Cloning and characterization of the natural lactose operator

A 55-bp DNA segment carrying the wild-type lactose operator sequence has been cloned. Its sequence is: (Formula: see text). With the exceptions of the bases at positions 19 and 41, 26 and 34, and 28 and 32, the sequence is a perfect inverted repeat about base pair 30. This segment was obtained from the wild-type lactose promoter and operator region of lambda h80dlac phage DNA by a combination of in vitro and in vivo steps. Up to four direct-repeat copies of this segment have been cloned in plasmid pMB9 and pBR325. Repressor affinity for this 55-bp fragment does not differ significantly from that for a 40-bp synthetic operator fragment cloned previously, even though the 55-bp fragment contains the complete set of sequence symmetries associated with the natural operator, whereas the 40-bp fragment does not. An improved procedure for operator purification is described: this was used to prepare 14 mg of the 55-bp fragment over a 2-month period.     

Plasmids containing many tandem copies of a synthetic lactose operator

Up to 12 tandem copies of the lactose operator sequence AATTCCACATGTGGAATTGTGAGCGGATAACAATTTGTGG (3') GGTGTACACCTTAACACTCGCCTATTGTTAAACACCTTAA (5') have been cloned in the EcoRI site of plasmid pMB9. A 12-operator plasmid is about 8% operator by weight and represents a rich source of this DNA segment. A procedure for the rapid and convenient isolation of operator in mg quantities is presented. The lifetimes of complexes formed between repressor and oligo-operator plasmids increased with increasing numbers of tandem operators per plasmid. Evidence is presented indicating that only one tetrameric repressor molecule binds strongly to a segment of four (or fewer) tandem operators, but that two repressor molecules can be accommodated on segments containing at least six tandem operators.     

Cloning of chemically synthesized lactose operators. II. EcoRI-linkered operators.

A 40 base, mainly duplex DNA segment, with the following sequence pAATTCCACATGTGGAATTGTGAGCGGATAACAATTTGTT (3') GGTGTACACCTTAACACTCGCCTATTGTTAAACACCTTAAp (5') has been synthesized by combination of chemical and enzymatic methods. It consists of a wild-type lactose operator sequence (boxed) bracketed by "linker" sequences which permit excision of the segment from plasmid vehicles by the EcoRI restriction endonuclease. This segment has been ligated into the pMB9 plasmid and the resulting operator plasmids used to transform E. coli K-12. Among the transformant products were strains carrying plasmids with one, two, three, or four operator segments in tandem. Derepression of the lactose operon effected by these plasmids in vivo as well as the lifetimes of complexes formed between repressor and these plasmids in vitro increase with increasing numbers of operators per plasmid.     

Modulation of the packaging reaction of bacteriophage t4 terminase by DNA structure

Bacteriophage terminases package DNA through the portal ring of a procapsid during phage maturation. We have probed the mechanism of the phage T4 large terminase subunit gp17 by analyzing linear DNAs that are translocated in vitro. Duplex DNAs of random sequence from 20 to 500 bp were efficiently packaged. Dye and short, single-stranded end extensions were tolerated, whereas 20-base extensions, hairpin ends, 20-bp DNA-RNA hybrid, and 4-kb dsRNA substrates were not packaged. Molecules 60 bp long with 10 mismatched bases were translocated; substrates with 20 mismatched bases, a related D-loop structure, or ones with 20-base single-strand regions were not. A single nick in 100- or 200-bp duplexes, irrespective of location, reduced translocation efficiency, but a singly nicked 500-bp molecule was packaged as effectively as an unnicked control. A fluorescence-correlation-spectroscopy-based assay further showed that a 100-bp nicked substrate did not remain stably bound by the terminase-prohead. Taken together, two unbroken DNA strands seem important for packaging, consistent with a proposed torsional compression translocation mechanism.     

