Identification of TNF-alpha-responsive NF-kappaB p65-binding element in the distal promoter of the mouse serine protease inhibitor SerpinE2

Serine protease inhibitor SerpinE2 is known as a cytokine-inducible gene. Here, we investigated whether tumor necrosis factor alpha-(TNF-alpha)-induced expression of SerpinE2 is mediated by the nuclear factor-kappaB (NF-kappaB) p65 subunit. Both steady state and TNF-alpha-induced expression of SerpinE2 mRNA were abrogated in p65-/- murine embryonic fibroblasts (MEFs). Reconstitution with wild-type p65 rescued SerpinE2 mRNA expression in an IkappaB kinase beta-dependent manner. Electrophoresis mobility shift assay and ChIP assay demonstrated that p65 bound to the kappaB-like DNA sequence located at approximately -9 kbp in the SerpinE2 promoter. In addition, TNF-alpha stimulated luciferase gene expression driven by the kappaB-like element in the reconstituted MEFs, but not in p65-/- MEFs. These results indicated that activation of NF-kappaB p65 plays an important role in TNF-alpha-induced expression of SerpinE2.     

Identification and characterization of a 3',5'-cyclic adenosine monophosphate-responsive element in the human corticotropin-releasing hormone gene promoter.

The regulation of human corticotropin-releasing hormone (hCRH) gene promoter activity by inducers of cAMP was investigated by transient transfection with a construct containing the hCRH gene promoter fused to the chloramphenicol acetyltransferase gene. Expression of hCRH-chloramphenicol acetyltransferase was strongly enhanced by forskolin in the neuroblastoma SK-N-MC and choriocarcinoma JAR cell lines. Overexpression of the catalytic subunit of protein kinase A dispensed the need for forskolin, and cotransfection of cAMP-responsive element-binding protein cDNAs enhanced forskolin-dependent expression of the hCRH promoter. Progressive 5'-end deletions of the hCRH promoter delineated a cAMP- responsive region between -226 and -164 base pairs. This fragment contained the sequence TGACGTCA at -221 base pairs, consistent with the consensus motif for a CRE. A homologous oligonucleotide responded to cAMP when cloned in either orientation in front of the thymidine kinase promoter. However, the level of constitutive and inductive cAMP expression was dependent on the cell line and on intrinsic properties of the promoter. Mutation of the wild type CRH-CRE sequence into an AP-1 site (TGAGTCA) completely abolished stimulation by cAMP. In contrast, coexpression of the catalytic subunit of protein kinase A dispensed the need for stimulation with forskolin, which showed that the CRH-CRE oligonucleotide served as a functional equivalent of the native CRE element.     

Identification of a Vitamin D response element in the human insulin receptor gene promoter

The present study was designed to explore the possible presence and location of Vitamin D response elements (VDREs) in the human insulin receptor (hIR) gene promoter. To this end, the -1819 to -271 bp fragment of the hIR promoter (wild type promoter) and progressive 5' deletions of this promoter (up to -1473 and -876 bp) were linked to the luciferase pGL2-basic vector to construct the reported plasmids: phIR (-1819)-GL2, phIR(-1473)-GL2 and phIR(-876)-GL2, respectively. U-937 cells were transiently transfected with these plasmids, and then the cells were either untreated or treated for 24h with 10(-8) M 1,25-dihydroxyvitamin D(3) (1,25D(3)). Luciferase determinations revealed that, while the activity of the wild promoter was increased 1.6-fold by the hormone, the activities of progressive 5' deletions of this promoter were enhanced 1.7-, and 1.6-fold, respectively. Thus, the region extending from -876 to -271bp of the hIR promoter, appears to contain VDREs, and to be sufficient for induction by 1,25D(3). In order to identify these potential VDREs, we performed a computer search of candidate sequences by homology with a consensus VDRE sequence. This search yielded a sequence located between -761 and -732 bp (5'CGTCGGGCCTGTGGGGCGCCTCCGGGGGTC3'), which includes an overlapping AP-2 like sequence, as a good candidate. Electrophoretic mobility shift assays revealed that the Vitamin D receptor (VDR) specifically recognized this sequence, since a VDR-DNA complex was able to compete with the unlabeled probe and was cleared by the specific anti-VDR antibody 9A7. These data represent the first identification of a VDRE in the hIR gene promoter.     

LEF-1 negatively controls interleukin-4 expression through a proximal promoter regulatory element

Lymphoid enhancer-binding factor 1 (LEF-1) and T cell factor (TCF-1) are downstream effectors of the Wnt signaling pathway and are involved in the regulation of T cell development in the thymus. LEF-1 and TCF-1 are also expressed in mature peripheral primary T cells, but their expression is down-regulated following T cell activation. Although the decisive roles of LEF-1 and TCF-1 in the early stages of T cell development are well documented, the functions of these factors in mature peripheral T cells are largely unknown. Recently, LEF-1 was shown to suppress Th2 cytokines interleukin-4 (IL-4), -5, and -13 expression from the developing Th2 cells that overexpress LEF-1 through retrovirus gene transduction. In this study, we further investigated the expression and functions of LEF-1 and TCF-1 in peripheral CD4+ T cells and revealed that LEF-1 is dominantly expressed in Th1 but not in Th2 cells. We identified a high affinity LEF-1-binding site in the negative regulatory element of the IL-4 promoter. Knockdown LEF-1 expression by LEF-1-specific small interfering RNA resulted in an increase in the IL-4 mRNA expression. This study further confirms a negative regulatory role of LEF-1 in mature peripheral T cells. Furthermore, we found that IL-4 stimulation possesses a negative effect on the expressions of LEF-1 and TCF-1 in primary T cells, suggesting a positive feedback effect of IL-4 on IL4 gene expression.     

Identification of a novel interleukin-6 response element containing an Ets-binding site and a CRE-like site in the junB promoter.

Interleukin-6 (IL-6) activation of the immediate-early gene junB has been shown to require both a tyrosine kinase and an unknown 1-(5-isoquinolinesulfonyl)-2-methylpiperazine (H7)-sensitive pathway. Here we report the identification and characterization of an IL-6 immediate-early response element in the junB promoter (designated JRE-IL6) in HepG2 cells. The JRE-IL6 element, located at -149 to -124, contains two DNA motifs, an Ets-binding site (EBS) (CAGGAAGC) and a CRE-like site (TGACGCGA). Functional studies using variously mutated JRE-IL6 elements showed that both motifs were necessary and sufficient for IL-6 response of the promoter. The EBS of the JRE-IL6 element (JEBS) appears to bind a protein in the Ets family or a related protein which could also form a major complex with the EBSs of the murine sarcoma virus long terminal repeat or human T-cell leukemia virus type 1 long terminal repeat. The CRE-like site appears to weakly bind multiple CREB-ATF family proteins. Despite the similarity in the structure between the JRE-IL6 element and the polyomavirus enhancer PyPEA3, composed of an EBS and an AP1-binding site and known to be activated by a variety of oncogene signals, JRE-IL6 could not be activated by activated Ha-Ras, Raf-1, or 12-O-tetradecanoylphorbol-13-acetate. We show that IL-6 activates JRE-IL6 through an H7-sensitive pathway that does not involve protein kinase C, cyclic AMP-dependent kinase, Ca(2+)- or calmodulin-dependent kinases, Ras, Raf-1, or NF-IL6 (C/EBP beta). The combination of JEBS and the CRE-like site appears to form the basis for the selective and efficient response of JRE-IL6 to IL-6 signals, but not to signals generated by activated Ha-Ras, Raf-1, or protein kinase C.