Spectroscopic and calorimetric investigation on the DNA triplex formed by d(CTCTTCTTTCTTTTCTTTCTTCTC) and d(GAGAAGAAAGA) at acidic pH.

The equimolar mixture of d(CTCTTCTTTCTTTTCTTTCTTCTC) (dY24) and d(GAGAAGAAAGA) (dR11) [designated (dY24).(dR11)], forms at pH = 5 a DNA triplex, which mimicks the H-DNA structure. The DNA triplex was identified by the following criteria: (i) dY24 and dR11 co-migrate in a poly-acrylamide gel, with a mobility and a retardation coefficient comparable to those observed for an 11-triad DNA triplex, previously characterized in our laboratories (1); (ii) the intercalator ethidium bromide shows a poor affinity for (dR11).(dY24) at pH = 5, and a high affinity at pH = 8; (iii) the (dR11).(dY24) mixture is not a substrate for DNase I at pH = 5; (iv) the CD spectrum of (dR11).(dY24), at pH = 5, is consistent with those previously reported for triple-stranded DNA. The (dR11).(dY24) mixture exhibits a thermally induced co-operative transition, which appears to be monophasic, reversible and concentration dependent. This transition is attributed to the disruption of the DNA triplex into single strands. The enthalpy change of the triplex-coil transition was measured by DSC (delta Hcal = 129 +/- 6 kcal/mol) and, assuming a two-state model, by analysis of UV-denaturation curves (average of two methods delta HUV = 137 +/- 13 kcal/mol). Subtracting from delta Hcal of triplex formation the contributions due to the Watson-Crick helix and to the protonation of the C-residues, we found that each pyrimidine binding into the major groove of the duplex, through a Hoogsteen base pair, is accompanied by an average delta H = -5.8 +/- 0.6 kcal/mol. The effect on the stability of the (dR11).(dY24) triplex due to the substitution of a T:A:T triad with a T:T:T one was also investigated.     

Thermodynamic analysis of catalysis by the dihydroorotases from hamster and Bacillus caldolyticus, as compared with the uncatalyzed reaction

Dihydroorotase (DHOase, EC 3.5.2.3) from the extreme thermophile Bacillus caldolyticus has been subcloned, sequenced, expressed, and purified as a monomer. The catalytic properties of this thermophilic DHOase have been compared with another type I enzyme, the DHOase domain from hamster, to investigate how the thermophilic enzyme is adapted to higher temperatures. B. caldolyticus DHOase has higher Vmax and Ks values than hamster DHOase at the same temperature. The thermodynamic parameters for the binding of L-dihydroorotate were determined at 25 degrees C for hamster DHOase (deltaG = -6.9 kcal/mol, deltaH = -11.5 kcal/mol, TdeltaS = -4.6 kcal/mol) and B. caldolyticus DHOase (deltaG = -5.6 kcal/mol, deltaH = -4.2 kcal/mol, TdeltaS = +1.4 kcal/mol). The smaller enthalpy release and positive entropy for thermophilic DHOase are indicative of a weakly interacting Michaelis complex. Hamster DHOase has an enthalpy of activation of 12.3 kcal/mol, similar to the release of enthalpy upon substrate binding, rendering the kcat/Ks value almost temperature independent. B. caldolyticus DHOase shows a decrease in the enthalpy of activation from 12.2 kcal/mol at temperatures from 30 to 50 degrees C to 5.3 kcal/mol for temperatures of 50-70 degrees C. Vibrational energy at higher temperatures may facilitate the transition ES --> ES(double dagger), making kcat/Ks almost temperature independent. The pseudo-first-order rate constant for water attack on L-dihydroorotate, based on experiments at elevated temperature, is 3.2 x 10(-11) s(-1) at 25 degrees C, with deltaH(double dagger) = 24.7 kcal/mol and TdeltaS(double dagger) = -6.9 kcal/mol. Thus, hamster DHOase enhances the rate of substrate hydrolysis by a factor of 1.6 x 10(14), achieving this rate enhancement almost entirely by lowering the enthalpy of activation (delta deltaH(double dagger) = -19.5 kcal/mol). Both the rate enhancement and transition state affinity of hamster DHOase increase steeply with decreasing temperature, consistent with the development of H-bonds and electrostatic interactions in the transition state that were not present in the enzyme-substrate complex in the ground state.     