Replication of bacteriophage M13: XIII. Structure and replication of cloned M13 miniphage

Restriction analysis of the duplex replicative forms of four cloned M13 miniphage indicates that all species examined contain a single copy of the intergenic space between genes II and IV plus one or more copies of a portion of the genome extending from within gene IV to a site in the HaeIII G fragment within the intergenic space. Both the viral and the complementary strand origins of replication have been localized previously within the 160 base-pair HaeIII G fragment. Since reiteration of a portion of the HaeIII G fragment could possibly lead to phages having multiple copies of the origin of replication, we have determined the location of the viral strand origin-terminus in M13 miniphage by mapping the position of the discontinuity(ies) in mini-RFII³ molecules isolated during asymmetric viral strand synthesis. Limited repair of late life-cycle mini-RFII molecules with DNA polymerase I in the presence of labeled deoxynucleoside triphosphates followed by restriction analysis demonstrates that the discontinuity in the RFII is contained at a unique site within the single HaeIII G fragment. The absence of a discontinuity in the reiterated DNA sequence containing only a portion of the HaeIII G fragment indicates that the reiterations of the origin region do not include the entire sequence specifying the viral strand origin-terminus.     

Enzymatic capability of HIS-tagged HIV-1 integrase using oligonucleotide disintegration substrates

Disintegration, wherein a half-site integration substrate is resolved into separate viral and host DNA components via DNA strand transfer, is one of three well-established in vitro activities of HIV-1 integrase. The role of disintegration in the HIV-1 replicative cycle, however, remains a mystery. In this report, we describe the expression inEscherichia coli and purification of HIV-1 integrase as a fusion protein containing a 6×His tag at its amino terminus. Integrase resolved dumbbell and Y-substrates optimally at pH 6.8–7.2 in the presence of 2 mM MnCl₂. Substrate requirements for intramolecular disintegration included a 10 base pair viral U5 LTR arm and a CA dinucleotide located at the 3 end of the LTR. Disintegration was not sensitive to changes in the host DNA portion of the substrate. A dumbbell substrate with a 5 oligo-dA tail also underwent disintegration. The released LTR arm with an oligo-dA tail was utilized as a template primer by several DNA polymerases indicating that disintegration occurred via nucleophilic attack on the phosphodiester bond located immediately adjacent to the CA dinucleotide at the 3 end of the LTR. Coupled disintegration-DNA polymerase reactions provided a highly efficient and sensitive means of detecting disintegration activity. Integrase also catalyzed an apparently concerted disintegration-5-end joining reaction in which an LTR arm was transferred from one dumbbell substrate molecule to another.     

Protection of steroid hormone receptors by protease inhibitors

Steroid hormone receptors are proteolyzed by different types of enzymes present in target tissues. Effective protease inhibitors protecting steroid hormone receptors in various target tissues were investigated. Progesterone receptor (PR) in hen oviduct and estrogen receptor (ER) in cow uterus were specifically protected by relatively low concentrations (0.5 mM) of leupeptin or antipain (inhibitors of serine and thiol proteases). It was indicated that two different types of enzymes which modify native glucocorticoid receptor (GR) are present in rat liver. One was inhibited by 1 mM leupeptin or 1 mM antipain, while the other was inhibited by 1 mM phosphoramidon (inhibitor of thermolysin like proteases) or 10 mM sodium molybdate. Native PR, ER, and GR were shown to have similar Stokes radii (44 Å).     

How does lysozyme penetrate through the bacterial outer membrane?

Lysozyme fails to penetrate through the outer membrane of stationary phase cells of Escherichia coli when it is simply added to suspensions of plasmolyzed cells. Lysozyme penetrates the outer membrane only when these cells are exposed to a mild osmotic shock in the presence of EDTA and lysozyme.In the presence of Mg²⁺, the outer membrane is stabilized sufficiently so that there is no lysozyme penetration during osmotic shock. If Mg²⁺ is added after an osmotic shock has been used to cause lysozyme to penetrate a destabilized outer membrane, the outer membrane is stabilized once again. In this case however, cells are converted to spheroplasts by the lysozyme which has gained access to the murein layer prior to the addition of Mg²⁺. Mg²⁺ stabilizes the outer membranes of these spheroplasts sufficiently so that they remain immune to lysis even in the absence of osmotic stabilizers such as sucrose.These results are discussed in terms of current information on the structure of the murein layer and the outer membrane.     

