Ramularia collo-cygni: the biology of an emerging pathogen of barley.

Ramularia collo-cygni is now recognized as an important pathogen of barley in Northern Europe and New Zealand. It induces necrotic spotting and premature leaf senescence, leading to loss of green leaf area in crops, and can result in substantial yield losses. The fungus produces a number of anthraquinone toxins called rubellins, which act as host nonspecific toxins with photodynamic activity. These toxins induce lipid peroxidation and are possibly the cause of the chlorosis and necrosis observed in leaves infected with R. collo-cygni. The fact that the fungus can remain latent in barley plants until flowering, coupled with its very slow growth in vitro, makes it difficult to detect in crops. As a result, the epidemiology of this pathogen remains poorly understood. However, the recent development of rapid and reliable PCR methods for specific detection of R. collo-cygni offers the prospect of increased understanding of its epidemiology and improved disease control.     

A quantitative real‐time PCR assay for the detection of Ramularia collo‐cygni from barley (Hordeum vulgare)

Aims: The aim of this study was to develop a real‐time quantitative PCR test to recognize and quantify the DNA levels of the increasingly important barley pathogen Ramularia collo‐cygni. Methods and Results: The method described uses specifically designed primers and a molecular beacon probe based on an internal transcribed spacer (ITS) sequence. Pathogen extracted from barley leaves could be quantified to the picogram level in both leaves showing symptoms of infection and symptomless barley leaves. Conclusions: A relationship between R. collo‐cygni DNA levels and disease symptoms was established in spring barley under natural infection conditions. Significance and Impact of the Study: To our knowledge, this is the first report of a test of this type and makes an important contribution to studies into the life cycle of this pathogen.     

Variability of the Ramularia collo‐cygni Population in Central Europe

The genetic structure of the fungal barley pathogen Ramularia collo‐cygni (Rcc) population in Central Europe involving the isolates from the Czech Republic, the Slovak Republic, Germany and Swiss was determined using amplified fragment length polymorphism (AFLP) analysis. One hundred and eighty‐four markers were chosen to determine genetic and genotypic diversity and to test the hypothesis of random mating and population differentiation of Rcc isolates. Among the 337 isolates collected, the overall gene diversity was moderate ( = 0.216). The level of multilocus genotypic diversity was higher within populations than among them. All individuals had unique multilocus genotypes. Genetic differentiation was significant among populations in localities, but at a moderate level (θ = 0.12; P < 0.001), suggesting that gene flow is occurring among populations. The isolates from all twelve clusters produced by Structure were found in all local populations, although at different frequencies. Therefore, the inferred clusters did not represent geographical populations. Although the null hypothesis of random mating in Rcc populations was rejected, the high level of genotypic diversity suggests that the Rcc population structure appears to be generated by a mixed reproductive system including both asexual and sexual reproduction, along with a rather high migration rate.     

Development of a nested PCR detection procedure for Nectria fuckeliana direct from Norway spruce bark extracts

A pair of primers specific for Nectria fuckeliana, a bark infecting pathogen predominantly of Norway spruce (Picea abies), were designed from comparisons of nucleotide sequences of the nuclear ribosomal internal transcribed spacer (ITS) regions of nine isolates from Norway, Lithuania, Switzerland, Austria, Slovakia, Scotland (Larix sp.) and New Zealand (Pinus radiata), and other closely related nectriaceous species, including Neo. Neomacrospora, and 'N'. mammoidea, to which it exhibits taxonomic similarities. Complete ITS sequence homology was observed between each of the nine N. fuckeliana isolates, regardless of geographic provenance, including a previously published Danish strain. Primers Cct1 and Cct2 consistently amplified a single product of 360 bp from DNA prepared from 20 isolates covering the principle range of the disease from Central and Northern Europe, but not from other Neonectria, 'Nectria' or a range of species commonly encountered in forest ecosystems, as well as P. abies or P. radiata DNA. A quick, simple and efficient mechanical lysis procedure for the extraction of high quality total DNA from bark, coupled with post-extraction polyvinylpolypyrrolidone (PVPP) chromatography purification, is described to facilitate successful PCR detection of N. fuckeliana direct from bark extracts. Detection of N. fuckeliana from bark preparations was only possible following nested PCR of PVPP purified extracts using universal primers ITS5 and 4 in first round amplification. The identity of products from bark tissues was confirmed by Southern hybridisation and sequencing. Using the above procedure, positive diagnosis of N. fuckeliana was achievable within 5 h and has the potential for full exploitation as both a forest management and ecological research tool. As the DNA extraction procedure described here has been successful in application against other tree species, it has potential for incorporation into other molecular diagnostic systems for other microorganisms responsible for other wood or tree bark diseases.     

