Extending the range of amide proton relaxation dispersion experiments in proteins using a constant-time relaxation-compensated CPMG approach

Relaxation compensated constant-time Carr–Purcell–Meiboom–Gill relaxation dispersion experiments for amide protons are presented that detect s-ms time-scale dynamics of protein backbone amide sites. Because of their ten-fold larger magnetogyric ratio, much shorter 180° pulses can be applied to ¹H than to ¹⁵N spins; therefore, off-resonance effects are reduced and a wider range of effective rf fields can often be used in the case of ¹H experiments. Applications to [¹H-¹⁵N]-ubiquitin and [¹H-¹⁵N]-perdeuterated HIV-1 protease are discussed. In the case of ubiquitin, we present a pulse sequence that reduces artifacts that arise from homonuclear ³J(H_N-H) coupling. In the case of the protease, we show that relaxation dispersion of both ¹H and ¹⁵N spins provides a more comprehensive picture of slow backbone dynamics than does the relaxation dispersion of either spin alone. We also compare the relative merits of ¹H versus ¹⁵N transverse relaxation measurements and note the benefits of using a perdeuterated protein to measure the relaxation dispersion of both spin types.     

Determination of conformational transition rates in the trp promoter by 1H NMR rotating-frame T1 and cross-relaxation rate measurements

Rotating-frame relaxation measurements have been used in conjunction with spin-spin relaxation rate constants to investigate a conformational transition previously observed in the -10 region of the trp promoter d(CGTACTAGTTAACTAGTACG)2 (Lefèvre, Lane, Jardetzky 1987). The transition is localised to the sub-sequence TAAC, and is in fast exchange on the chemical shift time-scale. The rate constant for the exchange process has been determined from measurements of the rotating-frame relaxation rate constant as a function of the spin-lock field strength, and is approximately 5000 s^–1 at 30 °C. Measurements have also been made as a function of temperature and in two different magnetic fields: the results are fully consistent with those expected for the exchange contribution in a two-site system. A similar transition has been observed in d(GTGATTGACAATTA).d(CACTAACTGTTAAT), which contains the –35 region of the trp promoter. This has been investigated in the same way, and has been found to undergo exchange at a faster rate under comparable conditions. In addition, the cross-relaxation rate constants for Ade C2H-Ade C2H pairs have been measured as a function of temperature, and these indicate that certain internuclear distances in YAAY subsequences increase with increasing temperature. These changes in distance are consistent with a flattening of propellor twist of the AT base-pairs. The occurrence of conformational transitions in YAAY subsequences depends on the flanking sequence.Correspondence to: A. N. Lane     

Off-resonance effects in 15N T2 CPMG measurements

The systematic difference between T ₂ values obtained from CPMG and T ₁ experiments was observed for backbone ¹⁵N nuclei of bacterial ribonuclease barnase. Theoretical consideration suggests that the observed difference is caused by off-resonance effects of 180° pulses of the CPMG pulse train. Namely, at off-resonance conditions T ₁-dependent secondary echo coherence pathways considerably contribute to the signal decay in the CPMG experiment and result in systematic (up to 10%) offset-dependent overestimation of ¹⁵N T ₂ measured by the CPMG technique. Under certain circumstances off-resonance effects result in dependence of ¹⁵N T ₂ on CPMG frequency, which might be erroneously interpreted as conformational exchange on the millisecond time-scale. A procedure for numerical correction of ¹⁵N T ₂ (CPMG) data is proposed.     

Estimating the time scale of chemical exchange of proteins from measurements of transverse relaxation rates in solution

Chemical (conformational) exchange on the ms-s time scale is reliably identified by the observation of transverse relaxation rates, R_ex, that depend upon the strength of the effective field (_1eff=B_1eff) used in spin lock or CPMG experiments. In order to determine if the exchange correlation time, _ex, is the fast or slow limit, measurements of (i) signal line shape and (ii) temperature dependence of R_ex have been commonly used in studies of stable, small molecules. However, these approaches are often not applicable to proteins, because sample stability and solubility, respectively, limit the temperature range and signal sensitivity of experiments. Herein we use a complex, but general, two-site exchange equation to show when the simple fast exchange equations for R_ex are good approximations, in the case of proteins. We then present a simple empirical equation that approximately predicts R_ex in all exchange regimes, and explains these results in a clear, straightforward manner. Finally we show how one can reliably determine whether _ex is in the fast or slow exchange limit.     