Dynamics of enzymatic interactions during short flap human Okazaki fragment processing by two forms of human DNA polymerase δ

Lagging strand DNA replication requires the concerted actions of DNA polymerase δ, Fen1 and DNA ligase I for the removal of the RNA/DNA primers before ligation of Okazaki fragments. To better understand this process in human cells, we have reconstituted Okazaki fragment processing by the short flap pathway in vitro with purified human proteins and oligonucleotide substrates. We systematically characterized the key events in Okazaki fragment processing: the strand displacement, Pol δ/Fen1 combined reactions for removal of the RNA/DNA primer, and the complete reaction with DNA ligase I. Two forms of human DNA polymerase δ were studied: Pol δ4 and Pol δ3, which represent the heterotetramer and the heterotrimer lacking the p12 subunit, respectively. Pol δ3 exhibits very limited strand displacement activity in contrast to Pol δ4, and stalls on encounter with a 5′-blocking oligonucleotide. Pol δ4 and Pol δ3 exhibit different characteristics in the Pol δ/Fen1 reactions. While Pol δ3 produces predominantly 1 and 2 nt cleavage products irrespective of Fen1 concentrations, Pol δ4 produces cleavage fragments of 1–10 nts at low Fen1 concentrations. Pol δ3 and Pol δ4 exhibit comparable formation of ligated products in the complete system. While both are capable of Okazaki fragment processing in vitro, Pol δ3 exhibits ideal characteristics for a role in Okazaki fragment processing. Pol δ3 readily idles and in combination with Fen1 produces primarily 1 nt cleavage products, so that nick translation predominates in the removal of the blocking strand, avoiding the production of longer flaps that require additional processing. These studies represent the first analysis of the two forms of human Pol δ in Okazaki fragment processing. The findings provide evidence for the novel concept that Pol δ3 has a role in lagging strand synthesis, and that both forms of Pol δ may participate in DNA replication in higher eukaryotic cells.     

Evidence for the oligomeric state of 'elastic' titin in muscle sarcomeres

The giant protein titin has important roles in muscle sarcomere integrity, elasticity and contractile activity. The key role in elasticity was highlighted in recent years by single-molecule mechanical studies, which showed a direct relationship between the non-uniform structure of titin and the hierarchical mechanism of its force-extension behavior. Further advances in understanding mechanisms controlling sarcomere structure and elasticity require detailed knowledge of titin arrangement and interactions in situ. Here we present data on the structure and self-interactive properties of an ∼ 290 kDa (∼ 100 nm long) tryptic fragment from the I-band part of titin that is extensible in situ. The fragment includes the conserved ‘distal’ tandem Ig segment of the molecule and forms side-by-side oligomers with distinctive 4 nm cross-striations. Comparisons between these oligomers and the end filaments seen at the tips of native thick filaments indicate identical structure. This shows that end-filaments are formed by the elastic parts of six titin molecules connecting each end of the thick filament to the Z-line. Self-association of elastic titin into stiff end-filaments adds a further hierarchical level in the mechanism of titin extensibility in muscle cells. Self-association of this part of titin may be required to prevent interference of the individual flexible molecules with myosin cross-bridges interacting with actin.     

