Searching for Genomic Region of High-Fat Diet-Induced Type 2 Diabetes in Mouse Chromosome 2 by Analysis of Congenic Strains

SMXA-5 mice are a high-fat diet-induced type 2 diabetes animal model established from non-diabetic SM/J and A/J mice. By using F2 intercross mice between SMXA-5 and SM/J mice under feeding with a high-fat diet, we previously mapped a major diabetogenic QTL (T2dm2sa) on chromosome 2. We then produced the congenic strain (SM.A-T2dm2sa (R0), 20.8–163.0 Mb) and demonstrated that the A/J allele of T2dm2sa impaired glucose tolerance and increased body weight and body mass index in the congenic strain compared to SM/J mice. We also showed that the combination of T2dm2sa and other diabetogenic loci was needed to develop the high-fat diet-induced type 2 diabetes. In this study, to narrow the potential genomic region containing the gene(s) responsible for T2dm2sa, we constructed R1 and R2 congenic strains. Both R1 (69.6–163.0 Mb) and R2 (20.8–128.2 Mb) congenic mice exhibited increases in body weight and abdominal fat weight and impaired glucose tolerance compared to SM/J mice. The R1 and R2 congenic analyses strongly suggested that the responsible genes existed in the overlapping genomic interval (69.6–128.2 Mb) between R1 and R2. In addition, studies using the newly established R1A congenic strain showed that the narrowed genomic region (69.6–75.4 Mb) affected not only obesity but also glucose tolerance. To search for candidate genes within the R1A genomic region, we performed exome sequencing analysis between SM/J and A/J mice and extracted 4 genes (Itga6, Zak, Gpr155, and Mtx2) with non-synonymous coding SNPs. These four genes might be candidate genes for type 2 diabetes caused by gene-gene interactions. This study indicated that one of the genes responsible for high-fat diet-induced diabetes exists in the 5.8 Mb genomic interval on mouse chromosome 2.     

Genome and Phenotype Microarray Analyses of Rhodococcus sp. BCP1 and Rhodococcus opacus R7: Genetic Determinants and Metabolic Abilities with Environmental Relevance

In this paper comparative genome and phenotype microarray analyses of Rhodococcus sp. BCP1 and Rhodococcus opacus R7 were performed. Rhodococcus sp. BCP1 was selected for its ability to grow on short-chain n-alkanes and R. opacus R7 was isolated for its ability to grow on naphthalene and on o-xylene. Results of genome comparison, including BCP1, R7, along with other Rhodococcus reference strains, showed that at least 30% of the genome of each strain presented unique sequences and only 50% of the predicted proteome was shared. To associate genomic features with metabolic capabilities of BCP1 and R7 strains, hundreds of different growth conditions were tested through Phenotype Microarray, by using Biolog plates and plates manually prepared with additional xenobiotic compounds. Around one-third of the surveyed carbon sources was utilized by both strains although R7 generally showed higher metabolic activity values compared to BCP1. Moreover, R7 showed broader range of nitrogen and sulphur sources. Phenotype Microarray data were combined with genomic analysis to genetically support the metabolic features of the two strains. The genome analysis allowed to identify some gene clusters involved in the metabolism of the main tested xenobiotic compounds. Results show that R7 contains multiple genes for the degradation of a large set of aromatic and PAHs compounds, while a lower variability in terms of genes predicted to be involved in aromatic degradation was found in BCP1. This genetic feature can be related to the strong genetic pressure exerted by the two different environment from which the two strains were isolated. According to this, in the BCP1 genome the smo gene cluster involved in the short-chain n-alkanes degradation, is included in one of the unique regions and it is not conserved in the Rhodococcus strains compared in this work. Data obtained underline the great potential of these two Rhodococcus spp. strains for biodegradation and environmental decontamination processes.     

