The linear mitochondrial plasmid pClK1 of the phytopathogenic fungus Claviceps purpurea may code for a DNA polymerase and an RNA polymerase

Summary Plasmid pClK1, a linear mitochondrial plasmid of Claviceps purpurea, was completely sequenced. The sequence contains two long open reading frames (ORF1, 3291 bp; ORF2, 2910 bp), and at least four smaller ORFs. The potential polypeptide derived from ORF1 shows homology to the family B type DNA polymerases. The product of ORF2 has significant homology to the mitochondrial RNA polymerase of yeast and RNA polymerases from bacteriophages. ORF1 and ORF2 show homology to URF3 and URF1 of the maize plasmids S1 and S2, respectively. No homology to any published protein sequence was found for the smaller ORFs. The origin of the terminal protein attached to the 5 ends of pClK1 remains open; several alternatives for its origin are discussed. The sequence data as a whole confirm the virus-like character of pClK1 already postulated from structural properties. Thus pClK1 together with S plasmids of maize and several other linear plasmids make up a distinct class of DNA species of plants and fungi probably derived from a common virus-like ancestor.     

Nucleotide sequence of the maize chloroplast rpo B/C1/C2 operon: Comparison between the derived protein primary structures from various organisms with respect to functional domains

Summary The genes (rpo B/C₁/C₂) coding for the , , subnits of maize (Zea mays) chloroplast RNA polymerase have been located on the plastome and their nucleotide sequences established. The operon is part of a large inversion with respect to the tobacco and spinach chloroplast genomes and is flanked by the genes trnC and rps2. Notable features of the nucleotide sequence are the loss of an intron in rpoC₁, and an insertion of approximately 450 by in rpOC₂ compared to the dicotyledons tobacco, spinach and liver-wort. The derived amino acid sequence of this additional monocotyledon specific sequence is characterized by acidic heptameric repeat units containing stretches of glutamic acid, tyrosines and leucines with regular spacing. Other structural motifs, such as a nucleotide binding domain in the subunit and a zinc finger in the subunit, are compared at the amino acid level throughout the RNA polymerase subunits with the enzymes from other organisms in order to identify functionally important conserved regions.The sequence data presented in this paper will appear in the EMBL/Gen Bank/DDBJ Nucleotide Databases under the accession number X17318     

Mapping and characterization of polymorphism in mtDNA of Cryphonectria parasitica: evidence of the presence of an optional intron

The mitochondrial DNA (mtDNA) of the filamentous ascomycete Cryphonectria parasitica is large and polymorphic so, to better understand the nature of the polymorphisms within populations, a small collection of Italian strains of the fungus was examined. Known mtDNA polymorphisms were mapped and found to cluster in four regions of the mtDNA molecule, particularly in the RFLP region 2 where five different mtDNA haplotypes out of 13 strains were identified. This region included an area of 8.4kbp which was entirely sequenced in strain Ep155 showing the presence of two introns. An internal 3.2kbp portion was sequenced also in six additional strains. Sequence comparison of the C. parasitica mitochondrial intronic ORFs revealed similarities to known endonucleases such as those of Podospora anserina and Neurospora crassa. DNA sequence analysis showed that three polymorphisms of this mtDNA region within this population of 12 strains were due to the optional presence in the ND5 gene of an intron and of an intervening sequence within the intron. Evidence was also found within this population of mixed mitochondrial types within a single strain.     

Characterization of the cleavage site and the recognition sequence of the I-CreI DNA endonuclease encoded by the chloroplast ribosomal intron of Chlamydomonns reinhardtii

Summary The chloroplast ribosomal intron of Chlamydomonas reinhardtii encodes a sequence-specific DNA endonuclease (I-CreI), which is most probably involved in the mobility of this intron. Here we show that I-CreI generates a 4 by staggered cleavage just downstream of the intron insertion site. The I-CreI recognition sequence is 19–24 by in size and is located asymmetrically around the intron insertion site. Screening of natural variants of the I-CreI recognition sequence indicates that the I-CreI endonuclease tolerates single and even multiple base changes within its recognition sequence.     

