpha 2 beta 2(O2)3 and underestimated the affinity of dimers. The significance of and possible origins for the discrepancy between equilibrium and kinetic data are discussed.     

Binding and reversible denaturation of double-stranded DNA by Ff gene 5 protein

The gene 5 protein (g5p) from Ff filamentous virus is a model single-stranded DNA (ssDNA) binding protein that has an oligonucleotide/oligosaccharide binding (OB)-fold structure and binding properties in common with other ssDNA-binding proteins. In the present work, we use circular dichroism (CD) spectroscopy to analyze the effects of amino acid substitutions on the binding of g5p to double-stranded DNA (dsDNA) compared to its binding to ssDNA. CD titrations of poly[d(A). d(T)] with mutants of each of the five tyrosines of the g5p showed that the 229-nm CD band of Tyr34, a tyrosine at the interface of adjacent protein dimers, is reversed in sign upon binding to the dsDNA, poly[d(A). d(T)]. This effect is like that previously found for g5p binding to ssDNAs, suggesting there are similarities in the protein-protein interactions when g5p binds to dsDNA and ssDNA. However, there are differences, and the possible perturbation of a second tyrosine, Tyr41, in the complex with dsDNA. Three mutant proteins (Y26F, Y34F, and Y41H) reduced the melting temperature of poly[d(A). d(T)] by 67 degrees C, but the wild-type g5p only reduced it by 2 degrees C. This enhanced ability of the mutants to denature dsDNA suggests that their binding affinities to dsDNA are reduced more than are their binding affinities to ssDNA. Finally, we present evidence that when poly[d(A). d(T)] is melted in the presence of the wild-type, Y26F, or Y34F proteins, the poly[d(A)] and poly[d(T)] strands are separately sequestered such that renaturation of the duplex is facilitated in 2 mM Na(+).     

Ultrastructure and function of dimeric, soluble intercellular adhesion molecule-1 (ICAM-1)

Previous studies have demonstrated dimerization of intercellular adhesion molecule-1 (ICAM-1) on the cell surface and suggested a role for immunoglobulin superfamily domain 5 and/or the transmembrane domain in mediating such dimerization. Crystallization studies suggest that domain 1 may also mediate dimerization. ICAM-1 binds through domain 1 to the I domain of the integrin alpha(L)beta(2) (lymphocyte function-associated antigen 1). Soluble C-terminally dimerized ICAM-1 was made by replacing the transmembrane and cytoplasmic domains with an alpha-helical coiled coil. Electron microscopy revealed C-terminal dimers that were straight, slightly bent, and sometimes U-shaped. A small number of apparently closed ring-like dimers and W-shaped tetramers were found. To capture ICAM-1 dimerized at the crystallographically defined dimer interface in domain 1, cysteines were introduced into this interface. Several of these mutations resulted in the formation of soluble disulfide-bonded ICAM-1 dimers (domain 1 dimers). Combining a domain 1 cysteine mutation with the C-terminal dimers (domain 1/C-terminal dimers) resulted in significant amounts of both closed ring-like dimers and W-shaped tetramers. Surface plasmon resonance studies showed that all of the dimeric forms of ICAM-1 (domain 1, C-terminal, and domain 1/C-terminal dimers) bound similarly to the integrin alpha(L)beta(2) I domain, with affinities approximately 1.5--3-fold greater than that of monomeric ICAM-1. These studies demonstrate that ICAM-1 can form at least three different topologies and that dimerization at domain 1 does not interfere with binding in domain 1 to alpha(L)beta(2).     