Conformation and stability of the Streptococcus pyogenes pSM19035-encoded site-specific beta recombinase, and identification of a folding intermediate

Solution properties of beta recombinase were studied by circular dichroism and fluorescence spectroscopy, size exclusion chromatography, analytical ultracentrifugation, denaturant-induced unfolding and thermal unfolding experiments. In high ionic strength buffer (1 M NaCl) beta recombinase forms mainly dimers, and strongly tends to aggregate at ionic strength lower than 0.3 M NaCl. Urea and guanidinium chloride denaturants unfold beta recombinase in a two-step process. The unfolding curves have bends at approximately 5 M and 2.2 M in urea and guanidinium chloride-containing buffers. Assuming a three-state unfolding model (N2-->2I-->2U), the total free energy change from 1 mol of native dimers to 2 mol of unfolded monomers amounts to deltaG(tot) = 17.9 kcal/mol, with deltaG(N2-->2I) = 4.2 kcal/mol for the first transition and deltaG(I-->U) = 6.9 kcal/mol for the second transition. Using sedimentation-equilibrium analytical ultracentrifugation, the presence of beta recombinase monomers was indicated at 5 M urea, and the urea dependence of the circular dichroism at 222 nm strongly suggests that folded monomers represent the unfolding intermediate.     

Thermodynamic parameters of the binding of retinol to binding proteins and to membranes

Retinol (vitamin A alcohol) is a hydrophobic compound and distributes in vivo mainly between binding proteins and cellular membranes. To better clarify the nature of the interactions of retinol with these phases which have a high affinity for it, the thermodynamic parameters of these interactions were studied. The temperature-dependence profiles of the binding of retinol to bovine retinol binding protein, bovine serum albumin, unilamellar vesicles of dioleoylphosphatidylcholine, and plasma membranes from rat liver were determined. It was found that binding of retinol to retinol binding protein is characterized by a large increase in entropy (T delta S degrees = +10.32 kcal/mol) and no change in enthalpy. Binding to albumin is driven by enthalpy (delta H degrees = -8.34 kcal/mol) and is accompanied by a decrease in entropy (T delta S degrees = -2.88 kcal/mol). Partitioning of retinal into unilamellar vesicles and into plasma membranes is stabilized both by enthalpic (delta H degrees was -3.3 and -5.5 kcal/mol, respectively) and by entropic (T delta S degrees was +4.44 and +2.91 kcal/mol, respectively) components. The implications of these finding are discussed.     

Thermodynamic and structural properties of pentamer DNA.DNA, RNA.RNA, and DNA.RNA duplexes of identical sequence

Four pentamers with the general sequence 5'CU(T)GU(T)G/5'CACAG have been prepared by chemical synthesis in order to generate duplex structures with common sequences. The four duplexes studied include the DNA.DNA duplex (5'dCACAG/5'dCTGTG) and the RNA.RNA duplex (5'rCUGUG/5'rCACAG) as well as the two corresponding DNA.RNA heteroduplexes (5'rCUGUG/5'dCACAG and 5'CACAG/5'dCTGTG). The measured entropy, enthalpy, and free energy changes upon melting are reported for each pentamer and compared to the predicted values where possible. Results show that the two DNA.RNA heteroduplexes are destabilized (delta G degrees 25 = -4.2 +/- 0.4 kcal/mol) relative to either the DNA.DNA duplex (delta G degrees 25 = -4.8 +/- 0.5 kcal/mol) or the RNA.RNA duplex (delta G degrees 25 = -5.8 +/- 0.6 kcal/mol). Circular dichroism spectra indicate that the RNA and the two heteroduplexes adopt an A-form conformation, while the DNA conformation is B-form. Imino proton NMR spectra also show that the heteroduplex structures resemble the RNA.RNA duplex.     