Prevalence and Genetic Properties of Salmonella enterica Serovar Typhimurium Definitive Phage Type 104 Isolated from Rattus norvegicus and Rattus rattus House Rats in Yokohama City, Japan

Salmonella enterica serovar Typhimurium was isolated from the intestinal contents of Rattus rattus and Rattus norvegicus house rats captured at two buildings, designated buildings J and YS, in Yokohama City, Japan. From October 1997 to September 1998, 52 of 339 (15.3%) house rats were found to carry Salmonella serovar Typhimurium definitive phage type 104 (DT104). In building J, 26 of 161 (16.1%) house rats carried DT104 over the 1-year study period, compared to 26 of 178 (14.6%) rats in building YS. The isolation rates of DT104 from R. rattus and R. norvegicus were similar in the two buildings. Most DT104 strains from building J (24 of 26) showed resistance to ampicillin, chloramphenicol, streptomycin, sulfisoxazole, and tetracycline and contained both the 1.0- and 1.2-kbp integrons, carrying genes pse1, pasppflo-like, aadA2, sulI, and tet(G). All DT104 strains from building YS were resistant to ampicillin and sulfisoxazole, and had the 1.2-kbp integron carrying pse1 and sulI. Cluster analysis of pulsed-field gel electrophoresis patterns of BlnI-digested DT104 DNAs showed that 22 of 26 DT104 strains from building J and 24 of 26 strains from building YS could be grouped into separate clusters each specific for the building origin. These results indicated that DT104 strains were prevalent in house rat colonies in each building and suggest that house rats may play an important role in the epidemiology of DT104.     

Zygosity Determination in Hairless Mice by PCR Based on Hrhr Gene Analysis

We analyzed the Hr gene of a hairless mouse strain of unknown origin (HR strain, http://animal.nibio.go.jp/e_hr.html) to determine whether the strain shares a mutation with other hairless strains, such as HRS/J and Skh:HR-1, both of which have an Hr^hr allele. Using PCR with multiple pairs of primers designed to amplify multiple overlapping regions covering the entire Hr gene, we found an insertion mutation in intron 6 of mutant Hr genes in HR mice. The DNA sequence flanking the mutation indicated that the mutation in HR mice was the same as that of Hr^hr in the HRS/J strain. Based on the sequence, we developed a genotyping method using PCR to determine zygosities. Three primers were designed: S776 (GGTCTCGCTGGTCCTTGA), S607 (TCTGGAACCAGAGTGACAGACAGCTA), and R850 (TGGGCCACCATGGCCAGATTTAACACA). The S776 and R850 primers detected the Hr^hr allele (275-bp amplicon), and S607 and R850 identified the wild-type Hr allele (244-bp amplicon). Applying PCR using these three primers, we confirmed that it is possible to differentiate among homozygous Hr^hr (longer amplicons only), homozygous wild-type Hr(shorter amplicons only), and heterozygous (both amplicons) in HR and Hos:HR-1 mice. Our genomic analysis indicated that the HR, HRS/J, and Hos:HR-1 strains, and possibly Skh:HR-1 (an ancestor of Hos:HR-1) strain share the same Hr^hr gene mutation. Our genotyping method will facilitate further research using hairless mice, and especially immature mice, because pups can be genotyped before their phenotype (hair coat loss) appears at about 2 weeks of age.     

Diversity of Nitrile Hydratase and Amidase Enzyme Genes in Rhodococcus erythropolis Recovered from Geographically Distinct Habitats