Study of amide proton exchange in 15N-enriched cryptogein using pH-dependent off-resonance ROESY-HSQC experiments

A new pH-dependent off-resonance ROESY-HSQC experiment has been used to characterize the degree of protection of the amide protons of cryptogein, a protein of the elicitin family, against solvent exchange. The study of the pH dependence of solvent-shielded amide protons in this protein reveals that the helices have different levels of stability. Two of the five helices exhibit strong protection of amide hydrogens against exchange with the solvent. By contrast, greater flexibility is observed in the other three helices, particularly in the C-terminal helix. These results provide information on the dynamic features of the protein and are consistent with the RMSD for the backbone atoms of residues involved in helical structures. In addition, the question of the flexibility in a hydrophobic cavity made of conserved residues, which represent a plausible binding site, is addressed by this method. Received: 30 July 1997 / Accepted: 11 November 1997     

Measurement of proton relaxation rates in proteins

Summary Five different types of experiment are described which make it possible to measure various relaxation rates of selected protons in crowded spectra of macromolecules such as proteins: longitudinal spin-lattice relaxation rates =1/T₁, transverse relaxation rates =1/T₂ measured under conditions of free precession, transverse relaxation rates ¹ _LOCK=1/T₁ measured under conditions of spin-locking, and transverse relaxation rates ^DQC=1/T₂ ^DQC and ^ZQC=1/T₂ ^ZQC of double- and zero-quantum coherences. The surprisingly large discrepancy between the transverse rates ^t and ^t is discussed in detail. To separate overlapping proton signals, the experimental schemes involve one or several magnetization transfer steps, using a doubly selective homonuclear Hartmann-Hahn method. Numerous variants of the basic ideas can be conceived, depending on the extent of signal overlap and on the topology of the networks of scalar couplings. Applications are shown to H and H of Tyr²³, to H, H and H of Cys³⁰, and to H and H of Ala²⁴ in bovine pancreatic trypsin inhibitor (BPTI).     

13C spin relaxation measurements in RNA: Sensitivity and resolution improvement using spin-state selective correlation experiments

A set of new NMR pulse sequences has been designed for the measurement of ¹³C relaxation rate constants in RNA and DNA bases: the spin-lattice relaxation rate constant R(C_z), the spin-spin relaxation rate constant R(C₊), and the CSA-dipolar cross-correlated relaxation rate constant . The use of spin-state selective correlation techniques provides increased sensitivity and spectral resolution. Sensitivity optimised C-C filters are included in the pulse schemes for the suppression of signals originating from undesired carbon isotopomers. The experiments are applied to a 15% ¹³C-labelled 33-mer RNA–theophylline complex. The measured ratios indicate that ¹³C CSA tensors do not vary significantly for the same type of carbon (C₂, C₆, C₈), but that they differ from one type to another. In addition, conformational exchange effects in the RNA bases are detected as a change in the relaxation decay of the narrow ¹³C doublet component when varying the spacing of a CPMG pulse train. This new approach allows the detection of small exchange effects with a higher precision compared to conventional techniques.     

Rapid and accurate processing method for amide proton exchange rate measurement in proteins

Exchange between protein backbone amide hydrogen and water gives relevant information about solvent accessibility and protein secondary structure stability. NMR spectroscopy provides a convenient tool to study these dynamic processes with saturation transfer experiments. Processing of this type of NMR spectra has traditionally required peak integration followed by exponential fitting, which can be tedious with large data sets. We propose here a computer-aided method that applies inverse Laplace transform in the exchange rate measurement. With this approach, the determination of exchange rates can be automated, and reliable results can be acquired rapidly without a need for manual processing.     

Rapid amide proton exchange rates in peptides and proteins measured by solvent quenching and two-dimensional NMR.