Thermodynamic parameters for an expanded nearest-neighbor model for the formation of RNA duplexes with single nucleotide bulges

Thirty-four RNA duplexes containing single nucleotide bulges were optically melted, and the thermodynamic parameters deltaH degrees, deltaS degrees, deltaG degrees (37), and T(M) for each sequence were determined. Data from this study were combined with data from previous thermodynamic data [Longfellow, C. E., Kierzek, R., and Turner, D. H. (1990) Biochemistry 29, 278-85] to develop a model that will more accurately predict the free energy of an RNA duplex containing a single nucleotide bulge. Differences between purine and pyrimidine bulges as well as differences between Group I duplexes, those in which the bulge is not identical to either neighboring nucleotide, and Group II duplexes, those in which the bulge is identical to at least one neighboring nucleotide, were considered. The length of the duplex, non-nearest-neighbor effects, and bulge location were also examined. A model was developed which divides sequences into two groups: those with pyrimidine bulges and those with purine bulges. The proposed model for pyrimidine bulges predicts deltaG degrees (37,bulge) = 3.9 kcal/mol + 0.10deltaG degrees (37,nn) + beta, while the model for purine bulges predicts deltaG degrees (37,bulge) = 3.3 kcal/mol - 0.30deltaG degrees (37,nn) + beta, where beta has a value of 0.0 and -0.8 kcal/mol for Group I and Group II sequences, respectively, and deltaG degrees (37,nn) is the nearest-neighbor free energy of the base pairs surrounding the bulge. The conformation of bulge loops present in rRNA was examined. Three distinct families of structures were identified. The bulge loop was either extrahelical, intercalated, or in a "side-step" conformation.     

Watson-Crick base-pairing properties of bicyclo-DNA.

A series of sequences of the DNA analog bicyclo-DNA, 6-12 nucleotides in length and containing all four natural nucleobases, were prepared and their Watson-Crick pairing properties with complementary RNA and DNA, as well as in its own series, were analyzed by UV-melting curves and CD-spectroscopy. The results can be summarized as follows: bicyclo-DNA forms stable Watson-Crick duplexes with complementary RNA and DNA, the duplexes with RNA generally being more stable than those with DNA. Pyrimidine-rich bicyclo-DNA sequences form duplexes of equal or slightly increased stability with DNA or RNA, whereas purine-rich sequences show decreased affinity to complementary DNA and RNA when compared with wild-type (DNA-DNA, DNA-RNA) duplexes. In its own system, bicyclo-DNA prefers antiparallel strand alignment and strongly discriminates for base mismatches. Duplexes are always inferior in stability compared with the natural ones. A detailed analysis of the thermodynamic properties was performed with the sequence 5'-GGATGGGAG-3'x 5'-CTCCCATCC-3' in both backbone systems. Comparison of the pairing enthalpy and entropy terms shows an enthalpic advantage for DNA association (delta deltaH = -18 kcal x (mol)-1)) and an entropic advantage for bicyclo-DNA association (delta deltaS = 49 cal x K(-1) x mol(-1), leading to a delta deltaG 25 degrees C of -3.4 kcal x mol(-1) in favor of the natural duplex. The salt dependence of Tm for this sequence is more pronounced in the case of bicyclo-DNA due to increased counter ion screening from the solvent. Furthermore bicyclo-DNA sequences are more stable towards snake venom phosphodiesterase by a factor of 10-20, and show increased stability in fetal calf serum by a factor of 8 compared with DNA.     

Calorimetric and spectroscopic investigation of drug--DNA interactions: II. Dipyrandium binding to poly d(AT).

We report the first calorimetric investigation of steroid diamine binding to a DNA duplex. Absorption spectroscopy, batch calorimetry, and differential scanning calorimetry (DSC) have been used to detect, monitor, and thermodynamically characterize the binding of the steroid diamine, dipyrandium, to poly d(AT). The following thermodynamic data for the binding in 16 mM Na+ at 25 degrees C have been obtained: delta G degree = -6.5 kcal/mol, delta H degree = +4.2 kcal/mol, and delta S = +36 e.u. We interpret the endothermic binding enthalpy in terms of steroid-induced conformational changes in the duplex (e.g. "kinking"). The large positive entropy is interpreted in terms of binding-induced release of bound water and condensed sodium ions. The salt-dependence of the binding constant is interpreted in terms of dipyrandium site-binding involving only one of the two charged ends of the steroid. The optical and DSC curves for the unsaturated steroid-poly d(AT) complexes exhibit biphasic behavior. A comparison of the van't Hoff and the calorimetric transition enthalpies reveals that steroid binding reduces the cooperativity of the transition.     

