Synthesis of a thymine glycol building block and its incorporation into oligonucleotides.

A phosphoramidite building block of thymine glycol, a major oxidative base damage in DNA, was synthesized in four steps from protected thymidine. The two hydroxyl functions of the oxidized base were protected with the tert-butyldimethylsilyl group. Using this building block, oligonucleotides containing this damage were synthesized.     

Solid phase synthesis and biological activities of [Arg8]-vasopressin methylenedithioether.

Solid phase synthesis of [Arg8]-vasopressin methylenedithioether, an analog of vasopressin which contains an extra methylene group between the two sulfur atoms of Cys1 and Cys6, is described. Methylene insertion occurred easily when the thiol free peptide on a solid support was treated with tetrabutylammonium fluoride in dichloromethane at room temperature for 3 h. The uterotonic in vitro, pressor, and antidiuretic activities of the compound were reduced in comparison to [Arg8]-vasopressin by one order of magnitude.     

Synthesis of a GlcNAcylated arginine building block for the solid phase synthesis of death domain glycopeptide fragments

Herein we describe the synthesis of glycopeptide fragments from the death domains of TRADD and FADD bearing the recently discovered Nω-GlcNAc-β-arginine post-translational modification. TRADD and FADD glycopeptides were accessed through the use of a suitably protected synthetic glycosylamino acid ‘cassette’ that could be directly incorporated into conventional solid phase peptide synthesis (SPPS) protocols.     

Solid phase synthesis of [18F]labelled peptides for positron emission tomography

A strategy for the solid phase synthesis of [18F]labelled peptides has been developed. The peptides were prepared on solid support and acylated with 4-[18F]fluorobenzoic acid using HATU within 3 min and the labelled peptide was released from the solid support within 7 min. The [18F]labelled peptides were produced in good purity with a specific activity of 20-25 GBq/micromol.     

Solid phase synthesis of quinolones.

Solid phase syntheses of ethyl 6-carboxyquinol-4(1H-)-one-3-carboxylate (5) and N-substituted 6-carboxyquinol-4(1H)-one-3-carboxamides 7a-d have been described. Antifilarial in vitro activities of 5,7a-d against Brugia malayi have also been delineated.     

Solid phase peptide synthesis of alpha-factor, a yeast mating pheromone.

Based on analysis of highly purified preparations of natural $\text{α}$-factor and on the sequence recently reported by others, oligopeptides of the following structures were chemically synthesized by the solid phase method of Merrifield: N-Trp-His-Trp-Leu-Lys-Pro-Gly-G1N-Pro-Met-Tyr-C N-His-Trp-Leu-Lys-Pro-Gly-G1N-Pro-Met-Tyr-C Both synthetic species arrested $\text{a}$ cells in G1, inhibited their DNA synthesis, caused them to elongate markedly, and induced an increase in their adhesivity toward $\text{α}$ cells. Neither synthetic material caused any of these effects in $\text{α}$ cells or in $\text{a}\text{α}$ diploids.     

A protected biotin containing deoxycytidine building block for solid phase synthesis of biotinylated oligonucleotides.

The synthesis of a modified 2'-deoxycytidine-3'-O-phosphoramidite carrying an N-t-butylbenzoyl protected biotin on a long polar spacer arm attached to the 4-N position is described. The presence of the bulky lipophilic t-butylbenzoyl protecting group enables the direct solid phase synthesis of biotinylated oligoribonucleotides and a variety of analogues in high yield without modification of the biotin moiety. Biotinylated antisense oligonucleotides incorporating this new derivative allow convenient isolation and purification of ribonucleic acid-protein complexes. The kinetics of biotin binding to streptavidin agarose is facilitated by the long polar spacer arm.     

Solid phase synthesis of polynucleotides. VIII. Synthesis of mixed oligodeoxyribonucleotides by the phosphotriester solid phase method.

A solid phase method for the simultaneous synthesis of mixed oligonucleotides using a phosphotriester approach has been developed. For this synthesis, a mixture of mono or dimeric coupling units is used, and a slight difference in the reactivity of those units is found. However, this difference does not hamper the simultaneous, mixed oligonucleotide synthesis, and the sequence analysis of a product demonstrates the existence of all desired sequences in the final mixture.     