A molecular screening approach was developed in order to amplify the genomic region that codes for the α- and β-subunits of the nitrile hydratase (NHase) enzyme in rhodococci. Specific PCR primers were designed for the NHase genes from a collection of nitrile-degrading actinomycetes, but amplification was successful only with strains identified as Rhodococcus erythropolis. A hydratase PCR product was also obtained from R. erythropolis DSM 43066^T, which did not grow on nitriles. Southern hybridization of other members of the nitrile-degrading bacterial collection resulted in no positive signals other than those for the R. erythropolis strains used as positive controls. PCR-restriction fragment length polymorphism-single-strand conformational polymorphism (PRS) analysis of the hydratases in the R. erythropolis strains revealed unique patterns that mostly correlated with distinct geographical sites of origin. Representative NHases were sequenced, and they exhibited more than 92.4% similarity to previously described NHases. The phylogenetic analysis and deduced amino acid sequences suggested that the novel R. erythropolis enzymes belonged to the iron-type NHase family. Some different residues in the translated sequences were located near the residues involved in the stabilization of the NHase active site, suggesting that the substitutions could be responsible for the different enzyme activities and substrate specificities observed previously in this group of actinomycetes. A similar molecular screening analysis of the amidase gene was performed, and a correlation between the PRS patterns and the geographical origins identical to the correlation found for the NHase gene was obtained, suggesting that there was coevolution of the two enzymes in R. erythropolis. Our findings indicate that the NHase and amidase genes present in geographically distinct R. erythropolis strains are not globally mixed.     

Genotypic and phenotypic diversity of rhizobia isolated from Lathyrus japonicus indigenous to Japan

Sixty-one rhizobial strains from Lathyrus japonicus nodules growing on the seashore in Japan were characterized and compared to two strains from Canada. The PCR-based method was used to identify test strains with novel taxonomic markers that were designed to discriminate between all known Lathyrus rhizobia. Three genomic groups (I, II, and III) were finally identified using RAPD, RFLP, and phylogenetic analyses. Strains in genomic group I (related to Rhizobium leguminosarum) were divided into two subgroups (Ia and Ib) and subgroup Ia was related to biovar viciae. Strains in subgroup Ib, which were all isolated from Japanese sea pea, belonged to a distinct group from other rhizobial groups in the recA phylogeny and PCR-based grouping, and were more tolerant to salt than the isolate from an inland legume. Test strains in genomic groups II and III belonged to a single clade with the reference strains of R. pisi, R. etli, and R. phaseoli in the 16S rRNA phylogeny. The PCR-based method and phylogenetic analysis of recA revealed that genomic group II was related to R. pisi. The analyses also showed that genomic group III harbored a mixed chromosomal sequence of different genomic groups, suggesting a recent horizontal gene transfer between diverse rhizobia. Although two Canadian strains belonged to subgroup Ia, molecular and physiological analyses showed the divergence between Canadian and Japanese strains. Phylogenetic analysis of nod genes divided the rhizobial strains into several groups that reflected the host range of rhizobia. Symbiosis between dispersing legumes and rhizobia at seashore is discussed.     

Bovine-like coronaviruses isolated from four species of captive wild ruminants are homologous to bovine coronaviruses, based on complete genomic sequences

We sequenced and analyzed the full-length genomes of four coronaviruses (CoVs), each from a distinct wild-ruminant species in Ohio: sambar deer (Cervus unicolor), a waterbuck (Kobus ellipsiprymnus), a sable antelope (Hippotragus niger), and a white-tailed deer (Odocoileus virginianus). The fecal samples from the sambar deer, the waterbuck, and the white-tailed deer were collected during winter dysentery outbreaks and sporadic diarrhea cases in 1993 and 1994 (H. Tsunemitsu, Z. R. el-Kanawati, D. R. Smith, H. H. Reed, and L. J. Saif, J. Clin. Microbiol. 33:3264-3269, 1995). A fecal sample from a sable antelope was collected in 2003 from an Ohio wild-animal habitat during the same outbreak when a bovine-like CoV from a giraffe (GiCoV) was isolated (M. Hasoksuz, K. Alekseev, A. Vlasova, X. Zhang, D. Spiro, R. Halpin, S. Wang, E. Ghedin, and L. J. Saif, J. Virol. 81:4981-4990, 2007). For two of the CoVs (sambar deer and waterbuck), complete genomes from both the cell culture-adapted and gnotobiotic-calf-passaged strains were also sequenced and analyzed. Phylogenetically, wild-ruminant CoVs belong to group 2a CoVs, with the closest relatedness to recent bovine CoV (BCoV) strains. High nucleotide identities (99.4 to 99.6%) among the wild-ruminant strains and recent BCoV strains (BCoV-LUN and BCoV-ENT, isolated in 1998) further confirm the close relatedness. Comparative genetic analysis of CoVs of captive wild ruminants with BCoV strains suggests that no specific genomic markers are present that allow discrimination between the bovine strains and bovine-like CoVs from captive wild ruminants; furthermore, no specific genetic markers were identified that defined cell cultured or calf-passaged strains or the host origin of strains. The results of this study confirm prior reports of biologic and antigenic similarities between bovine and wild-ruminant CoVs and suggest that cattle may be reservoirs for CoVs that infect captive wild ruminants or vice versa and that these CoVs may represent host range variants of an ancestral CoV.     