Equilibrium constants under physiological conditions for the reactions of choline kinase and the hydrolysis of phosphorylcholine to choline and inorganic phosphate.

The observed equilibrium constants (Kobs) of the P-choline hydrolysis reaction have been determined under physiological conditions of temperature (38 degrees) and ionic strength (0.25 M) and physiological ranges of pH and free [Mg2+]. Using sigma and square brackets to indicate total concentrations: (see article.) The value of Kobs has been found to be relatively insensitive to variations in pH and free [Mg2+]. At pH 7.0 and taking the standard state of liquid water to have unit activity ([H2O] = 1), Kobs = 26.6 M at free [Mg2+] = 0 [epsilon G0obs = -2.03 kcal/mol(-8.48 kJ/mol)], 26.8 M at free [Mg2+] = 10(-3) M, and 28.4 M at free [Mg2+] = 10(-2) M. At pH 8.0, Kobs = 18.8 M at free [Mg2+] = 0, 19.2 M at free [Mg2+] = 10(-3), and 22.2 M at free [Mg2+] = 10(-2) M. These values apply only to situations where choline and Pi concentrations are both relatively low (such as the conditions found in most tissues). At higher concentrations of phosphate and choline, the value of Kobs becomes significantly increased since HPO42- complexes choline weakly (association constant = 3.3 M-1). The value of K at 38 degrees and I = 0.25 M is calculated to be 16.4 +/- 0.3 M [epsilonG0 = 1.73 kcal/mol (-7.23 kJ/mol)]. The K for the P-choline hydrolysis reaction has been combined with the K for the ATP hydrolysis reaction determined previously under physiological conditions to calculate a value of 4.95 X 10(-3 M [deltaG0 j.28 kcal/mol (13.7 kJ/mol] for the K of the choline kinase reaction (EC 2.7.1.32), an important step in phospholipid metabolism: (see article.) Likewise, values for Kobs for the choline kinase reaction at 38 degrees, pH 7.0, and I = 0.25 M have been calculated to be 5.76 X 10(4) [deltaG0OBS = -6.77 KCAL/MOL (-28.3 KJ/mol)] at [Mg2+] = 0; 1.24 X 10(4) [deltaG0obs = -5.82 kcal/mol (-24.4 kJ/mol)] at [Mg2+] = 10(-3) M and 8.05 X 10(3) [delta G0obs = -5.56 kcal/mol (-23.3 kJ/mol)] at [Mg2+ = 10(-2) M. Attempts to determine the Kobs of the choline kinase reaction directly were unsuccessful because of the high value of the constant. The results indicate that in contrast to the high deltaG0obs for the hydrolysis of the ester bond of acetylcholine, the deltaG0obs for the hydrolysis of the ester bond of P-choline is quite low, among the lowest known for phosphate ester bonds of biological interest.     

Reaction of Escherichia coli and yeast photolyases with homogeneous short-chain oligonucleotide substrates

Similar rates have been observed for dimer repair with Escherichia coli photolyase and the heterogeneous mixtures generated by UV irradiation of oligothymidylates [UV-oligo(dT)n, n greater than or equal to 4] or DNA. Comparable stability was observed for ES complexes formed with UV-oligo(dT)n, (n greater than or equal to 9) or dimer-containing DNA. In this paper, binding studies with E. coli photolyase and a series of homogeneous oligonucleotide substrates (TpT, TpTp, pTpT, TpTpT, TpTpT, TpTpTpT, TpTpTpT, TpTpTpT, TpTpTpT) show that about 80% of the binding energy observed with DNA as substrate (delta G approximately 10 kcal/mol) can be attributed to the interaction of the enzyme with a dimer-containing region that spans only four nucleotides in length. This major binding determinant (TpTpTpT) coincides with the major conformational impact region of the dimer and reflects contributions from the dimer itself (TpT, delta G = 4.6 kcal/mol), adjacent phosphates (5'p, 0.8 kcal/mol; 3'p, 1.1 kcal/mol), and adjacent thymine residues (5'T, 0.8 kcal/mol; 3'T, 1.3 kcal/mol). Similar turnover rates (average kcat = 6.7 min-1) are observed with short-chain oligonucleotide substrates and UV-oligo(dT)18, despite a 25,000-fold variation in binding constants (Kd). In contrast, the ratio Km/Kd decreases as binding affinity decreases and appears to plateau at a value near 1. Turnover with oligonucleotide substrates occurs at a rate similar to that estimated for the photochemical step (5.1 min-1), suggesting that this step is rate determining. Under these conditions, Km will approach Kd when the rate of ES complex dissociation exceeds kcat.(ABSTRACT TRUNCATED AT 250 WORDS)     