DNA Binding and Cleavage by the Fowlpox Virus Resolvase

The first steps of poxvirus DNA synthesis yield concatemeric arrays of covalently linked genomes. The virus-encoded Holliday junction resolvase is required to process concatemers into unit-length genomes for packaging. Previous studies of the vaccinia virus resolvase have been problematic due to poor protein solubility. We found that fowlpox virus resolvase was much more tractable. Fowlpox resolvase formed complexes with a variety of branched DNA substrates, but not linear DNA, and had the highest affinity for a Holliday junction substrate, illustrating a previously unappreciated affinity for Holliday junctions over other substrates. The cleavage activity was monitored in fixed time assays, showing that, as with vaccinia resolvase, the fowlpox enzyme could cleave a wide array of branched DNA substrates. Single turnover kinetic analysis revealed the Holliday junction substrate was cleaved 90-fold faster than a splayed duplex substrate containing a single to double strand transition. Multiple turnover kinetic analysis, however, showed that the cleavage step was not limiting for the full reaction cycle. Cleavage by resolvase was also tightly coupled at symmetrical positions across the junction, and coupling required the complete Holliday junction structure. Last, we found that cleavage of an extruded cruciform yielded a product, which after treatment with ligase, had the properties expected for covalently closed DNA hairpin ends, as is seen for poxvirus genome monomers. These findings provide a tractable poxvirus resolvase usable for the development of small molecule inhibitors.Poxvirus DNA replication is proposed to proceed by a “rolling hairpin” mechanism to yield linear concatemers, in which genomes are arranged in mostly head-to-head and tail-to tail orientation (Fig. 1, step 1) (1). The terminal sequences at each junction form an inverted repeat, which can be extruded to form a cruciform structure (step 2) (2). Cleavage of the resulting Holliday junctions on each end frees the monomer genome from the concatemer (step 3). The nicks left behind after resolution of the Holliday junction can then be ligated, yielding the hairpin DNA ends characteristic of poxviruses (step 4).Open in a separate windowFIGURE 1.Role of poxvirus resolvase during viral replication. Black lines indicate single DNA strands. Half-arrows indicate repeated sequences. Small arrows indicate resolvase cleavage sites. 1) Poxvirus genome replication yields concatemers; 2) inverted repeat sequences at concatemer junctions extrude to form cruciform structures; 3) Holliday junction cleavage by resolvase at cruciform structures yields unit-length genomes with preserved hairpin ends; 4) ligase seals nicks to yield mature genome monomers.The vaccinia virus resolvase gene, A22R, was first recognized in bioinformatic surveys to encode a member of the RNase H superfamily of polynucleotide phosphotransfer enzymes (3). These enzymes catalyze attack of a hydroxyl group on a phosphodiester bond, thereby supporting a variety of nuclease or DNA joining reactions. Garcia et al. (3) purified recombinant vaccinia resolvase and showed that it displayed cleaving activity on model Holliday junctions. They also generated a conditional A22R recombinant vaccinia virus and showed that in the absence of A22R expression, vaccinia failed to replicate and concatemer junctions accumulated, indicating that A22 resolvase indeed is required for concatemer resolution in vivo (4). Subsequent studies by Garcia et al. (5) and Culyba et al. (6) showed that vaccinia resolvase had little sequence specificity, and that cleavage yielded a 3′-hydroxyl group suitable for subsequent DNA ligation. Culyba et al. (7) also showed that several further branched DNA molecules could be cleaved by vaccinia resolvase, establishing that the enzyme could potentially process a variety of branched DNA forms expected to arise during recombination or replication, suggesting possible additional roles for poxvirus resolvase.Progress in studying poxvirus resolvase has been limited by the poor solubility of the purified vaccinia protein. For example, in Garcia et al. (5), the vaccinia resolvase was fused to maltose-binding protein to improve solubility, but consequently the properties of the maltose-binding protein portion of the fusion must be considered in interpreting the results. Pilot studies from our laboratory showed that the insolubility and low activity of the vaccinia virus resolvase precluded its use in high-throughput screens for inhibitors (data not shown).In an effort to identify a more tractable poxvirus resolvase protein, we attempted to clone four other poxvirus resolvase genes and purify the gene products after overexpression in bacteria. We found that the fowlpox resolvase was much more soluble and active than the others tested. Analysis of cleavage revealed that a wide range of branched DNA forms were substrates, paralleling results with vaccinia resolvase and establishing that these activities are a conserved property of poxvirus resolvases. Binding analysis on these same DNA forms also revealed a strict specificity for branched DNA, with the highest affinity binding for the Holliday junction, suggesting that DNA binding specificity is the major discriminatory mechanism for DNA cleavage activity. Kinetic analysis was feasible with fowlpox resolvase, allowing us to show that the first-order rate constant for strand cleavage under single turnover conditions is 90-fold greater for a Holliday junction substrate than for a splayed duplex substrate. However, this rate constant was not limiting for the Holliday junction under multiple turnover conditions, where the rate of strand cleavage is 1.9-fold slower for the Holliday junction than for the splayed duplex. Last, we show that fowlpox resolvase cleavage at Holliday junctions is coupled, so that nicking on one strand also promoted nicking on the strand located across the junction from it. These studies indicate that fowlpox resolvase is well suited to in vitro analysis and suggests approaches to high-throughput screening for resolvase inhibitors.     