In an effort to develop a more versatile quenched hydrogen exchange method for studies of peptide conformation and protein-ligand interactions, the mechanism of amide proton exchange for model peptides in DMSO-D2O mixtures was investigated by NMR methods. As in water, H-D exchange rates in the presence of 90% or 95% DMSO exhibit characteristic acid- and base-catalyzed processes and negligible water catalysis. However, the base-catalyzed rate is suppressed by as much as four orders of magnitude in 95% DMSO. As a result, the pH at which the exchange rate goes through a minimum is shifted up by about two pH units and the minimum exchange rate is approximately 100-fold reduced relative to that in D2O. The solvent-dependent decrease in base-catalyzed exchange rates can be attributed primarily to a large increase in pKa values for the NH group, whereas solvent effects on pKW seem less important. Addition of toluene and cyclohexane resulted in improved proton NMR chemical shift dispersion. The dramatic reduction in exchange rates observed in the solvent mixture at optimal pH makes it possible to apply 2D NMR for NH exchange measurements on peptides under conditions where rates are too rapid for direct NMR analysis. To test this solvent-quenching method, melittin was exchanged in D2O (pH 3.2, 12 degrees C), aliquots were quenched by rapid freezing, lyophilized, and dissolved in quenching buffer (70% DMSO, 25% toluene, 4% D2O, 1% cyclohexane, 75 mM dichloroacetic acid) for NMR analysis. Exchange rates for 21 amide protons were measured by recording 2D NMR spectra on a series of samples quenched at different times. The results are consistent with a monomeric unfolded conformation of melittin at acidic pH. The ability to trap labile protons by solvent quenching makes it possible to extend amide protection studies to peptide ligands or labile protons on the surface of a protein involved in macromolecular interactions.     

Flexible and rigid structures in HIV-1 p17 matrix protein monitored by relaxation and amide proton exchange with NMR

The HIV-1 p17 matrix protein is a multifunctional protein that interacts with other molecules including proteins and membranes. The dynamic structure between its folded and partially unfolded states can be critical for the recognition of interacting molecules. One of the most important roles of the p17 matrix protein is its localization to the plasma membrane with the Gag polyprotein. The myristyl group attached to the N-terminus on the p17 matrix protein functions as an anchor for binding to the plasma membrane. Biochemical studies revealed that two regions are important for its function: D14–L31 and V84–V88. Here, the dynamic structures of the p17 matrix protein were studied using NMR for relaxation and amide proton exchange experiments at the physiological pH of 7.0. The results revealed that the α12-loop, which includes the 14–31 region, was relatively flexible, and that helix 4, including the 84–88 region, was the most protected helix in this protein. However, the residues in the α34-loop near helix 4 had a low order parameter and high exchange rate of amide protons, indicating high flexibility. This region is probably flexible because this loop functions as a hinge for optimizing the interactions between helices 3 and 4. The C-terminal long region of K113-Y132 adopted a disordered structure. Furthermore, the C-terminal helix 5 appeared to be slightly destabilized due to the flexible C-terminal tail based on the order parameters. Thus, the dynamic structure of the p17 matrix protein may be related to its multiple functions.     

The use of TROSY for detection and suppression of conformational exchange NMR line broadening in biological macromolecules

The interference between conformational exchange-induced time-dependent variations of chemical shifts in a pair of scalar coupled ¹H and ¹⁵N spins is used to construct novel TROSY-type NMR experiments to suppress NMR signal loss in [¹⁵N,¹H]-correlation spectra of a 14-mer DNA duplex free in solution and complexed with the Antp homeodomain. An analysis of double- and zero-quantum relaxation rates of base ¹H–¹⁵N moieties showed that for certain residues the contribution of conformational exchange-induced transverse relaxation might represent a dominant relaxation mechanism, which, in turn, can be effectively suppressed by TROSY. The use of the new TROSY method for exchange-induced transverse relaxation optimization is illustrated with two new experiments, 2D ^h1 J _HN,^h2 J _NN-quantitative [¹⁵N,¹H]-TROSY to measure ^h1 J _HN and ^h2 J _NN scalar coupling constants across hydrogen bonds in nucleic acids, and 2D (^h2 J _NN+^h1 J _NH)-correlation-[¹⁵N,¹H]-TROSY to correlate ¹H^N chemical shifts of bases with the chemical shifts of the tertiary ¹⁵N spins across hydrogen bonds using the sum of the trans-hydrogen bond coupling constants in nucleic acids.     

Longitudinal relaxation optimized amide <Superscript>1</Superscript>H-CEST experiments for studying slow chemical exchange processes in fully protonated proteins

Chemical Exchange Saturation Transfer (CEST) experiments are increasingly used to study slow timescale exchange processes in biomolecules. Although ¹⁵N- and ¹³C-CEST have been the approaches of choice, the development of spin state selective ¹H-CEST pulse sequences that separate the effects of chemical and dipolar exchange [T. Yuwen, A. Sekhar and L. E. Kay, Angew Chem Int Ed Engl 2016 doi:  10.1002/anie.201610759 (Yuwen et al. 2017)] significantly increases the utility of ¹H-based experiments. Pulse schemes have been described previously for studies of highly deuterated proteins. We present here longitudinal-relaxation optimized amide ¹H-CEST experiments for probing chemical exchange in protonated proteins. Applications involving a pair of proteins are presented establishing that accurate ¹H chemical shifts of sparsely populated conformers can be obtained from simple analyses of ¹H-CEST profiles. A discussion of the inherent differences between ¹⁵N-/¹³C- and ¹H-CEST experiments is presented, leading to an optimal strategy for recording ¹H-CEST experiments.     