Reciprocal cooperative effects of multiple ligand binding to pyruvate kinase

The formation of multiple ligand complexes with muscle pyruvate kinase was measured in terms of dissociation constants and the standard free energies of formation were calculated. The binding of Mn2+ to the enzyme (KA = 55 +/- 5 X 10(-6) M; deltaF degrees = -5.75 +/- 0.05 kcal/mol) and to the enzyme saturated with phosphoenolpyruvate (conditional free energy) KA' = 0.8 +/- 0.4 X 10(-6) M; deltaF degrees = -8.22 +/- 0.34 kcal/mol) has been measured under identical conditions giving a free energy of coupling, delta(deltaF degrees) = -2.47 +/- 0.34 kcal/mol. Such a large negative free energy of coupling is diagnostic of a strong positively cooperative effect in ligand binding. The binding of the substrate phosphoenolpyruvate to free enzyme and the enzyme-Mn2+ complex was, by necessity, measured by different methods. The free energy of phosphoenolpyruvate binding to free enzyme (KS = 1.58 +/- 0.10 X 10(-4)M; deltaF degrees = -5.13 +/- 0.04 kcal/mol) and to the enzyme-Mn2+ complex (K3 = 0.75 +/- 0.10 X 10(-6)M; deltaF degrees = -8.26 +/- 0.07 kcal/mol) also gives a large negative free energy of coupling, delta(deltaF degrees) = -3.16 +/- 0.08 kcal/mol. Such a large negative value confirms reciprocal binding effects between the divalent cation and the substrate phosphoenolpyruvate. The binding of Mn2+ to the enzyme-ADP complex was also investigated and a free energy of coupling, delta(deltaF degrees) = -0.08 +/- 0.08 kcal/mol, was measured, indicative of little or no cooperativity in binding. The free energy of coupling with Mn2+ and pyruvate was measured as -1.52 +/- 0.14 kcal/mol, showing a significant amount of cooperativity in ligand binding but a substantially smaller effect than that observed for phosphoenolpyruvate binding. The magnitude of the coupling free energy may be related to the role of the divalent cation in the formation of the enzyme-substrate complexes. In the absence of the activating monovalent cation, the coupling free energies for phosphoenolpyruvate and pyruvate binding decrease by 40-60% and 25%, respectively, substantiating a role for the monovalent cation in the formation of enzyme-substrate complexes with phosphoenolpyruvate and with pyruvate.     

Circular dichroism and UV melting studies on formation of an intramolecular triplex containing parallel T*A:T and G*G:C triplets: netropsin complexation with the triplex.

We have used circular dichroism and UV absorption spectroscopy to characterize the formation and melting behaviour of an intramolecular DNA triple helix containing parallel T*A:T and G*G:C triplets. Our approach to induce and to stabilize a parallel triplex involves the oligonucleotide 5'-d(G4A4G4[T4]C4T4C4-[T4]G4T4G4) ([T4] represents a stretch of four thymine residues). In a 10 mM sodium cacodylate, 0.2 mM disodium EDTA (pH 7) buffer, we have shown the following significant results. (i) While in the absence of MgCl2 this oligonucleotide adopts an intramolecular hairpin duplex structure prolonged by the single strand extremity 5'-d([T4]G4T4G4), the presence of millimolar concentrations of MgCl2generates an intramolecular triplex (via double hairpin formation). (ii) In contrast to the antiparallel triplex formed by the oligonucleotide 5'-d(G4T4G4[T4]G4A4G4[T4]C4T4C4), the parallel triplex melts in a biphasic manner (a triplex to duplex transition followed by a duplex to coil transition) and is less stable than the antiparallel one. The enthalpy change associated with triplex formation (-37 kcal/mol) is approximately half that of duplex formation (-81 kcal/mol). (iii) The parallel triple helix is disrupted by increasing the concentration of KCl(>10 mM), whereas, under the same conditions, the antiparallel triplex remains stable. (iv) Netropsin, a natural DNA minor groove-binding ligand, binds to the central site A4/T4of the duplex or triplex in an equimolar stoichiometry. Its association constant K is smaller for the parallel triplex ( approximately 1 x 10(7) M-1) than for the antiparallel one ( approximately 1 x 10(8) M-1). In contrast to the antiparallel structure, netropsin binding has no apparent effect on thermal stability of the parallel triple helix.     