Bivalent ligand approach on 4-[2-(3-methoxyphenyl)ethyl]-1-(2-methoxyphenyl)piperazine: synthesis and binding affinities for 5-HT(7) and 5-HT(1A) receptors

We here report on the synthesis and binding properties at 5-HT(7) and 5-HT(1A) receptors of ligands 3-12, that were designed according to the 'bivalent ligand' approach. Two moieties of the 5-HT(7)/5-HT(1A) ligand 4-[2-(3-methoxyphenyl)ethyl]-1-(2-methoxyphenyl)piperazine (1) were linked through their 3-methoxy substituent by polymethylene chains of variable length, with the aim to increase the affinity for 5-HT(7) receptor and the selectivity over 5-HT(1A) receptors. In the best cases, the dimers showed affinities for 5-HT(7) receptors as high as the monomer with no improvement in selectivity. Some dimers displayed 5-HT(1A) receptor affinities slightly higher than monomer 1.     

Lipid-lowering effect of berberine in human subjects and rats

Due to serious adverse effects and the limited effectiveness of currently available pharmacological therapies for obesity, many research efforts have focused on the development of drugs from natural products. Our previous studies demonstrated that berberine, an alkaloid originally isolated from traditional Chinese herbs, prevented fat accumulation in vitro and in vivo. In this pilot study, obese human subjects (Caucasian) were given 500 mg berberine orally three times a day for twelve weeks. The efficacy and safety of berberine treatment was determined by measurements of body weight, comprehensive metabolic panel, blood lipid and hormone levels, expression levels of inflammatory factors, complete blood count, and electrocardiograph. A Sprague-Dawley rat experiment was also performed to identify the anti-obesity effects of berberine treatment. The results demonstrate that berberine treatment produced a mild weight loss (average 5 lb/subject) in obese human subjects. But more interestingly, the treatment significantly reduced blood lipid levels (23% decrease of triglyceride and 12.2% decrease of cholesterol levels) in human subjects. The lipid-lowering effect of berberine treatment has also been replicated in the rat experiment (34.7% decrease of triglyceride and 9% decrease of cholesterol level). Cortisol, calcitriol, ACTH, TSH, FT4, and SHBG levels were not significantly changed following 12 weeks of berberine treatment. However, there was interestingly, an increase in calcitriol levels seen in all human subjects following berberine treatment (mean 59.5% increase, p=0.11). Blood inflammatory factors (CRP, IL-6, TNFα, COX-2) and erythrocyte sedimentation rate (ESR) were not significantly affected by treatment with berberine. Tests of hematological, cardiovascular, liver, and kidney function following berberine treatment showed no detrimental side effects to this natural compound. Collectively, this study demonstrates that berberine is a potent lipid-lowering compound with a moderate weight loss effect, and may have a possible potential role in osteoporosis treatment/prevention.     

Binding of the 9-O-N-aryl/arylalkyl Amino Carbonyl Methyl Substituted Berberine Analogs to tRNAphe

Background

Three new analogs of berberine with aryl/arylalkyl amino carbonyl methyl substituent at the 9-position of the isoquinoline chromophore along with berberrubine were studied for their binding to tRNA^phe by wide variety of biophysical techniques like spectrophotometry, spectrofluorimetry, circular dichroism, thermal melting, viscosity and isothermal titration calorimetry.

Methodology/Principal Findings

Scatchard binding isotherms revealed that the cooperative binding mode of berberine was propagated in the analogs also. Thermal melting studies showed that all the 9-O-N-aryl/arylalkyl amino carbonyl methyl substituted berberine analogs stabilized the tRNA^phe more in comparison to berberine. Circular dichroism studies showed that these analogs perturbed the structure of tRNA^phe more in comparison to berberine. Ferrocyanide quenching studies and viscosity results proved the intercalative binding mode of these analogs into the helical organization of tRNA^phe. The binding was entropy driven for the analogs in sharp contrast to the enthalpy driven binding of berberine. The introduction of the aryl/arylalkyl amino carbonyl methyl substituent at the 9-position thus switched the enthalpy driven binding of berberine to entropy dominated binding. Salt and temperature dependent calorimetric studies established the involvement of multiple weak noncovalent interactions in the binding process.

Conclusions/Significance

The results showed that 9-O-N-aryl/arylalkyl amino carbonyl methyl substituted berberine analogs exhibited almost ten folds higher binding affinity to tRNA^phe compared to berberine whereas the binding of berberrubine was dramatically reduced by about twenty fold in comparison to berberine. The spacer length of the substitution at the 9-position of the isoquinoline chromophore appears to be critical in modulating the binding affinities towards tRNA^phe.     