Conserved Plasmid Hydrogen-Uptake (hup)-Specific Sequences within Hup+Rhizobium leguminosarum Strains

Thirteen Rhizobium leguminosarum strains previously reported as H₂-uptake hydrogenase positive (Hup⁺) or negative (Hup⁻) were analyzed for the presence and conservation of DNA sequences homologous to cloned Bradyrhizobium japonicum hup-specific DNA from cosmid pHU1 (M. A. Cantrell, R. A. Haugland, and H. J. Evans, Proc. Natl. Acad. Sci. USA 80:181-185, 1983). The Hup phenotype of these strains was reexamined by determining hydrogenase activity induced in bacteroids from pea nodules. Five strains, including H₂ oxidation-ATP synthesis-coupled and -uncoupled strains, induced significant rates of H₂-uptake hydrogenase activity and contained DNA sequences homologous to three probe DNA fragments (5.9-kilobase [kb] HindIII, 2.9-kb EcoRI, and 5.0-kb EcoRI) from pHU1. The pattern of genomic DNA HindIII and EcoRI fragments with significant homology to each of the three probes was identical in all five strains regardless of the H₂-dependent ATP generation trait. The restriction fragments containing the homology totalled about 22 kb of DNA common to the five strains. In all instances the putative hup sequences were located on a plasmid that also contained nif genes. The molecular sizes of the identified hup-sym plasmids ranged between 184 and 212 megadaltons. No common DNA sequences homologous to B. japonicum hup DNA were found in genomic DNA from any of the eight remaining strains showing no significant hydrogenase activity in pea bacteroids. These results suggest that the identified DNA region contains genes essential for hydrogenase activity in R. leguminosarum and that its organization is highly conserved within Hup⁺ strains in this symbiotic species.     

Whole-genome sequencing of Mesorhizobium huakuii 7653R provides molecular insights into host specificity and symbiosis island dynamics

Background

Evidence based on genomic sequences is urgently needed to confirm the phylogenetic relationship between Mesorhizobium strain MAFF303099 and M. huakuii. To define underlying causes for the rather striking difference in host specificity between M. huakuii strain 7653R and MAFF303099, several probable determinants also require comparison at the genomic level. An improved understanding of mobile genetic elements that can be integrated into the main chromosomes of Mesorhizobium to form genomic islands would enrich our knowledge of how genome dynamics may contribute to Mesorhizobium evolution in general.

Results

In this study, we sequenced the complete genome of 7653R and compared it with five other Mesorhizobium genomes. Genomes of 7653R and MAFF303099 were found to share a large set of orthologs and, most importantly, a conserved chromosomal backbone and even larger perfectly conserved synteny blocks. We also identified candidate molecular differences responsible for the different host specificities of these two strains. Finally, we reconstructed an ancestral Mesorhizobium genomic island that has evolved into diverse forms in different Mesorhizobium species.

Conclusions

Our ortholog and synteny analyses firmly establish MAFF303099 as a strain of M. huakuii. Differences in nodulation factors and secretion systems T3SS, T4SS, and T6SS may be responsible for the unique host specificities of 7653R and MAFF303099 strains. The plasmids of 7653R may have arisen by excision of the original genomic island from the 7653R chromosome.