Essential dynamics of DNA containing a cis.syn cyclobutane thymine dimer lesion.

Conformational properties of a UV-damaged DNA decamer containing a cis.syn cyclobutane thymine dimer (PD) have been investigated by molecular dynamics (MD) simulations. Results from MD simulations of the damaged decamer DNA show a kink of approximately 21.7 degrees at the PD damaged site and a disruption of H bonding between the 5'-thymine of the PD and its complementary adenine. However, no extra-helical flipping of the 3'-adenine complementary to the PD was observed. Comparison to two undamaged DNA decamers, one with the same sequence and the other with an AT replacing the TT sequence, indicates that these properties are specific to the damaged DNA. Essential dynamics (ED) derived from the MD trajectories of the three DNAs show that the backbone phosphate between the two adenines complementary to the PD of the damaged DNA has considerably larger mobility than the rest of the molecule and occurs only in the damaged DNA. As observed in the crystal structure of T4 endonuclease V in a complex with the damaged DNA, the interaction of the enzyme with the damaged DNA can lead to bending along the flexible joint and to induction of adenine flipping into an extra-helical position. Such motions may play an important role in damage recognition by repair enzymes.     

RNA ligase from bacteriophage T4. VIII. Solid phase enzymatic synthesis of oligoribonucleotides]

A method of the solid-phase enzymic synthesis of oligoribonucleotides has been suggested. The donor is fixed through its 3'-end on a water-insoluble matrix followed by the stepwise RNA ligase- and T4 polynucleotide kinase-assisted coupling of trinucleoside diphosphates in the 5'-direction. As an example, (pA)6pAox was immobilised on Biogel P-300 hydrazine and the RNA ligase-catalyzed addition of acceptor ApApA to the donor gave (Ap)9 with the 50% yield.     

Synthesis and characterization of a substrate for T4 endonuclease V containing a phosphorodithioate linkage at the thymine dimer site.

A dodecadeoxyribonucleotide containing a cis-syn thymine dimer with a phosphorodithioate linkage was synthesized on a solid support using a dinucleotide coupling unit prepared by UV-irradiation of dithymidine monophosphorodithioate followed by S- and 5'-O-protection and 3'-phosphitylation. A photodimer-containing dodecamer without phosphate modification was also synthesized. The dodecamers were hybridized to the complementary sequence, and the duplexes used as substrates for T4 endonuclease V. This enzyme cleaved the phosphate-modified substrate more slowly than the unmodified duplex with the same dissociation constant.     

Synthesis of an Fmoc-Asn-heptasaccharide building block and its application to chemoenzymatic glycopeptide synthesis

The Fmoc-protected heptasaccharide asparagine building block β-GlcNAc-(1→2)-α-Man-(1→3)-[β-GlcNAc-(1→2)-α-Man-(1→6)]β-Man-(1→4)-β-GlcNAc-(1→4)-β-GlcNAc-(Fmoc)Asn was obtained by chemical synthesis. Two flexible strategies were developed with optimized conditions for the simultaneous debenzylation of the sugar and the amino acid part. The heptasaccharide asparagine building block is a partial structure of many glycoproteins and can be used for glycopeptide synthesis in solution and on the solid phase. In this work the heptasaccharide asparagine was elongated in solution to an Fmoc-glycopentapeptide methylester. After chemical cleavage of the Fmoc group the methylester was removed enzymatically by chymotrypsin. The use of β-(1→4)-galactosyltransferase and α-(2→6)-sialyltransferase in the presence of alkaline phosphatase allowed the efficient transfer of four sugar units to the acceptor resulting in an undecasaccharide glycopentapeptide.     

Solid phase synthesis of structurally diverse pyrimido[4,5-d] pyrimidines for the potential use in combinatorial chemistry

An efficient solid phase synthesis of pyrimido[4,5-d]pyrimidine derivatives is described. Reaction of polymer-bound pyrimidine 1 with urea or thiourea followed by cleavage from the support provided 4-aminopyrimido[4,5-d]pyrimidines 4 and 5 while treatment of 6 with phenyl isocyanate or phenyl isothiocyanate followed by cleavage from resin afforded 3-phenylpyrimido[4,5-d]pyrimidines 9 and 10.     

Solid phase phosphotriester synthesis of large oligodeoxyribonucleotides on a polyamide support.