HeteroTOCSY-based experiments for measuring heteronuclear relaxation in nucleic acids and proteins

Summary While both ³¹P and ¹¹³Cd are present at locations of interest in many different macromolecular systems, heteronuclear-detected relaxation measurements on these nuclei have been restrained by limitations in either resolution or signal-to-noise ratio. We have developed hetero TOCSY-based methods to overcome both of these problems. Two-dimensional versions of these experiments were utilized to measure ³¹P T₁ and T₂ values in DNA oligonucleotides; the additional resolution offered by a second dimension allowed determination of these values for most of the ³¹P resonances in a DNA dodecamer. The results from the experiments indicated that there was little significant variation in T₁ values for the different phosphates in the DNA dodecamer; however, the T₂ values showed a clear pattern, with lower values in the interior of the sequence than at the ends of the helix. Furthermore, a significant correlation between ³¹P chemical shifts and T₂ values was observed. One-dimensional, frequency-selective versions of these experiments were also developed for use on systems containing a smaller number of heteronuclear spins. These methods were applied to investigate the heteronuclear relaxation properties of ¹¹³Cd in ¹¹³Cd₂LAC9(61), a Cys₆Zn₂ DNA-binding domain. Data from the experiments confirm biochemical evidence that more significant differences occur in the metal-protein interactions between the two metal-binding sites than has been previously identified for proteins containing this motif.     

The relationship between amide proton chemical shifts and secondary structure in proteins

Summary The parameters for HN chemical shift calculations of proteins have been determined using data from high-resolution crystal structures of 15 proteins. Employing these chemical shift calculations for HN protons, the observed secondary structure chemical shift trends of HN protons, i.e., upfield shifts on helix formation and downfield shifts on -sheet formation, are discussed. Our calculations suggest that the main reason for the difference in NH chemical shifts in helices and sheets is not an effect from the directly hydrogen-bonded carbonyl, which gives rise to downfield shifts in both cases, but arises from an additional upfield shift predicted in helices and originating in residues i-2 and i-3. The calculations also explain the well-known relationship between amide proton shifts and hydrogen-bond lengths. In addition, the HN chemical shifts of the distorted amphipathic helices of the GCN4 leucine zipper are calculated and used to characterise the solution structure of the helices. By comparing the calculated and experimental shifts, it is shown that in general the agreement is good between residues 15 and 28. The most interesting observation is that in the N-terminal half of the zipper, although both calculated and experimental shifts show clear periodicity, they are no longer in phase. This suggests that for the N-terminal half, in the true average solution structure the period of the helix coil is longer by roughly one residue compared to the NMR structures.     

Off-resonance R1rho relaxation outside of the fast exchange limit: an experimental study of a cavity mutant of T4 lysozyme

An ¹⁵N off-resonance R ₁ spin relaxation study of an L99A point mutant of T4 lysozyme is presented. Previous CPMG-based relaxation dispersion studies of exchange in this protein have established that the molecule interconverts between a populated ground state and an excited state (3.4%) with an exchange rate constant of 1450 s^–1 at 25°C. It is shown that for the majority of residues in this protein the offset dependence of the R ₁ relaxation rates cannot be well fit using models which are only valid in the fast exchange regime. In contrast, a recently derived expression by Trott and Palmer (J. Magn. Reson., 154, 157–160, 2002) which is valid over a wider window of exchange than other relations, is shown to fit the data well. Values of (signed) chemical shift differences between exchanging sites have been extracted and are in reasonable agreement with shift differences measured using CPMG methods. A set of simulations is presented which help establish the exchange regimes that are best suited to analysis by off-resonance R ₁ techniques.     