Electronic supplementary material

The online version of this article (doi: 10.1186/1471-2164-15-440) contains supplementary material, which is available to authorized users.     

Proteins and surface proteins of Leishmania promastigotes and their possible relevance to the characterisation of strains

Ramasamy R., Jamnadas H. & Mutinga M.J. 1981. Proteins and surface proteins of Leishmania promastigotes and their possible relevance to the characterisation of strains. International Journal for Parasitology11: 387–390. Two strains of Leishmania isolated from phlebotomine flies and another one from a patient with kala-azar were grown in culture as promastigotes. They were analysed for protein composition and surface proteins by polyacrylamide gel electrophoresis after surface radiolabelling. Differences were observed in the characteristic patterns of proteins and surface proteins between the two strains that are likely to be Leishmania donovani and the other strain. Such differences may prove valuable in the classification of Leishmania strains.     

Sequence organisation in nuclear DNA from Physarum polycephalum: Genomic organisation of DNA segments containing foldback sequences

DNA clones containing foldback sequences, derived from Physarum polycephalum nuclear DNA, can be classified according to their pattern of hydridisation to Southern blots of genomic DNA. One group of DNA clones map to unique DNA loci when used as a probe to restriction digests of Physarum nuclear DNA. These cloned segments appear to contain dispersed repetitive sequence elements located at many hundreds of sites in the genome. Similar patterns of hybridisation are generated when these cloned DNA probes are annealed to DNA restriction fragments of genomic DNA obtained from a number of different Physarum strains, indicating that no detectable alteration has occurred at these genomic loci subsequent to the divergence of the strains as a result of the introduction or deletion of mobile genetic elements. However, deletion of segments of some cloned DNA fragments occurs following their propagation in Escherichia coli. A second, distinct group of clones are shown to be derived from highly methylated segments of Physarum DNA which contain very abundant repetitive sequences with regular, though complex, arrangements of restriction sites at their various genomic locations. It is suggested that these DNA segments contain clustered repetitive sequence elements. The results lead to the conclusion that foldback elements in Physarum DNA are located in segments of the genome which display markedly different patterns of sequence organisation and degree of DNA methylation.     

Membrane-active and DNA binding related double-action antimycobacterial mechanism of antimicrobial peptide W3R6 and its synthetic analogs

The emergence of multidrug- or extremely drug-resistant M. tuberculosis strains has made very few drugs available for current tuberculosis treatment. Antimicrobial peptides can be employed as a promising alternative strategy for TB treatment. Here, we designed and synthesized a series of peptide sequences based on the structure-activity relationships of natural sequences of antimicrobial peptides. The peptide W3R6 and its analogs were screened and found to have potent antimycobacterial activity against M. smegmatis, and no hemolytic activity against human erythrocytes. The evidence from the mechanism of action study indicated that W3R6 and its analogs can interact with the mycobacterial membrane in a lytic manner and form pores on the outer membrane of M. smegmatis. Significant colocalization of D-W3R6 with mycobacterial DNA was observed by confocal laser scanning microscopy and DNA retardation assays, which suggested that the antimycobacterial mechanism of action of the peptide was associated with the unprotected genomic DNA of M. smegmatis. In general, W3R6 and its analogs act on not only the mycobacterial membrane but also the genomic DNA in the cytoplasm, which makes it difficult for mycobacteria to generate resistance due to the peptides having two targets. In addition, the peptides can effectively eliminate M. smegmatis cells from infected macrophages. Our findings indicated that the antimicrobial peptide W3R6 could be a novel lead compound to overcome the threat from drug-resistant M. tuberculosis strains in the development of potent AMPs for TB therapeutic applications.     