Direct-PCR Detection and Epidemiology of Ramularia collo-cygni Associated with Barley Necrotic Leaf Spots

Ramularia collo‐cygni (Sutton & Waller) is involved in a disease complex of barley characterized by the formation of necrotic spots on leaves. Isolation of this fungus is difficult, which complicates the study of its epidemiology and the aetiology of the disease complex. A new assay based on polymerase chain reaction (PCR) was developed to detect the presence of R. collo‐cygni (Rcc) without previous isolation of the fungus nor prior purification of DNA. Primers RC3 and RC5 were designed to amplify a 348 bp fragment of the internal transcribed spacer region of this pathogen. These primers were highly specific to Rcc, as no cross‐reactions were observed with other barley pathogens or saprobes commonly found on this crop. Amplification was possible from crude extracts (direct‐PCR), circumventing the need for a DNA purification. Detection of 1 fg of target DNA was achieved with a single PCR. This specific and sensitive assay was used to study the epidemiology of Rcc on winter and spring barley at two locations in Switzerland. Rcc was present on winter barley from snow melting until harvest and colonized gradually all leaf layers. It was also found on volunteers, which could, together with weeds, offer a survival possibility to the pathogen between two barley crops. The fungus was detected on spring barley only after it sporulated on winter barley, indicating that Rcc probably spreads from winter to spring barley. The hypothesis of Rcc being a seed‐borne pathogen can be tested more easily with this fast and reliable molecular tool, which may also find applications in barley breeding programmes and fungicide trials.     

Biosynthesis of photodynamically active rubellins and structure elucidation of new anthraquinone derivatives produced by Ramularia collo-cygni

Here we present the first isolation of the anthrachinone derivative rubellin A out of mycelium and culture filtrate of Ramularia collo-cygni. Furthermore, two compounds, rubellin E and 14-dehydro rubellin D were isolated and their structures elucidated. In comparison to the other rubellins, rubellin A shows increased photodynamic oxygen activation. By incorporating both [1-(13)C]-acetate and [2-(13)C]-acetate into the rubellins, we showed that such anthraquinone derivatives were biosynthesised via the polyketide pathway. The labelling pattern after being fed [U-(13)C(6)]-glucose proved the existence of fungal folding mode of the poly-beta-keto chain. The ability to produce rubellins is not limited to R. collo-cygni in the anamorph genus Ramularia.     

Rapid Detection of Phytophthora nicotianae in Infected Tobacco Tissues and Soil Samples Based on Its Ypt1 Gene

This paper describes the development of a polymerase chain reaction (PCR) assay for the detection of Phytophthora nicotianae , the causal agent of Phytophthora blight of tobacco and other plants. The PCR primers were designed based on a Ras-related protein ( Ypt 1) gene, and 115 isolates representing 26 species of Phytophthora and 29 fungal species of plant pathogens were used to test the specificity of the primers. PCR amplification with species-specific (Pn) primers resulted in a product of 389 bp only from isolates of P. nicotianae . The detection sensitivity with Pn primers was 1 ng of genomic DNA. Using Ypt 1F/ Ypt 1R as first-round amplification primers, followed by a second round using the primer pair Pn1/Pn2, a nested PCR procedure was developed, which increased the detection sensitivity 100-fold to 10 pg. PCR with the Pn primers could also be used to detect P. nicotianae from naturally infected tobacco tissues and soil. The PCR-based methods developed here could simplify both plant disease diagnosis and pathogen monitoring as well as guide plant disease management.     