Lipopolysaccharides in bacterial membranes act like cholesterol in eukaryotic plasma membranes in providing protection against melittin-induced bilayer lysis

Melittin is a small, cationic peptide that, like many other antimicrobial peptides, lyses cell membranes by acting on their lipid bilayers. However, the sensitivity to antimicrobial peptides varies among cell types. We have performed direct binding and vesicle leakage experiments to determine the sensitivity to melittin of bilayers composed of various physiologically relevant lipids, in particular, key components of eukaryotic membranes (cholesterol) and bacterial outer membranes (lipopolysaccharide or LPS). Melittin binds to bilayers composed of both zwitterionic and negatively charged phospholipids, as well as to the highly charged LPS bilayers. The magnitude of the free energy of binding (deltaG degrees ) increases with increasing bilayer charge density; deltaG degrees = -7.6 kcal/mol for phosphatidylcholine (PC) bilayers and -8.9 to -11.0 kcal/mol for negatively charged bilayers containing phosphatidylserine (PS), phospholipids with covalently attached polyethylene glycol (PEG-lipids), or LPS. Comparisons of these data show that binding is not markedly affected by the steric barrier produced by the PEG in PEG-lipids or by the polysaccharide core of LPS. The addition of equimolar cholesterol to PC bilayers reduces the level of binding (deltaG degrees = -6.4 kcal/mol) and reduces the extent of melittin-induced leakage by 20-fold. LPS and 1:1 PC/cholesterol bilayers have similar high resistance to melittin-induced leakage, indicating that cholesterol in eukaryotic plasma membranes and LPS in Gram-negative bacteria provide strong protection against the lytic effects of melittin. We argue that this resistance is due at least in part to the similar tight packing of the lipid acyl chains in PC/cholesterol and LPS bilayers. The addition of bacterial phospholipids to LPS bilayers increases their sensitivity to melittin, helping to explain the higher sensitivity of deep rough bacteria compared to smooth phenotypes.     

Binding of the recombinant proteinase inhibitor eglin c from leech Hirudo medicinalis to human leukocyte elastase, bovine alpha-chymotrypsin and subtilisin Carlsberg: thermodynamic study

The effect of pH and temperature on the apparent association equilibrium constant (Ka) for the binding of the recombinant proteinase inhibitor eglin c from leech Hirudo medicinalis to human leukocyte elastase (EC 3.4.21.37), bovine alpha-chymotrypsin (EC 3.4.21.1) and subtilisin Carlsberg (EC 3.4.21.14) has been investigated. On lowering the pH from 9.5 to 4.5, values of Ka for eglin c binding to the serine proteinases considered decrease thus reflecting the acid-pK shift of the invariant histidyl catalytic residue (His57 in human leukocyte elastase and bovine alpha-chymotrypsin, and His64 in subtilisin Carlsberg) from congruent to 6.9, in the free enzymes, to congruent to 5.1, in the enzyme:inhibitor adducts. At pH 8.0, values of the apparent thermodynamic parameters for eglin c binding are: human leukocyte elastase - Ka = 1.0 x 10(10) M-1, delta G phi = -13.4 kcal/mol, delta H phi = +1.8 kcal/mol, and delta S phi = +52 entropy units; bovine alpha-chymotrypsin -Ka = 5.0 x 10(9) M-1, delta G phi = -13.0 kcal/mol, delta H phi = +2.0 kcal/mol, and delta S phi = +51 entropy units; and subtilisin Carlsberg - Ka = 6.6 x 10(9) M-1, delta G phi = -13.1 kcal/mol, delta H phi = +2.0 kcal/mol, and delta S phi = +51 entropy units (values of Ka, delta G phi and delta S phi were obtained at 21 degrees C; values of delta H phi were temperature independent over the range explored, i.e. between 10 degrees C and 40 degrees C; 1 kcal = 4184J).(ABSTRACT TRUNCATED AT 250 WORDS)     