Role of HU proteins in forming and constraining supercoils of chromosomal DNA inEscherichia coli

Induction of supercoiling in plasmid DNA by HU heterotypic and homotypic dimers, a mutant HU-2 (HupAN12), HBs and HB1 proteins with different DNA-binding affinities was investigated in vitro. The abilities of these proteins to induce supercoiling in DNA correlated with their affinities for DNA. Stoichiometrical analysis of HU heterodimers bound to DNA in the complex restraining the negative torsional tension of DNA showed that 12–13 dimers account for a single superhelical turn. The number of supercoils in the plasmid in vivo decreased on inhibition of DNA gyrase with coumermycin, reaching a steady-state level that indicated the existence of a compartment of restrained supercoils. The size of the restrained compartment was reduced in the absence of HU, indicating the participation of HU in constituting this fraction, and was larger on overproduction of HU-2 in the cells. An increased level of DNA gyrase, expressed from a plasmid carrying bothgyr genes, in the cells did not compensate for the deficit of the restrained supercoils caused by HU deficiency, indicating seeming distinct and unrelated action of HU and DNA gyrase in introducing and constraining supercoiling of intracellular DNA.     

Spectroscopic probing of recognition of the G-quadruplex in c-kit promoter by small-molecule natural products

The c-kit oncogene plays important roles in cell growth and proliferation which is associated with many human tumors. In this study, electrospray ionization mass spectrometry (ESI-MS) and circular dichroism (CD) spectroscopy were used to evaluate the formation and recognition of the G-quadruplex by d(AGGGAGGGCGCTGGGAGGAGGG) in the promoter region of the c-kit oncogene. Among the twelve small natural molecules studied, three crescent-shaped small molecules (chelerythrine, jatrorrhizine and berberine, named as P1-P3) and one flexible cyclic small molecule (fangchinoline, named as P4) were found to bind to the G-quadruplex with high affinities. The melting experiments demonstrate that P1-P4 can significantly enhance the stability of the G-quadruplex with the ordering of P1≈P4>P3>P2. Further insight into the binding mode of small molecules with the G-quadruplex by Autodock3 analysis reveals that P1-P3 prefer the end-stacking mode with the G-quadruplex through π-π interaction and P4 prefers to insert into the groove outside the G-tetrads. Thus, our research finds that four ligands (P1-P4) from small natural molecules have high affinity to, and can significantly enhance the stability of the G-quadruplex in the promoter region of the c-kit oncogene.     

Synthesis and antifungal activity of a novel series of 13-(4-isopropylbenzyl)berberine derivatives

By replacing the methyl group of 13-(4-isopropylbenzyl)berberine 2 with various acyl, alkyl, and benzyl groups via the demethylated intermediate, 13-(4-isopropylbenzyl)berberrubine 4, a novel series of 9-O-alkyl-13-(4-isopropylbenzyl)berberine derivatives was synthesized and examined for antifungal activities against various human pathogenic fungi. The introduction of various alkyl groups led to enhanced antifungal activity but that of acyl groups resulted in decrease of the activity. Among them, 9-O-butyl-13-(4-isopropylbenzyl)berberine 6d exhibited the most potent antifungal activities against Cryptococcus neoformans, Candida species (MIC=0.25-1 μg/ml), and Aspergillus species (MIC=2-4 μg/ml). The compound was found to be relatively safe up to 900 mg/kg in oral administration to mice.     

Studies on the interaction of alpha subunits of GTP-binding proteins with beta gamma dimers.