Genomic Characteristics of Chinese Borrelia burgdorferi Isolates

In China, B. burgdorferi, B.garinii, B. afzelii and B. yangtze sp. nov have been reported; B.garinii and B. afzelii are the main pathogenic genotypes. But until now only one Chinese strain was reported with whole genome sequence. In order to further understand the genomic characteristics and diversity of Chinese Borrelia strains, 5 isolates from China were sequenced and compared with the whole genome sequences of strains in other areas. The results showed a high degree of conservation within the linear chromosome of Chinese strains, whereas plasmid showed a much larger diversity according to the majority genomic information of plasmids. The genome sequences of the five Chinese strains were compared with the corresponding reference strains, respectively, according to the genospecies. Pairwise analysis demonstrates that there are only 70 SNPs between the genomes of CS4 and B31. However, there are many more SNPs between the genomes of QX-S13 and VS116, PD91 and PBi, FP1 and PKo, R9 and Pko, respectively. Gene comparison showed some important different genes. OspA was one of the important different genes. Comparative genomic studies have found that OspA gene sequences of PD91 and R9 had great differences compared with the sequence of B31. OspA gene sequence of R9 had a 96bp deletion; OspA gene of PD91 had two deletions: 9bp and 10 bp. To conclude, we showed the genomic characteristics of four genotype Chinese B. burgdorferi strains. The genomic sequence of B. yangtze sp. nov and differences from B. valaisiana were first reported. Comparative analysis of Chinese strains with the different Borrelia species from other areas will help us to understand evolution and pathogenesis of Chinese Borrelia burgdorferi strains.     

Spatial Distribution of Rhodopseudomonas palustris Ecotypes on a Local Scale

The number, spatial distribution, and significance of genetically distinguishable ecotypes of prokaryotes in the environment are poorly understood. Oda et al. (Y. Oda, B. Star, L. A. Huisman, J. C. Gottschal, and L. J. Forney, Appl. Environ. Microbiol. 69:xxx-xxx, 2003) have shown that Rhodopseudomonas palustris ecotypes were lognormally distributed along a 10-m transect and that multiple strains of the species could coexist in 0.5-g sediment samples. To extend these observations, we investigated the clonal diversity of R. palustris in 0.5-g samples taken from the corners and center of a 1-m square. A total of 35 or 36 clones were recovered by direct plating from each sample and were characterized by BOX A1R repetitive element-PCR genomic DNA fingerprinting. Isolates with fingerprint images that were ≥80% similar to each other were defined as the same genotype. Among the 178 isolates studied, 32 genotypes were identified, and each genotype contained between 1 and 40 isolates. These clusters were consistent with minor variations found in 16S rRNA gene sequences. The Shannon indices of the genotypic diversity within each location ranged from 1.08 (5 genotypes) to 2.18 (13 genotypes). Comparison of the rank abundance of genotypes found in pairs of locations showed that strains from three locations were similar to each other, with Morisita-Horn similarity coefficients ranging from 0.59 to 0.71. All comparisons involving the remaining two locations resulted in coefficients between 0 and 0.12. From these results we inferred that the patterns of ecotype diversity at the sampling site are patchy at a 1-m scale and postulated that factors such as mixing, competitive interactions, and microhabitat variability are likely to be responsible for the maintenance of the similarities between some locations and the differences between others.     

Molecular Analysis of Vibrio cholerae O1, O139, non-O1, and non-O139 Strains: Clonal Relationships between Clinical and Environmental Isolates