Binding of netropsin and 4,6-diamidino-2-phenylindole to an A2T2 DNA hairpin: a comparison of biophysical techniques

Isothermal titration calorimetry (ITC), differential scanning calorimetry (DSC), and biosensor-surface plasmon resonance (SPR) are evaluated for their accuracy in determining equilibrium constants, ease of use, and range of application. Systems chosen for comparison of the three techniques were the formation of complexes between two minor groove binding compounds, netropsin and 4,6-diamidino-2-phenylindole (DAPI), and a DNA hairpin having the sequence 5'-d(CGAATTCGTCTCCGAATTCG)-3'. These systems were chosen for their structural differences, simplicity (1:1 binding), and binding affinity in the range of interest (K approximately 10(8) M(-1)). The binding affinities determined from all three techniques were in excellent agreement; for example, netropsin/DNA formation constants were determined to be K = 1.7x10(8) M(-1) (ITC), K = 2.4x10(8) M(-1) (DSC), and K = 2.9x10(8) M(-1) (SPR). DSC and SPR techniques have an advantage over ITC in studies of ligands that bind with affinities greater than 10(8) M(-1). The ITC technique has the advantage of determining a full set of thermodynamic parameters, including deltaH, TdeltaS, and deltaC(p) in addition to deltaG (or K). The ITC data revealed complex binding behavior in these minor groove binding systems not detected in the other methods. All three techniques provide accurate estimates of binding affinity, and each has unique benefits for drug binding studies.     

Investigation of phosphotyrosine recognition by the SH2 domain of the Src kinase.

The binding of tyrosine phosphorylated targets by SH2 domains is required for propagation of many cellular signals in higher eukaryotes; however, the determinants of phosphotyrosine (pTyr) recognition by SH2 domains are not well understood. In order to identify the attributes of pTyr required for high affinity interaction with SH2 domains, the binding of the SH2 domain of the Src kinase (Src SH2 domain) to a dephosphorylated peptide, a phosphoserine-containing peptide, and the amino acid pTyr was studied using titration calorimetry and compared with the binding of a high affinity tyrosyl phosphopeptide. The dephosphorylated peptide and the phosphoserine containing peptide both bind extremely weakly to the Src SH2 domain (DeltaGo (dephosphorylated)=-3.6 kcal/mol, DeltaGo (phosphoserine) >-3.7 kcal/mol); however, the DeltaGo value of pTyr binding is more favorable (-4.7 kcal/mol, or 50 % of the entire binding free energy of a high affinity tyrosyl phosphopeptide). These results indicate that both the phosphate and the tyrosine ring of the pTyr are critical determinants of high affinity binding. Alanine mutagenesis was also used to evaluate the energetic contribution to binding of ten residues located in the pTyr-binding site. Mutation of the strictly conserved Arg betaB5 resulted in a large increase in DeltaGo (DeltaDeltaGo=3.2 kcal/mol) while elimination of the other examined residues each resulted in a significantly smaller (DeltaDeltaGo<1.4 kcal/mol) reduction in affinity, indicating that Arg betaB5 is the single most important determinant of pTyr recognition. However, mutation of Cys betaC3, a residue unique to the Src SH2 domain, surprisingly increased affinity by eightfold (DeltaDeltaGo=-1.1 kcal/mol). Using a double mutant cycle analysis, it was revealed that residues of the pTyr-binding pocket are not coupled to the peptide residues C-terminal to the pTyr. In addition, comparison of each residue's DeltaDeltaGo value upon mutation with that residue's sequence conservation among SH2 domains revealed only a modest correlation between a residue's energetic contribution to pTyr recognition and its conservation throughout evolution. The results of this investigation highlight the importance of a single critical interaction, the buried ionic bond between the phosphate of the pTyr and Arg betaB5 of the SH2 domain, driving the binding of SH2 domains to tyrosine phosphorylated targets.     