Detection of Magnaporthe grisea in infested rice seeds using polymerase chain reaction

AIM: To develop a diagnostic assay based on polymerase chain reaction for the detection of Magnaporthe grisea from infested rice seeds. METHODS AND RESULTS: Primers were designed based on the nucleotide sequence of the mif 23, an infection-specific gene of M. grisea. The primers amplified target DNA from genetically and geographically diverse isolates of the pathogen. The lowest concentration of template DNA that led to amplification was 20 rhog. No PCR product was detected when DNA from other fungi was used, indicating the specificity of the primers. With this PCR based seed assay, M. grisea was detected in rice seedlots with infestation rates as low as 0.2%. CONCLUSION: The PCR detection of M. grisea is simple, rapid, specific, sensitive and suitable for the routine detection of the pathogen in infested seeds. SIGNIFICANCE AND IMPACT OF THE STUDY: Introduction of the blast fungus into new areas where it has not been previously recorded could be avoided by the detection of infested seedlots. A PCR-based seed assay could facilitate risk assessment of naturally infested rice seeds; help design management programs and optimize fungicide use.     

Two new species of Rhynchosporium

Rhynchosporium consists of two species, R. secalis and R. orthosporum. Both are pathogens of grasses with R. secalis infecting a variety of Poaceae hosts and R. orthosporum infecting Dactylis glomerata. Phylogenetic analyses of multilocus DNA sequence data on R. secalis isolates originating from cultivated barley, rye, triticale and other grasses, including Agropyron spp., Bromus diandrus and Hordeum spp., resolved the monophyletic groups into three species according to their respective hosts. Host specificity according to phylogenetic lineages was confirmed with pathogenicity studies. Because R. secalis was described first on rye this name is retained for Rhynchosporium isolates infecting rye and triticale. Rhynchosporium isolates infecting cultivated barley and other Hordeum spp. and Bromus diandrus belong to a distinct species, R. commune. Similarly isolates infecting Agropyron spp. represent a distinct species of Rhynchosporium, namely R. agropyri. A PCR-RFLP assay was developed as a rapid tool for species identification of R. secalis and R. commune.     

Molecular detection of Puccinia horiana Henn. the causal agent of Chrysanthemum white rust

Chrysanthemum white rust is one of the most important foliar diseases of pot chrysanthemum and is a quarantine pathogen in many countries. Under conducive environmental conditions, it has the potential to completely destroy susceptible cultivars. This is mainly avoided through frequent preventive fungicide applications. As part of a research program to develop a disease warning system, a molecular detection method was developed. To determine the nucleotide sequence of the nuclear rDNA-ITS (internal transcribed spacer) region of P. horiana, 56 isolates were collected between 2003 and 2006 from diseased commercial chrysanthemum plants from different national and international geographical areas. DNA was isolated from the basidiospores or teliospores from several isolates and the rDNA-ITS region was cloned and sequenced. Based on the limited variability in rDNA-ITS sequence between these isolates, several primer pairs were designed and tested for detection through conventional and real-time PCR. Specificity of detection was cross-checked against a variety of other fungi (saprophytes and other rusts) that may occur in the same environment, and against DNA of healthy chrysanthemum leaves. Using the best primers, the PCR-based methods successfully detected all the P. horiana isolates tested, while no signal was observed with other rust species up to 1 ng non target genomic DNA template. The limit of detection of P. horiana DNA in conventional, nested and real-time PCR was 10 pg, 10 fg and 10 fg, respectively. The DNA extraction method and PCR template concentration were optimized to maximize the recoverability of the pathogen from infected plant tissue. Using the optimized real-time PCR method, the pathogen could be detected in washed plant tissue, 9 hours after inoculation. Hence, this method allows detection of the P. horiana in any part of its latent stage and will also serve as a tool for studying the biology and epidemiology of the pathogen.     

PCR amplification of species-specific DNA sequences can distinguish among Phytophthora species.