The interaction of several preparations of purified beta gamma dimers with two types of guanosine-nucleotide-binding-regulatory-(G)-protein alpha subunits, a recombinant bv alpha i3, made in Sf9 Spodoptera frugiperda cells by the baculovirus (bv) expression system, and alpha s, either purified from human erythrocyte Gs-type GTP-binding protein, and activated by NaF/AlCl3, or unpurified as found in a natural membrane, were studied. The beta gamma dimers used were from bovine rod outer segments (ROS), bovine brain, human erythrocytes (hRBC) and human placenta and contained distinct ratios of beta subunits that, upon electrophoresis, migrated as two bands with approximate M(r) of 35,000 and 36,000, as well as distinct complements of at least two gamma subunits each. When tested for their ability to recombine at submaximal concentrations with bv alpha i3, ROS, brain, hRBC and placental beta gamma dimers exhibited apparent affinities that were the same within a factor of two. When bovine brain, placental and ROS beta gamma dimers were tested for their ability to promote deactivation of Gs, brain and placental beta gamma dimers were equipotent and at least 10-fold more potent than that of ROS beta gamma dimers; likewise, brain beta gamma and placental dimers were equipotent in inhibiting GTP-activated and GTP-plus-isoproterenol-activated adenylyl cyclase, while ROS beta gamma dimers were less potent when assayed at the same concentration. The possibility that different alpha subunits may distinguish subsets of beta gamma dimers from a single cell was investigated by analyzing the beta gamma composition of three G proteins, Gs, Gi2 and Gi3, purified to near homogeneity from a single cell type, the human erythrocyte. No evidence for an alpha-subunit-specific difference in beta gamma composition was found. These findings suggests that, in most cells, alpha subunits interact indistinctly with a common pool of beta gamma dimers. However, since at least one beta gamma preparation (ROS) showed unique behavior, it is clear that there may be mechanisms by which some combinations of beta gamma dimers may exhibit selectivity for the alpha subunits they interact with.     

A comparative conformational study of thymidylyl(3'----5')-thymidine, thymidylyl(3'----5')-5'-thio-5'- deoxythymidine and thymidinylacetamido-[3'(O)----5'(C)]-5'-deoxythymidine

A comparative 270 MHz NMR spectroscopic study on the solution structure of the dimer d(TpT) 1, and its two analogues, namely, d(TpST) 2, and NH2d(TcmT) 4 has been reported. Analysis of chemical shifts and coupling constants indicate that: (i) The sugar moieties of the constituent nucleotides are not affected by modification of the internucleotide linkages and adopt preferentially an S-type conformation. (ii) The C4'-C5' bond in the pT part of the modified dimers 2 and 4 shows a large conformational freedom (gamma+ = 32% and 35%, respectively) compared to 1 (gamma+ = 75%). (iii) The population of the trans conformer about C5'-O5' is less important in d(TpST) 2 compared to d(TpT) 1. (iv) The C3'-O3' bond in 2 adopts a trans conformation as in 1. (v) The glycosidic bonds in the modified dimers 2 and 4 showed preferential syn conformation. UV and CD data show that the modified dimers 2 and 4 have poor tendency to stack intramolecularly, they also base pair less efficiently with d(ApA) as compared to d(TpT) 1.     

Di-, tri- and tetrameric single chain Fv antibody fragments against human CD19: effect of valency on cell binding.

Single chain variable fragments (scFv) of the murine monoclonal antibody HD37 specific to human B-cell antigen CD19 were constructed by joining the VH and VL domains with linkers of 18, 10, 1 and 0 residues. ScFv-18 formed monomers, dimers and small amounts of tetramers; scFv-10 formed dimers and small amounts of tetramers; scFv-1 formed exclusively tetramers; scFv-0 formed exclusively trimers. The affinities of the scFv-10 (diabody) and scFv-1 (tetrabody) were approximately 1.5- and 2.5-fold higher, respectively, than that of the scFv-0 (triabody). The tetrabody displayed a significantly prolonged association with cell-bound antigen (t1/2 cell surface retention at 37 degrees C of 26.6 min) compared to both the diabody (13.3 min) and triabody (6.7 min). This increase in avidity of the tetrabody combined with its larger size could prove to be particularly advantageous for imaging and the immunotherapy of B-cell malignancies.