Temporal relationships of a pulse of prolactin (PRL) to a pulse of a metabolite of PGF2α in mares

Hourly blood samples were collected from 10 mares during 24 h of each of the preluteolytic, luteolytic, and postluteolytic periods. The autocorrelation function of the R program was used to detect pulse rhythmicity, and the intra-assay CV was used to locate and characterize pulses of prolactin (PRL) and a metabolite of prostaglandin F2α (PGFM). Rhythmicity of PRL and PGFM concentrations was detected in 67% and 89% of mares, respectively. Combined for the three periods (no difference among periods), the PRL pulses were 5.2 ± 0.4 h (mean ± SEM) at the base, 7.5 ± 1.5 h between nadirs of adjacent pulses, and 12.3 ± 1.5 h from peak to peak. The peaks of PRL pulses were greater (P < 0.05) during the luteolytic period (46 ± 14 ng/mL) and postluteolytic period (52 ± 15 ng/mL) than during the preluteolytic period (17 ± 3 ng/mL). Concentrations of PRL during hours of a PGFM pulse were different (P < 0.003) within the luteolytic period and postluteolytic period and were greatest at the PGFM peak; PRL concentrations during a PGFM pulse were not different during the preluteolytic period. The frequency of the peak of PRL and PGFM pulses occurring at the same hour (synchrony) was greater for the luteolytic period (65%, P < 0.01) and postluteolytic period (50%, P < 0.001) than for the preluteolytic period (17%). This is the first report in mares on characterization and rhythmicity of PRL pulses, synchrony between PRL and PGFM pulses, and greater PRL activity during the luteolytic and postluteolytic periods than during the preluteolytic period.     

Horizontal transmission of a parasitic nematode from a non-native to a native woodwasp?

In eastern North America, the exotic invasive woodwasp, Sirex noctilio, attacks pines (Pinus spp.) and often shares larval habitat with the native woodwasp, Sirex nigricornis. The parasitic nematode, Deladenus siricidicola, has been used widely in the southern hemisphere as a biological control agent because it sterilizes female S. noctilio. This nematode was introduced accidentally to North America along with S. noctilio. Historical reports indicate nematode-woodwasp fidelity: the parasitic nematode, D. siricidicola, exclusively infects S. noctilio, and the native nematode, Deladenus proximus, exclusively infects S. nigricornis. From two sites in southern Ontario, separated by 225 km, we collected woodwasps from three Pinus sylvestris, and identified the nematode species present in the abdomens of infected wasps. Both wasp species co-occurred in all three trees. D. siricidicola was present in the haemocoel, but not inside the eggs, of infected S. noctilio and S. nigricornis. This evidence suggests horizontal transmission of D. siricidicola likely occurred from S. noctilio to S. nigricornis.     

Development of a New Method to Get a Reliable Powder Flow Characteristics Using Only 1 to 2 g of Powder

In powder technology, it is often important to directly measure real powder flow rate from a small amount of powder. For example, in pharmaceutical industry, a frequent problem is to determine powder flow properties of new active pharmaceutical ingredient (API) in an early stage of the development when the amount of API is limited. The purpose of this paper is to introduce a new direct method to measure powder flow when the material is poorly flowing (cohesive) and the amount of material is about 1 to 2 g. The measuring system was simple, consisting of a flow chamber and electronic balance and an automated optical detection system, and for each measurement, only 1 to 2 g of sample was required. Based on the results obtained with this testing method, three selected sugar excipients, three grades of microcrystalline cellulose, and APIs (caffeine, carbamazepine, and paracetamol) can be classified as freely flowing, intermediate flowing, and poorly flowing powders, respectively. The average relative standard deviation for the flow time determinations was not more than 2–10%. The present novel flowability testing method provides a new tool for a rapid determination of flowing characteristics of powders (e.g., inhalation powders) and granules at a small scale.     