Studies of DNA dumbbells. V. A DNA triplex formed between a 28 base-pair DNA dumbbell substrate and a 16 base linear single strand

CD spectra and melting curves were collected for a 28 base-pair DNA fragment in the form of a DNA dumbbell (linked on both ends by T₄ single-strand loops) and the same DNA sequence in the linear form (without end loops). The central 16 base pairs (bp) of the 28-bp duplex region is the poly(pu) sequence: 5′-AGGAAGGAGGAAAGAG-3′. Mixtures of the dumbbell and linear DNAs with the 16-base single-strand sequence 5′-TCCTTCCTCCTTTCTC-3′ were also prepared and studied. At 22°C, CD measurements of the mixtures in 950 mM NaCl, 10 mM sodium acetate, 1 mM EDTA, pH 5.5, at a duplex concentration of 1.8 μM, provided evidence for triplex formation. Spectroscopic features of the triplexes formed with either a dumbbell or linear substrate were quite similar. Melting curves of the duplex molecules alone and in mixtures with the third strand were collected as a function of duplex concentration from 0.16 to 2.15 μM. Melting curves of the dumbbell alone and mixtures with the third strand were entirely independent of DNA concentration. In contrast, melting curves of the linear duplex alone or mixed with the third strand were concentration dependent. At identical duplex concentrations, the dumbbell alone melts ～20°C higher than the linear duplex. The curve of the linear duplex displayed a significant pretransition probably due to end fraying. On melting curves of mixtures of the dumbbell or linear duplex with the third strand, a low temperature transition with much lower relative hyperchromicity change (～ 5%) was observed. This transition was attributed to the melting of a new molecular species, e.g., the triplex formed between the duplex and single-strand DNA molecules. In the case of the dumbbell/single-strand mixture, these melting transitions of the triplex and the dumbbell were entirely resolvable. In contrast, the melting transitions of the linear duplex and the triplex overlapped, thereby preventing their clear distinction. To analyze the data, a three-state equilibrium model is presented. The analysis utilizes differences in relative absorbance vs temperature curves of dumbbells (or linear molecules) alone and in mixtures with the third strand. From the model analysis a straightforward derivation of f_T(T), the fraction of triplex as a function of temperature, was obtained. Analysis of f_T vs temperature curves, in effect melting curves of the triplexes, provided evaluation of thermodynamic parameters of the melting transition. For the triplex formed with the dumbbell substrate, the total transition enthalpy is ΔH_T = 118.4 ± 12.8 kcal/mol (7.4 ± 0.8 kcal/mol per triplet unit) and the total transition entropy is ΔS_T = 344 ± 36.8 cal/K · mol (eu) (21.5 ± 2.3 eu per triple unit). The transition curves of the triplex formed with the linear duplex substrate displayed two distinct regions. A broad pretransition region from f_T = 0 to 0.55 and a higher, sharper transition above f_T = 0.55. The transition parameters derived from the lower temperature region of the curve are ΔH′_T = 44.8 ± 9.6 kcal/mol and ΔS′_T = 112 ± 33.6 eu (or ΔH′ = 2.8 ± 0.6 kcal/mol and ΔS′ = 7.0 ± 2.1 eu per triplet). These values are probably too small to correspond to actual melting of the triplex but instead likely reveal effects of end fraying of the duplex substrate on triplex stability. Transition parameters of the upper transition are ΔH′_T = 128.0 ± 2.3 kcal/mol and ΔS′_T = 379.2 ± 6.4 eu (ΔH′ = 8.0 ± 0.2 kcal/mol and ΔS′ = 23.7 ± 0.4 eu per triplet) in good agreement (within experimental error) with the transition parameters of the triplex formed with the dumbbell substrate. Supposing this upper transition reflects actual dissociation of the third strand from the linear duplex substrate this triplex is comparable in thermodynamic stability to the triplex formed with a dumbbell substrate. Even so, the biphasic melting character of the linear triplex obscures the whole analysis, casting doubt on its absolute reliability. Apparently triplexes formed with a dumbbell substrate offer technical advantages over triplexes formed from linear or hairpin duplex substrates for studies of DNA triplex stability. © 1993 John Wiley & Sons, Inc.     