Phosphotriester solid phase methodology on a polyamide support [(1980) Nucleic Acids Research, 8, 1081-1096] has been extended for the rapid synthesis of the tetradecanucleotide, d(AGTTGTTTGTAGTT), the octadecanucleotide, d(GTGGGTTTGGGGCAGGTC), and the heneicosanucleotide, d(GTGCTCTTATCCTCTTGGCTC). Thus, oligodeoxyribonucleotides comparable in size to those obtained by solution synthesis are readily accessible using solid phase techniques. An approach to the purification of the synthetic octadecanucleotide without recourse to high performance liquid chromatography is described.     

Solid phase synthesis of oligodeoxyribonucleoside phosphorodithioates from thiophosphoramidites.

Oligonucleoside phosphorodithioates 1 are modified DNA sequences with potential use as antisense oligonucleotides. The preparation of up to 20-mers containing all four bases by solid phase synthesis is described, with details on the preparation of the four monomer units (protected nucleoside thiophosphoramidites 2), the conditions used for the assembly of the strands with up to 19 phosphorodithioate linkages, and the purification and characterisation of the products. Full-length homogeneity of HPLC-purified all-phosphorodithioate products is demonstrated by PAGE, but 31P NMR discloses the presence of phosphorothioate impurities (typically 8-9%), the origin of which is discussed. Oligonucleoside phosphorodithioates are freely soluble in water at neutral or basic pH, and are very stable towards oxidation, hydrolysis, and nuclease cleavage. Their ability to hybridize to complementary DNA has been studied by UV melting point (Tm) measurements. The observed depression of Tm, 0.5-2 degrees C per phosphorodithioate linkage, is higher that the 0.4-0.6 degrees C found for phosphorothioates.     

alpha-DNA. VII. Solid phase synthesis of alpha-anomeric oligodeoxyribonucleotides.

An efficient procedure for the synthesis of unnatural alpha-anomeric oligodeoxyribonucleotides is described. This solid-phase procedure is based on the use of alpha-nucleoside phosphoramidites and alpha-nucleoside derivatized solid supports corresponding to the four natural bases and allow rapid synthesis of oligonucleotides up to 20 alpha-deoxynucleotide units in length. After HPLC purification, a 15-mer: alpha-d(CCTCTCGTTCTTTAC) and a 20-mer: alpha-d(ATACTTGAGGAAGAGGTGTT) were obtained respectively in 27 and 29% overall yields. Their purity, nucleoside composition and primary structure were ascertained by HPLC and Maxam-Gilbert sequence analyses.     

Efficient syntheses of [3-15N]uracil and [3-15N]thymine.

Regiospecific syntheses of [3-15N]uracil and [3-15N]thymine are described using [15N]ammonium sulfate as a source of labeled nitrogen. The overall yields are excellent, and the reactions are amenable to production of multigram quantities of labeled material.     

Solid phase synthesis of 2-aminobenzothiazoles

A traceless solid supported protocol for the synthesis of 2-aminobenzothiazoles is described, employing resin-bound acyl-isothiocyanate and a series of anilines. Cyclization of the resulting N-acyl, N′-phenyl-thioureas generates the 2-aminobenzothiazole scaffold, which can be further elaborated prior to hydrazine-mediated cleavage of the final products from the carboxy-polystyrene resin. A small, focused library of 2-aminobenzothiazoles was prepared.     

Solid phase synthesis of retro-inverso peptide analogues. Synthesis and biological activity of the partially modified retro-inverso analogue of the bradykinin potentiating peptide BPP9a [gLys6, (RS)-mPhe7, Ala8] BPP9a

The solid phase synthesis of a partially modified retro-inverso analogue of the bradykinin potentiating peptide BPP9a, [gLys6, (R,S)-mPhe7, Ala8] BPP9a is described. The analogue, which is active in vitro and in vivo, displays prolonged resistance towards cleavage by angiotensin converting enzyme (ACE).     

Short synthesis of a benzyl ether-protected building block for the synthesis of carbocyclic galactopyranose mimics

A versatile intermediate for the synthesis of galactose-mimicking carbasugars was synthesised from tetrabenzyl galactose in five steps and 30% overall yield. The reaction sequence uses an l-proline-mediated aldol reaction as key step. The reaction sequence was run on several grams of material.