We used PCR to differentiate species in the genus Phytophthora, which contains a group of devastating plant pathogenic fungi. We focused on Phytophthora parasitica, a species that can infect solanaceous plants such as tomato, and on Phytophthora citrophthora, which is primarily a citrus pathogen. Oligonucleotide primers were derived from sequences of a 1,300-bp P. parasitica-specific DNA segment and of an 800-bp P. citrophthora-specific segment. Under optimal conditions, the primers developed for P. parasitica specifically amplified a 1,000-bp sequence of DNA from isolates of P. parasitica. Primers for P. citrophthora similarly and specifically amplified a 650-bp sequence of DNA from isolates of P. citrophthora. Detectable amplification of these specific DNA sequences required picogram quantities of chromosomal DNA. Neither pair of primers amplified these sequences with DNAs from other species of Phytophthora or from the related genus Pythium. DNAs from P. parasitica and P. citrophthora growing in infected tomato stem tissue were amplified as distinctly as DNAs from axenic cultures of each fungal species. This is the first report on PCR-driven amplification with Phytophthora species-specific primers.     

Amplified fragment length polymorphism among Rhynchosporium secalis isolates collected from a single barley field in Syria

AFLP markers were used to measure the amount and distribution of genetic variation among Rhynchosporium secalis isolates on a microgeographical scale in Syria. Forty isolates hierarchically sampled from a single barley field were assayed for AFLP variation using primer combinations not previously tested in populations of the pathogen from Syria. In contrast to a previous study, which showed high clonality within field populations of R. secalis in Syria, the present study revealed a much higher level of genetic diversity, stressing the important roles that sampling strategies and the choice of primers/primer combinations play in the evaluation of genetic variation in R. secalis populations at a microgeographical scale. A high level of genetic variation was found to occur on a fine scale throughout the pathogen population examined, with 40 different haplotypes being identified among the 40 isolates sampled. Data were consistent with the hypothesis that the primary inoculum originated from a genetically diverse founding population, which may have consisted of ascospores of an as yet undescribed teleomorph and/or asexual spores of a highly mutable local population.     

Detection of the biocontrol agent Colletotrichum coccodes (183088) from the target weed velvetleaf and from soil by strain-specific PCR markers

Diagnostic molecular markers, generated from random amplified polymorphic DNA (RAPD) and used in polymerase chain reaction (PCR), were developed to selectively recognize and detect the presence of a single strain of the biocontrol fungus Colletotrichum coccodes (183088) on the target weed species Abutilon theophrasti and from soil samples. Several isolates of C. coccodes, 15 species of Colletotrichum, a variety of heterogeneous organisms and various plant species were first screened by RAPD-PCR, and a strain specific marker was identified for C. coccodes (183088). No significant sequence similarity was found between this marker and any other sequences in the databases. The marker was converted into a sequence-characterised amplified region (SCAR), and specific primer sets (N5F/N5R, N5Fi/N5Ri) were designed for use in PCR detection assays. The primer sets N5F/N5R and N5Fi/N5Ri each amplified a single product of 617 and 380 bp, respectively, with DNA isolated from strain 183088. The specificity of the primers was confirmed by the absence of amplified products with DNA from other C. coccodes isolates, other species representing 15 phylogenetic groups of the genus Colletotrichum and 11 other organisms. The SCAR primers (N5F/N5R) were successfully used to detect strain 183088 from infected velvetleaf plants but not from seeded greenhouse soil substrate or from soil samples originating from deliberate-released field experiments. The sensitivity of the assay was substantially increased 1000-fold when nested primers (N5Fi/N5Ri) were used in a second PCR run. N5Fi/N5Ri selectively detected strain 183088 from seeded greenhouse soils as well as from deliberate-released field soil samples without any cross-amplification with other soil microorganisms. This rapid PCR assay allows an accurate detection of C. coccodes strain 183088 among a background of soil microorganisms and will be useful for monitoring the biocontrol when released into natural field soils.     