DNA sequences of tobacco chloroplast genes for tRNASer (GGA), tRNAThr (UGU), tRNALeu (UAA), tRNAPhe (GAA): the tRNALeu gene contains a 503 bp intron

Summary The location and nucleotide sequence of tobacco chloroplast genes for tRNA^Ser (GGA), tRNA^Thr (UGU), tRNA^Leu (UAA) and tRNA^Phe (GAA) (trnS-GGA, trnT-UGU, trnL-UAA and trnF-GAA, respectively) have been determined. These genes are located in the 10 kbp BamHI fragment which lies in the middle of the large single-copy region of the chloroplast DNA. The gene order is trnS-trnT-trnL-trnF. The trnS, trnL and trnF are encoded on the same strand while the trnT on the opposite strand. The trnL contains a 503 bp intron like maize and broad bean trnL-UAAs.     

The roles of RNA polymerase and RNAase I in stable RNA degradation in Escherichia coli carrying the srnB+ gene

In Escherichia coli cells carrying the srnB⁺ gene of the F plasmid, rifampin, added at 42°C, induces the extensive rapid degradation of the usually stable cellular RNA (Ohnishi, Y., (1975) Science 187, 257–258; Ohnishi, Y., Iguma, H., Ono, T., Nagaishi, H. and Clark, A.J. (1977) J. Bacteriol. 132, 784–789). We have studied further the necessity for rifampin and for high temperature in this degradation. Streptolidigin, another inhibitor of RNA polymerase, did not induce the RNA degradation. Moreover, the stable RNA of some strains in which RNA polymerase is temperature-sensitive did not degrade at the restrictive temperature in the absence of rifampin. These data suggest that rifampin has an essential role in the RNA degradation, possibly by the modification of RNA polymerase function. A protein (M_r 12 000) newly synthesized at 42°C in the presence of rifampin appeared to be the product of the srnB⁺ gene that promoted the RNA degradation. In a mutant deficient in RNAase I, the extent of the RNA degradation induced by rifampin was greatly reduced. RNAase activity of cell-free crude extract from the RNA-degraded cells was temperature-dependent. The RNAase was purified as RNAase I in DEAE-cellulose column chromatography and Sephadex G-100 gel filtration. Both in vivo and with purified RNAase I, a shift of the incubation mixture from 42 to 30°C, or the addition of Mg²⁺ ions, stopped the RNA degradation. Thus, an effect on RNA polymerase seems to initiate the expression of the srnB⁺ gene and the activation of RNAase I, which is then responsible for the RNA degradation of E. coli cells carrying the srnB⁺ gene.     

Sequence,proposed secondary structure,and phylogenetic analysis of the chloroplast 5S rRNA gene of the brown alga Pylaiella littoralis (L.) Kjellm

Summary The chloroplast 5S rRNA gene of the brown alga Pylaiella littoralis (L.) Kjellm has been cloned and sequenced. The gene is located 23 bp downstream from the 3 end of the 23S rRNA gene. The sequence of the gene is as follows: GGTCTTG GTGTTTAAAGGATAGTGGAACCACATTGAT CCATATCGAACTCAATGGTGAAACATTATT ACAGTAACAATACTTAAGGAGGAGTCCTTT GGGAAGATAGCTTATGCCTAAGAC. A secondary structure model is proposed, and compared to those for the chloroplast 5S rRNAs of spinach and the red alga Porphyra umbilicalis. Cladograms based on chloroplast and bacterial 5S rRNA and rRNA gene sequences were constructed using the MacClade program with a user-defined character transformation in which transitions and transversions were assigned unequal step values. The topology of the resulting cladogram indicates a polyphyletic origin for photosynthetic organelles.Offprint requests to: S. Loiseaux-de Goër     

Differential regulation of the two rice ferritin genes (OsFER1 and OsFER2)