Measurement of 15N relaxation in deuterated amide groups in proteins using direct nitrogen detection

15N chemical shielding tensors contain useful structural information, and their knowledge is essential for accurate analysis of protein backbone dynamics. The anisotropic component (CSA) of 15N chemical shielding can be obtained from 15N relaxation measurements in solution. However, the predominant contribution to nitrogen relaxation from 15N-(1)H dipolar coupling in amide groups limits the sensitivity of these measurements to the actual CSA values. Here we present nitrogen-detected NMR experiments for measuring 15N relaxation in deuterated amide groups in proteins, where the dipolar contribution to 15N relaxation is significantly reduced by the deuteration. Under these conditions nitrogen spin relaxation becomes a sensitive probe for variations in 15N chemical shielding tensors. Using the nitrogen direct-detection experiments we measured the rates of longitudinal and transverse 15N relaxation for backbone amides in protein G in D(2)O at 11.7 T. The measured relaxation rates are validated by comparing the overall rotational diffusion tensor obtained from these data with that from the conventional 15N relaxation measurements in H(2)O. This analysis revealed a 17-24 degree angle between the NH-bond and the unique axis of the 15N chemical shielding tensor.     

Microsecond timescale backbone conformational dynamics in ubiquitin studied with NMR R1rho relaxation experiments

NMR spin relaxation experiments are used to characterize the dynamics of the backbone of ubiquitin. Chemical exchange processes affecting residues Ile 23, Asn 25, Thr 55, and Val 70 are characterized using on- and off-resonance rotating-frame 15N R1rho relaxation experiments to have a kinetic exchange rate constant of 25,000 sec(-1) at 280 K. The exchange process affecting residues 23, 25, and 55 appears to result from disruption of N-cap hydrogen bonds of the alpha-helix and possibly from repacking of the side chain of Ile 23. Chemical exchange processes affecting other residues on the surface of ubiquitin are identified using 1H-15N multiple quantum relaxation experiments. These residues are located near or at the regions known to interact with various enzymes of the ubiquitin-dependent protein degradation pathway.     

A TROSY CPMG sequence for characterizing chemical exchange in large proteins

A new NMR spin relaxation experiment is described for measuring chemical exchange time constants from approximately 0.5 ms to 5 ms in ¹⁵N-labeled macromolecules. The pulse sequence is based on the Carr–Purcell–Meiboom–Gill technique [Carr and Purcell (1954) Phys. Rev., 94, 630–638; Meiboom and Gill (1958) Rev. Sci. Instrum., 29, 688–691; Loria et al. (1999) J. Am. Chem. Soc., 121, 2331–2332], but implements TROSY selection [Pervushin et al. (1997) Proc. Natl. Acad. Sci. USA, 94, 12366–12371] to permit measurement of exchange linebroadening contributions to the narrower component of the ¹H-¹⁵N scalar-coupled doublet. This modification extends the size limitation imposed on relaxation measurements due to the fast decay of transverse magnetization in larger macromolecules. The new TROSY-CPMG experiment is demonstrated on a [U-98% ¹⁵ N] labeled sample of basic pancreatic trypsin inhibitor and a [U-83% ²H, U-98% ¹⁵ N] labeled sample of triosephosphate isomerase, a 54 kDa homodimeric protein.     

Detection of early unfolding events in a dimeric protein by amide proton exchange and native electrospray mass spectrometry

Oligomeric proteins generally undergo unfolding through a dissociation/denaturation mechanism wherein the subunits first dissociate and then unfold. This mechanism can be detected by the fact that the proteins exhibit a concentration dependence of the denaturation curve. However, the concentration dependence does not answer the question of whether there are thermally induced conformational changes that facilitate subunit dissociation. To fully probe these mechanisms it is desirable to have an analytical approach that is capable of measuring both subunit dissociation and protein denaturation in a highly sensitive manner. In this article, we demonstrate that the combined use of native mass spectrometry to detect subunit mixing, and amide hydrogen/deuterium exchange to detect transient unfolding events can provide a very unique insight into the pre‐melting transitions in a protein oligomer. Both methods keep an isotopic record of each transformation event, without the dependence on equilibrium of the unfolding reaction. Here, we use a combined form of H/D exchange/mass spectrometry and isotopic labeling/native electrospray mass spectrometry to study the pre‐unfolding events of Bacillus subtilis NAD⁺ synthetase, a symmetrical dimer protein, which plays a vital role in the lifecycle of the bacteria. In the experimental outcome provided, we were able to clearly illustrate that at elevated temperatures, the NAD synthetase dimer undergoes reversible dissociation without monomer unfolding, while at temperatures where monomer unfolding is observed to take place, the rate of dimer dissociation still yet exceeds the rate of unfolding. Information provided by combining these two mass spectrometric methods was found to be very robust, and allowed us to establish an NAD synthetase unfolding model, where primary dissociation occurs prior to the complete unfolding of the NAD⁺ synthetase.