A polymerase chain reaction-based test for Verticillium fungicola causing dry bubble disease on the cultivated mushroom,Agaricus bisporus

A polymerase chain reaction (PCR)-based test is described for the specific detection of Verticillium fungicola var. aleophilum (Vfa), the fungal pathogen causing dry bubble disease on the cultivated button mushroom, Agaricus bisporus. PCR primers were tailored to target a 162-bp arbitrary sequence in the Vfa genome. In PCR amplifications using the primer pair, all of 20 isolates of Vfa that had been collected during a 29-year period at commercial mushroom operations located primarily in North America were found to generate the diagnostic 162-bp DNA product. Conversely, the primers failed to produce the specific amplicon with DNA from isolates representing 5 other species of Verticillium, the pathogenic subspecies V. fungicola var. fungicola from Europe, and 12 other fungal species commonly inhabiting mushroom compost. A protocol was designed enabling a confirmed diagnosis of dry bubble disease in less than 3 h. The PCR-based test should find application for the rapid diagnosis and detection of the fungal pathogen in disease management programs and, potentially, in screening for on-the-farm sources of infection.     

Development of a SCAR marker for detection of Bipolaris sorokiniana causing spot blotch of wheat

Spot blotch of wheat caused by Bipolaris sorokiniana is an important disease of wheat, especially in slightly warm (25 ± 1 °C) and humid weather conditions. A quick and reliable PCR-based diagnostic assay has been developed to detect B. sorokiniana using a pathogen-specific marker derived from genomic DNA. A PCR-amplified band of 650 bp obtained in B. sorokiniana isolates using universal rice primer (URP 1F) was cloned in pGEMT easy vector and sequenced. Based on sequences, six primers were designed, out of which a primer pair RABSF1 (GGTCCGAGACAACCAACAA) and RABSR2 (AAAGAAAGCGGTCGACGTAA) amplified a sequence of 600 bp in B. sorokiniana isolates. The specificity of the marker when tested against 40 isolates of B. sorokiniana, seven isolates of other species of Bipolaris, and 27 isolates of other pathogens infecting wheat and other crops showed a specific band of 600 bp only in B. sorokiniana. The detection limit was 50 pg of genomic DNA. The marker could detect the pathogen in soil and wheat leaves at presymptomatic stage. This sequence characterized amplified region (SCAR) marker designated as SCRABS(600) could clearly distinguish B. sorokiniana from other fungal plant pathogens, including Bipolaris spp. The utilization of this diagnostic PCR assay in analysis of field soil and wheat leaves will play a key role in effective management of the disease.     

Detection of Xanthomonas arboricola pv. pruni by PCR using primers based on DNA sequences related to the hrp genes

Efficient control of Xanthomonas arboricola pv. pruni, the causal agent of bacterial spot on stone fruit, requires a sensitive and reliable diagnostic tool. A PCR detection method that utilizes primers to target the hrp gene cluster region was developed in this study. The nucleotide sequence of the PCR product amplified with primers specific for the hrp region of the xanthomonads and genomic DNA of X. arboricola pv. pruni was determined, and the sequence was aligned with that of X. campestris pv. campestris, which was obtained from the GenBank database. On the basis of the sequence of the amplified hrp region, a PCR primer set of XapF/R specific to X. arboricola pv. pruni was designed. This primer set yielded a 243-bp product from the genomic DNA of X. aboricola pv. pruni strains, but no products from other 21 strains of Xanthomonas or from two epiphytic bacterial species. Southern blot hybridization with the probe derived from the PCR product with the primer set and X. aboricola pv. pruni DNA confirmed the PCR results. The Xap primer system was successfully applied to detect the pathogen from infected peach fruits. When it was applied in field samples, the primer set was proved as a reliable diagnostic tool for specific detection of X. aboricola pv. pruni from peach orchards.     