Teaching to Relax: Development of a Program to Potentiate Stress—Results of a Feasibility Study with Medical Undergraduate Students

Medical students are a population at risk for the development of stress-related risk states (e.g. burnout) and manifest mental disorders (e.g. depression). Still the learning of coping mechanisms against stress is not an integral part of the medical curriculum. In a pilot study we developed an elective course for learning relaxation techniques (Relacs) which was geared to the clinical practice of autogenic training (AT) with psychiatric patients. The course focussed on an innovative and mostly communicative transfer of knowledge about AT, progressive muscle relaxation and medical hypnosis and stressed the principle of repeated and supervised exercises in small student groups alongside self-administered exercise. 42 students took part in this course and showed a very high acceptance for the topic and positive evaluation. Moreover, we found a distinct improvement of the participants’ mental parameters (burnout, anxiety) and a good knowledge about the course’s contents within the final exams at the end of the semester. The structure and realisation of the course is easily adaptable and very effective regarding the improvement of the students’ mental health. Due to our results and the commonly known prevalence of stress-related disorders in medical students we postulate the integration of courses on relaxation strategies in the medical curriculum.     

Effects of a half a millennium winter on a deep lake – a shape of things to come?

Analyses of the effects of extreme climate periods have been used as a tool to predict ecosystem functioning and processes in a warmer world. The winter half‐year 2006/2007 (w06/07) has been extremely warm and was estimated to be a half‐a‐millennium event in central Europe. Here we analyse the consequences of w06/07 for the temperatures, mixing dynamics, phenologies and population developments of algae and daphnids (thereafter w06/07 limnology) in a deep central European lake and investigate to what extent analysis of w06/07 limnology can really be used as a predictive tool regarding future warming. Different approaches were used to put the observations during w06/07 into context: (1) a comparison of w06/07 limnology with long‐term data, (2) a comparison of w06/07 limnology with that of the preceding year, and (3) modelling of temperature and mixing dynamics using numerical experiments. These analyses revealed that w06/07 limnology in Lake Constance was indeed very special as the lake did not mix below 60 m depth throughout winter. Because of this, anomalies of variables associated strongly with mixing behaviour, e.g., Schmidt stability and a measure for phosphorus upward mixing during winter exceeded several standard deviations the long‐term mean of these variables. However, our modelling results suggest that this extreme hydrodynamical behaviour was only partially due to w06/07 meteorology per se, but depended also strongly on the large difference in air temperature to the previous cold winter which resulted in complete mixing and considerable cooling of the water column. Furthermore, modelling results demonstrated that with respect to absolute water temperatures, the model ‘w06/07’ most likely underestimates the increase in water temperature in a warmer world as one warm winter is not sufficient to rise water temperatures in a deep lake up to those expected under a future climate.     

Intracellular Screening of a Peptide Library to Derive a Potent Peptide Inhibitor of α-Synuclein Aggregation

Aggregation of α-synuclein (α-syn) into toxic fibrils is a pathogenic hallmark of Parkinson disease (PD). Studies have focused largely on residues 71–82, yet most early-onset mutations are located between residues 46 and 53. A semirationally designed 209,952-member library based entirely on this region was constructed, containing all wild-type residues and changes associated with early-onset PD. Intracellular cell survival screening and growth competition isolated a 10-residue peptide antagonist that potently inhibits α-syn aggregation and associated toxicity at a 1:1 stoichiometry. This was verified using continuous growth measurements and 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide cytotoxicity studies. Atomic force microscopy and circular dichroism on the same samples showed a random-coil structure and no oligomers. A new region of α-syn for inhibitor targeting has been highlighted, together with the approach of using a semirational design and intracellular screening. The peptides can then be used as candidates for modification in drugs capable of slowing or even preventing the onset of PD.     

The Extraterrestrial Origin of the Homochirality of Biomolecules – Rebuttal to a Critique

Having concluded that abiotic terrestrial mechanisms would have been ineffectual for the origin of terrestrial homochirality, we have proposed an alternative extraterrestrial scenario involving stereoselective ultraviolet photolysis of the racemic constituents of interstellar grain mantles by circularly polarized synchrotron radiation from neutron stars, followed by terrestrial accretion of the resulting chiral molecules via cometary impact. Recently L. Keszthelyi (1995) has reviewed a number of our arguments and advanced several erroneous calculations and conclusions purporting to negate them. We offer here points of rebuttal to Keszthelyi's criticisms, and support our inferences with recent data regarding indigenous enantiomeric excesses of L-amino acids in the Murchison meteorite.     