Iron is essential to plants. However, when free and in excess, iron can catalyze the formation of oxygen free radicals. Ferritin, a protein capable of storing up to 4500 atoms of iron, can act as an iron buffer inside plant cells. Using a strategy based in amplicon size difference, we were able to analyze the expression profile of the two rice ferritin genes (OsFER1 and OsFER2). Both genes are expressed, although with different regulation and organ distribution. Exposure to copper, Paraquat, SNP and excess iron led to accumulation of ferritin mRNA, remarkably of OsFER2. The iron-induced expression was abolished by treatment with GSH, indicating that the induction observed is dependent of an oxidative step. OsFER2 mRNA levels in rice flag leaves and panicles at different reproductive stages were higher than OsFER1 mRNA levels. No ferritin mRNA was detected in rice seeds. However, imbibition under light led to ferritin expression, which was abolished when seeds were kept in the dark, suggesting a light-regulated induction. Ferritin mRNA accumulation was seen in the dark only when seeds were germinated in the presence of externally supplied iron. We suggest that the primary role of rice ferritins is related to defense against iron-mediated oxidative stress.     

The 5S ribosomal RNA sequences of a red algal rhodoplast and a gymnosperm chloroplast. Implications for the evolution of plastids and cyanobacteria

Summary The 5S ribosomal RNA sequences have been determined for the rhodoplast of the red algaPorphyra umbilicalis and the chloroplast of the coniferJuniperus media. The 5S RNA sequence of theVicia faba chloroplast is corrected with respect to a previous report. A survey of the known sequences and secondary structures of 5S RNAs from plastids and cyanobacteria shows a close structural similarity between all 5S RNAs from land plant chloroplasts. The algal plastid 5S RNAs on the other hand show much more structural diversity and have certain structural features in common with bacterial 5S RNAs. A dendrogram constructed from the aligned sequences by a clustering algorithm points to a common ancestor for the present-living cyanobacteria and the land plant plastids. However, the algal plastids branch off at an early stage within the plastid-cyanobacteria cluster, before the divergence between cyanobacteria and land plant chloroplasts. This evolutionary picture points to the occurrence of multiple endosymbiotic events, with the ancestors of the present algal plastids already established as photosynthetic endosymbionts at a time when the ancestors of the present land plant chloroplasts were still free-living cells.     

Structural insight into the essential PB1–PB2 subunit contact of the influenza virus RNA polymerase

Influenza virus RNA‐dependent RNA polymerase is a multi‐functional heterotrimer, which uses a ‘cap‐snatching’ mechanism to produce viral mRNA. Host cell mRNA is cleaved to yield a cap‐bearing oligonucleotide, which can be extended using viral genomic RNA as a template. The cap‐binding and endonuclease activities are only activated once viral genomic RNA is bound. This requires signalling from the RNA‐binding PB1 subunit to the cap‐binding PB2 subunit, and the interface between these two subunits is essential for the polymerase activity. We have defined this interaction surface by protein crystallography and tested the effects of mutating contact residues on the function of the holo‐enzyme. This novel interface is surprisingly small, yet, it has a crucial function in regulating the 250 kDa polymerase complex and is completely conserved among avian and human influenza viruses.     

The novel function of the Saccharomyces cerevisiaeCBP2 gene as a splicing factor essential to excision of the Saccharomyces douglasiiLSU intron in vivo

In the yeast Saccharomyces cerevisiae, the product of the nuclear gene CBP2 is required exclusively for the splicing of the terminal intron of the mitochondrial cytochrome b gene. The homologous gene from the related yeast, Saccharomyces douglasii, has been shown to be essential for respiratory growth in the presence of a wild-type S. douglasii mitochondrial genome and dispensable in the presence of an intronless mitochondrial genome. The two CBP2 genes are functionally interchangeable although the target intron of the S. cerevisiaeCBP2 gene is absent from the S. douglasii mitochondrial genome. To determine the function of the CBP2 gene in S. douglasii mitochondrial pre-RNA processing we have constructed and analyzed interspecific hybrid strains between the nuclear genome of S. cerevisiae carrying an inactive CBP2 gene and S. douglasii mitochondrial genomes with different intron contents. We have demonstrated that inactivation of the S. cerevisiaeCBP2 gene affects the maturation of the S. douglasii LSU pre-RNA, leading to a respiratory-deficient phenotype in the hybrid strains. We have shown that the CBP2 gene is essential for excision of the S. douglasii LSU intron in vivo and that the gene is dispensable when this intron is deleted or replaced by the S. cerevisiae LSU intron. Received: 1 October 1997 / Accepted: 18 November 1997