Molecular Analysis of Rhynchosporium secalis Population Collected from Barley Cultivars having Different Resistance Specificities

Molecular analysis was performed to detect genetic diversity in 106 Rhynchosporium secalis isolates collected from different regions of Canada using random amplified polymorphic DNA (RAPD) markers. The isolates collected from barley cultivars having different resistance specificity to R. secalis and grown in geographically distinct regions, exhibited reproducible variation for 2–3 polymorphic PCR products per decamer primer. Analysis of 1960 RAPD markers data obtained with five primers formed 5 groups with different genetic similarity. High genetic variation was observed in R. secalis isolates obtained from resistant and susceptible cultivars of barley. Isolates collected from susceptible cultivars showed a tendency to group together, whereas isolates from resistant cultivars were divergent. R. secalis isolates infecting different barley cultivars released as resistant to the barley scald formed a specific group with UPGMA, even though all these isolates were collected from the same epidemiological region. Analysis of 15 isolates collected from one resistant cultivar Duke formed three clusters with low bootstrap values indicating high genetic diversity among the isolates present on a single host cultivar.     

Genome scanning for resistance-gene analogs in rice, barley, and wheat by high-resolution electrophoresis

 Genes cloned from diverse plants for resistance to different pathogens have sequence similarities in domains presumably involved in pathogen recognition and signal transduction in triggering the defense response. Primers based on the conserved regions of resistance genes often amplify multiple fragments that may not be separable in an agarose gel. We used denaturing polyacrylamide-gel electrophoresis to detect PCR products of plant genomic DNA amplified with primers based on conserved regions of resistance genes. Depending upon the primer pairs used, 30–130 bands were detected in wheat, rice, and barley. As high as 47%, 40%, and 27% of the polymorphic bands were detected in rice, barley, and wheat, respectively, and as high as 12.5% of the polymorphic bands were detected by certain primers in progeny from a cross of the wheat cultivars ‘Stephens’ and ‘Michigan Amber’. Using F₆ recombinant inbred lines from the ‘Stephens’בMichigan Amber’ cross, we demonstrated that polymorphic bands amplified with primers based on leucine-rich repeats, nucleotide-binding sites and protein kinase genes, were inherited as single loci. Linkages between molecular markers and stripe rust resistance genes were detected. This technique provides a new way to develop molecular markers for assessing the genetic diversity of germplasm based upon potential candidate resistance genes in diverse species. Received : 5 September 1997 / Accepted : 6 November 1997     

Detection and identification of bacterial endosymbionts in arbuscular mycorrhizal fungi belonging to the family Gigasporaceae

Intracellular bacteria have been found previously in one isolate of the arbuscular mycorrhizal (AM) fungus Gigaspora margarita BEG 34. In this study, we extended our investigation to 11 fungal isolates obtained from different geographic areas and belonging to six different species of the family Gigasporaceae. With the exception of Gigaspora rosea, isolates of all of the AM species harbored bacteria, and their DNA could be PCR amplified with universal bacterial primers. Primers specific for the endosymbiotic bacteria of BEG 34 could also amplify spore DNA from four species. These specific primers were successfully used as probes for in situ hybridization of endobacteria in G. margarita spores. Neighbor-joining analysis of the 16S ribosomal DNA sequences obtained from isolates of Scutellospora persica, Scutellospora castanea, and G. margarita revealed a single, strongly supported branch nested in the genus Burkholderia.     

Diversity among clinical isolates of Histoplasma capsulatum detected by polymerase chain reaction with arbitrary primers.

Clinical isolates of the fungal respiratory and systemic pathogen Histoplasma capsulatum have been placed in several different classes by using genomic restriction fragment length polymorphisms (RFLPs), but in general have not been distinguished further. We report here that a polymerase chain reaction (PCR)-based DNA fingerprinting method that has been termed arbitrary primer or random amplified polymorphic DNA (RAPD) PCR can distinguish among isolates in a single RFLP class. In this method, arbitrarily chosen oligonucleotides are used to prime DNA synthesis from genomic sites that they fortuitously match, or almost match, to generate strain-specific arrays of DNA fragments. Each of 29 isolates of RFLP class 2, the group endemic in the American Midwest, was distinguished by using just three arbitrary primers. In contrast, laboratory-derived S and E colony morphology variants of two strains were not distinguished from their R parents by using 18 such primers. Thus, the clinical isolates of H. capsulatum are quite diverse, but their genomes remain stable during laboratory culture. These outcomes suggest new possibilities for epidemiological analysis and studies of fungal populations in infected hosts.