Susceptibility of a naïve population of house finches to Mycoplasma gallisepticum

Since 1994 an epidemic of mycoplasmal conjunctivitis has spread throughout the eastern house finch (Carpodacus mexicanus) population leading to a significant decline in this population. The infection has not yet been reported from house finch populations west of the Great Plains. We hypothesized that the western population, like the eastern population, is susceptible to infection, and we tested this hypothesis by experimentally infecting house finches from Missoula, Montana (USA) with the house finch strain of Mycoplasma gallisepticum (MG). We compared the response of finches from Montana infected with MG to that of finches from Auburn, Alabama (USA) (October 1999-February 2000). Fifteen house finches from Montana were shipped to Auburn and quarantined for 6 wk at the Auburn University aviary. All birds were negative for MG antibodies when tested by serum plate agglutination assay and MG could not be detected in any bird by polymerase chain reaction. We tested two methods of inoculation, ocular inoculation and contact exposure to an infected finch. Seven house finches from Montana and four house finches from Alabama were infected by bilateral ocular inoculation with 20 microliters of a culture containing 1 x 10(6) color changing units of the house finch strain of MG. The remaining eight house finches from Montana were co-housed with a house finch from Alabama exhibiting mycoplasmal conjunctivitis. After exposure to the pathogen, all house finches became infected, regardless of origin or method of exposure, and all developed conjunctivitis. All birds seroconverted, and evidence of infection could be detected in every bird at some point during the course of disease. Our results suggest that house finches from the western United States are highly susceptible to infection with the house finch strain of MG.     

Control of allergic rhinitis and asthma test – a formal approach to the development of a measuring tool

Background

The concurrent management of allergic rhinitis and asthma (ARA) has been recommended by Allergic Rhinitis and its Impact on Asthma (ARIA) guidelines. However, a tool capable of assessing simultaneously the control of upper and lower airways diseases is lacking.

Aim

To describe the studies conducted to design the control of ARA test (CARAT) questionnaire.

Methods

We performed a literature review to generate a list of potentially important items for the assessment of control of ARA. A formal consensus development process, that used an innovative web-based application, was designed – 111 experts in ARA and 60 patients participated. At the final consensus meeting, 25 primary and secondary care physicians formulated the questions and response options. A qualitative feasibility study (n = 31 patients) was conducted to evaluate the comprehensibility of the questionnaire while testing two different designs.

Results

Thirty-four potentially important items were identified. All the steps of the consensus process were completed in 2.5 months. The opinions of experts and patients lead to the formulation of 17 questions. At the feasibility study the instructions and wording problems were corrected and a semi-tabular format was chosen.

Conclusion

A tool to measure the control of allergic rhinitis and asthma was developed using a comprehensive set of methodological steps ensuring the design quality and the face and content validity. Additional validation studies to assess the psychometric properties of the questionnaire have started.     

Stabilisation of ‘Green tides’ Ulva by a method of composting with a view to pollution limitation

85 000 m³ of Ulva sp. is harvested each year in Brittany (France) during a 3–4-month season. Spreading is often impossible and the alga does not keep for more than a few days. Storage results in objectionable odours and release of a liquified fraction. Such pollution can be suppressed by composting the alga with the lowest possible quantity of ligno-cellulosic substrates. This results in the stabilisation of the seaweed, and its use can thereby be delayed. This system of processing the seaweed decreases the cost of treatment by composting and the product can be used either as a substrate for later composting or as an organic enhancing and fertilising agent. (*author for correspondence)     

Members of a new family of DNA-binding proteins bind to a conserved cis-element in the promoters of α-Amy2 genes

The promoters of wheat, barley and wild oat -Amy2 genes contain a number of conserved cis-acting elements that bind nuclear protein, we report here the isolation of two cDNAs encoding proteins (ABF1 and ABF2) that bind specifically to one of these elements, Box 2 (ATTGACTTGACCGTCATCGG). The two proteins are unrelated to each other except for a conserved region of 56–58 amino acids that consists of 25 highly conserved amino acids followed by a putative zinc finger motif, C-X_4–5-C-X_22–23-H-X₁-H. ABF1 contains two such conserved regions, whereas ABF2 possesses only one but also contains a potential leucine zipper motif, suggesting that it could form homo- or heterodimers. ABF1 and ABF2 expressed in Escherichia coli bound specifically to Box 2 probes in gel retardation experiments; this binding was abolished by the transition-metal-chelating agent, 1,10-o-phenanthroline and by EDTA. We propose that ABF1 and ABF2 are representatives of two classes of a new family of plant sequence-specific DNA-binding proteins.     

Inhibition of farnesyltransferase: a rational approach to treat cancer?