A total of 26 strains of Vibrio cholerae, including members of the O1, O139, and non-O1, non-O139 serogroups from both clinical and environmental sources, were examined for the presence of genes encoding cholera toxin (ctxA), zonula occludens toxin (zot), accessory cholera enterotoxin (ace), hemolysin (hlyA), NAG-specific heat-stable toxin (st), toxin-coregulated pilus (tcpA), and outer membrane protein (ompU), for genomic organization, and for the presence of the regulatory protein genes tcpI and toxR in order to determine relationships between epidemic serotypes and sources of isolation. While 22 of the 26 strains were hemolytic on 5% sheep blood nutrient agar, all strains were PCR positive for hlyA, the hemolysin gene. When multiplex PCR was used, all serogroup O1 and O139 strains were positive for tcpA, ompU, and tcpI. All O1 and O139 strains except one O1 strain and one O139 strain were positive for the ctxA, zot, and ace genes. Also, O1 strain VO3 was negative for the zot gene. All of the non-O1, non-O139 strains were negative for the ctxA, zot, ace, tcpA, and tcpI genes, and all of the non-O1, non-O139 strains except strain VO26 were negative for ompU. All of the strains except non-O1, non-O139 strain VO22 were PCR positive for the gene encoding the central regulatory protein, toxR. All V. cholerae strains were negative for the NAG-specific st gene. Of the nine non-ctx-producing strains of V. cholerae, only one, non-O1, non-O139 strain VO24, caused fluid accumulation in the rabbit ileal loop assay. The other eight strains, including an O1 strain, an O139 strain, and six non-O1, non-O139 strains, regardless of the source of isolation, caused fluid accumulation after two to five serial passages through the rabbit gut. Culture filtrates of all non-cholera-toxigenic strains grown in AKI media also caused fluid accumulation, suggesting that a new toxin was produced in AKI medium by these strains. Studies of clonality performed by using enterobacterial repetitive intergenic consensus sequence PCR, Box element PCR, amplified fragment length polymorphism (AFLP), and pulsed-field gel electrophoresis (PFGE) collectively indicated that the V. cholerae O1 and O139 strains had a clonal origin, whereas the non-O1, non-O139 strains belonged to different clones. The clinical isolates closely resembled environmental isolates in their genomic patterns. Overall, there was an excellent correlation among the results of the PCR, AFLP, and PFGE analyses, and individual strains derived from clinical and environmental sources produced similar fingerprint patterns. From the results of this study, we concluded that the non-cholera-toxin-producing strains of V. cholerae, whether of clinical or environmental origin, possess the ability to produce a new secretogenic toxin that is entirely different from the toxin produced by toxigenic V. cholerae O1 and O139 strains. We also concluded that the aquatic environment is a reservoir for V. cholerae O1, O139, non-O1, and non-O139 serogroup strains.     

Marine mammal Brucella isolates with different genomic characteristics display a differential response when infecting human macrophages in culture

Marine mammal Brucella strains with different genomic characteristics according to distribution of IS711 elements in their genomes were analysed for their intracellular behaviour in human THP-1 macrophage-like cells. Seven different groups of marine mammal strains were identified including a human isolate from New Zealand presumably from marine origin. Entry and intracellular survival of strains representative of these groups in THP-1 human macrophage-like cells were analysed at several times of infection. Three patterns of infection were identified. The Brucella strain isolated from the human case from New Zealand, and two other groups of strains belonging to B. ceti or B. pinnipedialis were able to infect THP-1 macrophage cells to the same extent as the virulent strains B. suis 1330 or B. melitensis 16M. Three other groups of strains belonging to B. ceti or B. pinnipedialis were able to enter the cells as classical virulent strains but were eliminated after 48 h. The last group was composed only of strains isolated from hooded seals (Cystophora cristata) and was even unable to enter and infect THP-1 macrophage cells. Thus, several groups of marine mammal Brucella strains appear to be non-infectious for human macrophages.     

Length polymorphism of integrated copies of R1 and R2 retrotransposons in the German cockroach (Blattella germanica) as a potential marker for population and phylogenetic studies

Using polymerase chain reaction technique with primers flanking target sites of retrotransposons R1 and R2, integrated copies of these transposable elements were amplified in various cockroach species (Blattodea). It was shown that each species has a unique pattern of “5′-truncated copies” with the definite set of amplified fragments of different lengths. Intraspecies polymorphism was revealed in analysis of German cockroach specimens obtained upon individual mating. This is the first report providing results of identifying, cloning, and sequencing extended fragments (5′-truncated copies) of Blattella germanica R1 and R2 retrotransposons. It may be assumed that patterns of 5′-truncated copies of R1 and R2 elements can be used as markers in population and phylogenetic studies. Moreover, cloned and sequenced fragments will be employed in our further studies for screening of the German cockroach genomic library in order to detect full-length copies in this class transposable elements.     