Kinetic and thermodynamic characterization of the R17 coat protein-ribonucleic acid interaction

A filter retention assay is used to examine the kinetic and equilibrium properties of the interaction between phage R17 coat protein and its 21-nucleotide RNA binding site. The kinetics of the reaction are consistent with the equilibrium association constant and indicate a diffusion-controlled reaction. The temperature dependence of Ka gives delta H = -19 kcal/mol. This large favorable delta H is partially offset by a delta S = -30 cal mol-1 deg-1 to give a delta G = -11 kcal/mol at 2 degrees C in 0.19 M salt. The binding reaction has a pH optimum centered around pH 8.5, but pH has no effect on delta H. While the interaction is insensitive to the type of monovalent cation, the affinity decreases with the lyotropic series among monovalent anions. The ionic strength dependence of Ka reveals that ionic contacts contribute to the interaction. Most of the binding free energy, however, is a result of nonelectrostatic interactions.     

Thermal and urea-induced unfolding of the marginally stable lac repressor DNA-binding domain: a model system for analysis of solute effects on protein processes

Thermodynamic and structural evidence indicates that the DNA binding domains of lac repressor (lacI) exhibit significant conformational adaptability in operator binding, and that the marginally stable helix-turn-helix (HTH) recognition element is greatly stabilized by operator binding. Here we use circular dichroism at 222 nm to quantify the thermodynamics of the urea- and thermally induced unfolding of the marginally stable lacI HTH. Van't Hoff analysis of the two-state unfolding data, highly accurate because of the large transition breadth and experimental access to the temperature of maximum stability (T(S); 6-10 degrees C), yields standard-state thermodynamic functions (deltaG(o)(obs), deltaH(o)(obs), deltaS(o)(obs), deltaC(o)(P,obs)) over the temperature range 4-40 degrees C and urea concentration range 0 相似文献   

Flanking DNA-sequences contribute to the specific binding of cI-repressor and OR1.

The binding of cI-repressor to a series of mutant operators containing OR1 of the right operator of bacteriophage lambda was investigated. Sites OR2 and/or OR3 were inactivated by either point or deletion mutations. The free energy of binding repressor to OR1 in the wildtype operator, delta G1, is -13.7 +/- 0.3 kcal/mol. delta G1 determined for an OR2- operator created by a single point mutation in OR2 is -13.6 +/- 0.2 kcal/mol. In contrast, delta G1 for the binding of repressor to a cloned synthetic OR1 operator containing only 24 bp of lambda sequence is -12.2 +/- 0.1 kcal/mol. When sequence 5' to OR1 is present, the binding affinity increases to -13.0 +/- 0.1 kcal/mol. In addition, the proximity of OR1 to a fragment-end decreases delta G1 from -13.7 to -12.3 +/- 0.1 kcal/mol. These results suggest that the DNA sequence outside the 17 bp OR1 binding-site contributes to the specific binding of cI-repressor.     

Identification of key amino acid residues in the assembly of enzymes into the pyruvate dehydrogenase complex of Bacillus stearothermophilus: a kinetic and thermodynamic analysis

Structural studies have shown that electrostatic interactions play a major part in the binding of dihydrolipoyl dehydrogenase (E3) to the peripheral subunit-binding domain (PSBD) of the dihydrolipoyl acyltransferase (E2) in the assembly of the pyruvate dehydrogenase multienzyme complex of Bacillus stearothermophilus. The binding is characterized by a small, unfavorable enthalpy change (deltaH degrees = +2.2 kcal/mol) and a large, positive entropy change (TdeltaS degrees = +14.8 kcal/mol). The contributions of individual surface residues of the PSBD of E2 to its interaction with E3 have been assessed by alanine-scanning mutagenesis, surface plasmon resonance detection, and isothermal titration calorimetry. The mutation R135A in the PSBD gave rise to a significant decrease (120-fold) in the binding affinity; two other mutations (R139A and R156A) were associated with smaller effects. The binding of the R135A mutant to E3 was accompanied by a favorable enthalpy (deltaH degrees = -2.6 kcal/mol) and a less positive entropy change (TdeltaS degrees = +7.2 kcal/mol). The midpoint melting temperature (T(m)) of E3-PSBD complexes was determined by differential scanning calorimetry. The R135A mutation caused a significant decrease (5 degrees C) in the T(m), compared with the wild-type complex. The results reveal the importance of Arg135 of the PSBD as a key residue in the molecular recognition of E3 by E2, and as a major participant in the overall entropy-driven binding process. Further, the effects of mutagenesis on the deltaCp of subunit association illustrate the difficulties in attributing changes in heat capacity to specific classes of interactions.