This article presents in brief the development of farnesyltransferase inhibitors (FTIs) and their preclinical and clinical status. In this review the mechanism of action of FTIs is discussed and their selectivity issue towards tumor cells is also addressed. The significant efficacy of FTIs as single or combined agents in preclinical studies stands in contrast with only moderate effects in Clinical Phase II-III studies. This suggests that there is a need to further explore and understand the complex mechanism of action of FTIs and their interaction with cytotoxic agents.     

Spray-drying of Dunaliella salina to produce a β-carotene rich powder

Powders of Dunaliella salina biomass were obtained by spray drying a cell concentrate under different drying regimes. A three-factor, two-level experimental design was employed to investigate the influence of inlet temperature, outlet temperature and feed solids on β-carotene recovery. The effect of microencapsulation in a polymer matrix of maltodextrin and gum arabic was also studied. All powders were stored under specific conditions to assess the stability of the native β-carotene. There was a trend indicating that lower outlet temperature yielded higher carotenoid recoveries, β-carotene recovery varying between 57% and 91%. Microencapsulated biomass yielded 100% recoveries. All non-microencapsulated powders were unstable in terms of β-carotene content in the presence of natural light and oxygen showing 90% degradation over a 7-day period. The incorporation of a microencapsulating agent had a significant increase in the storage stability. Results indicated a first-order degradation of the β-carotene in microencapsulated powders with kinetic constants of 0.06 day⁻¹ and 0.10 day⁻¹. HPLC analysis showed no effect of drying processes on isomer composition (9-cis-β-carotene and all-trans-β-carotene ratio). This behaviour was also observed during storage of the microencapsulated powders. Received 16 October 1996/ Accepted in revised form 13 November 1997     

Metabolic depression: a response of cancer cells to hypoxia?

Hypoxic tumours have the worst prognosis because they are the most aggressive and the most likely to metastasize. This may be because these aggressive cancers have a hypoxic core which generates signals that activate angiogenesis which enables the supply of nutrients and oxygen to a rapidly growing outer oxidative shell. The hypoxic core is a crucial element of this hypothesis, as is the fact that the cells in the hypoxic core are inherently adapted to survive hypoxia. We reasoned therefore that cancer cells exposed to hypoxia/anoxia should show the hallmarks of adaptation to hypoxia/anoxia, i.e. a down-regulation of protein synthesis and a reverse Pasteur effect. We tested this hypothesis in transformed (MCF-7) and normal (HME) human mammary epithelial cells, by exposing both cell types to a range of oxygen concentrations, including anoxia. We find that indeed protein synthesis is down-regulated in the MCF-7, but not in the HME cells in response to anoxia. The data on glycolysis are not as clear-cut, but in the light of similar previous measurements on hypoxia-tolerant animals, is still consistent with the hypothesis.     

Identification of a Compound That Disrupts Binding of Amyloid-β to the Prion Protein Using a Novel Fluorescence-based Assay

The prion protein (PrP) has been implicated both in prion diseases such as Creutzfeldt-Jakob disease, where its monomeric cellular isoform (PrP^C) is recruited into pathogenic self-propagating polymers of misfolded protein, and in Alzheimer disease, where PrP^C may act as a receptor for synaptotoxic oligomeric forms of amyloid-β (Aβ). There has been considerable interest in identification of compounds that bind to PrP^C, stabilizing its native fold and thereby acting as pharmacological chaperones to block prion propagation and pathogenesis. However, compounds binding PrP^C could also inhibit the binding of toxic Aβ species and may have a role in treating Alzheimer disease, a highly prevalent dementia for which there are currently no disease-modifying treatments. However, the absence of a unitary, readily measurable, physiological function of PrP makes screening for ligands challenging, and the highly heterogeneous nature of Aβ oligomer preparations makes conventional competition binding assays difficult to interpret. We have therefore developed a high-throughput screen that utilizes site-specifically fluorescently labeled protein to identify compounds that bind to PrP and inhibit both Aβ binding and prion propagation. Following a screen of 1,200 approved drugs, we identified Chicago Sky Blue 6B as the first small molecule PrP ligand capable of inhibiting Aβ binding, demonstrating the feasibility of development of drugs to block this interaction. The interaction of Chicago Sky Blue 6B was characterized by isothermal titration calorimetry, and its ability to inhibit Aβ binding and reduce prion levels was established in cell-based assays.