Rapid detection by multiplex PCR of Genomic Islands, prophages and Integrative Conjugative Elements in V. cholerae 7th pandemic variants

Vibrio cholerae poses a threat to human health, and new epidemic variants have been reported so far. Seventh pandemic V. cholerae strains are characterized by highly related genomic sequences but can be discriminated by a large set of Genomic Islands, phages and Integrative Conjugative Elements. Classical serotyping and biotyping methods do not easily discriminate among new variants arising worldwide, therefore the establishment of new methods for their identification is required. We developed a multiplex PCR assay for the rapid detection of the major 7th pandemic variants of V. cholerae O1 and O139. Three specific genomic islands (GI-12, GI-14 and GI-15), two phages (Kappa and TLC), Vibrio Seventh Pandemic Island 2 (VSP-II), and the ICEs of the SXT/R391 family were selected as targets of our multiplex PCR based on a comparative genomic approach. The optimization and specificity of the multiplex PCR was assessed on 5 V. cholerae 7th pandemic reference strains, and other 34 V. cholerae strains from various epidemic events were analyzed to validate the reliability of our method. This assay had sufficient specificity to identify twelve different V. cholerae genetic profiles, and therefore has the potential to be used as a rapid screening method.     

Design of hybrid molecules as antimycobacterial compounds: Synthesis of isoniazid-naphthoquinone derivatives and their activity against susceptible and resistant strains of Mycobacterium tuberculosis

Isoniazid-naphthoquinone hybrids were synthesized and evaluated against a susceptible (H₃₇Rv) strain and two isoniazid-resistant strains (INH_R1 and INH_R2) of Mycobacterium tuberculosis. The antimycobacterial activity of the derivatives was determined based on the resazurin microtiter assay and their cytotoxicity in adhered mouse monocyte macrophage J774.A1 cells (ATCC TIB-67). Of the twenty-two compounds evaluated against the three strains of M. tuberculosis, twenty-one presented some activity against the H₃₇Rv and INH_R1 (katG S315T) or INH_R2 (inhA C(−5)T) strains. Compounds 1a, 2a, and 8a were effective against the INH_R1 strain, and compounds 1a, 1b, 2a, 3a, 5a, 5b and 8a were effective against the INH_R2 strain, with MICs in the range of 3.12–6.25 µg/mL. Compounds 1b and 5b were the most active against H₃₇Rv, with MIC of 0.78 µg/mL. Based on the selectivity index, 1b and 5b can be considered safe as a drug candidate compounds. These results demonstrate that quinoidal compounds can be used as promising scaffolds for the development of new anti-TB drugs and hybrids with activity against M. tuberculosis-susceptible and INH-resistant strains.     

Restriction site tagged (RST) microarrays: a novel technique to study the species composition of complex microbial systems

We have developed a new type of microarray, restriction site tagged (RST), for example NotI, microarrays. In this approach only sequences surrounding specific restriction sites (i.e. NotI linking clones) were used for generating microarrays. DNA was labeled using a new procedure, NotI representation, where only sequences surrounding NotI sites were labeled. Due to these modifications, the sensitivity of RST microarrays increases several hundred-fold compared to that of ordinary genomic microarrays. In a pilot experiment we have produced NotI microarrays from Gram-positive and Gram-negative bacteria and have shown that even closely related Escherichia coli strains can be easily discriminated using this technique. For example, two E.coli strains, K12 and R2, differ by less than 0.1% in their 16S rRNA sequences and thus the 16S rRNA sequence would not easily discriminate between these strains. However, these strains showed distinctly different hybridization patterns with NotI microarrays. The same technique can be adapted to other restriction enzymes as well. This type of microarray opens the possibility not only for studies of the normal flora of the gut but also for any problem where quantitative and qualitative analysis of microbial (or large viral) genomes is needed.