Molecular cloning of the terminal hairpin of vaccinia virus DNA as an imperfect palindrome in an Escherichia coli plasmid

The genome of vaccinia virus is a linear duplex molecule of approximately 185 kb with hairpins at each end that link the complementary strands. The hairpins, which exist in two forms that are inverted and complementary in sequence, were isolated as XbaI restriction fragments and converted to a linear intermolecular duplex structure by denaturation and reannealing. The latter was then stably cloned as a 142-bp imperfect palindrome in an Escherichia coli plasmid. The insert was excised from the plasmid and the palindrome was extended on both sides by ligating it to the adjacent vaccinia virus DNA segment. The resulting fragment was cloned as a 278-bp imperfect palindrome. Restriction endonuclease analysis and DNA sequencing indicated the absence of any deletions or rearrangements. After excision from the plasmid, the palindrome was converted by heating and rapid cooling to the original two hairpin forms. In this manner, large quantities of vaccinia virus telomeres may be obtained for physical and biochemical studies.     

Rapid purification of plasmid DNA by a single centrifugation in a two-step cesium chloride-ethidium bromide gradient

A procedure for rapid, preparative purification of plasmid DNA is described and compared with a conventional equilibrium centrifugation method. A discontinuous, two-step CsCl-ethidium bromide gradient is used, with the starting position of the plasmid-containing extract being at the bottom of the tube. During centrifugation in a fixed angle rotor, covalently closed circular plasmid DNA is separated from contaminating protein, RNA, and chromosomal DNA in 5 hr. Plasmids purified by this method are considerably less contaminated with RNA than when purified by a 48-hr equilibrium run in a homogeneous gradient, as determined by agarose gel electrophoresis and 5'-end-labeling studies. Plasmid DNA purified in two-step gradients can be used directly for restriction endonuclease analysis and DNA sequencing.     

A deletion derivative of the kalilo senescence plasmid forms hairpin and duplex DNA structures in the mitochondria of Neurospora.

Summary A novel deletion derivative, kal, of the kalilo senescence plasmid from Neurospora intermedia, was recovered from a culture treated with chloramphenicol. The deletion derivative exists in mitochondria as two different, equally abundant forms: a 2.8 kb duplex DNA molecule kal-2.8) and a 1.4 kb hairpin form kal-1.4). The kal-2.8 plasmid contains the 1366 by terminal inverted repeats and a partially duplicated 102 by segment of the unique sequence of the 8.6 kb kalilo plasmid. In contrast, the kal-1.4 hairpin plasmid appears to result from the folding of single strands that are generated during the replication of kal-2.8. Both forms of kal have covalently linked terminal proteins. Sequence analysis suggests that kal was generated either by slippage of the tip of a growing strand during the replication of kalilo, or by illegitimate recombination between two copies of the plasmid at non-homologous palindromic sequences that might form cruciform structures. In either case, the deletion process was mediated at least in part by an inverted repeat of 5 by in the unique region of kalilo. Since the terminal segments of kalilo DNA that are implicated in plasmid integration might also form cruciform structures, it is possible, but improbable, that the process that generated the first kal molecule is related to that which mediates integration of the plasmid into mitochondrial DNA.     

Free ribosomal DNA molecules from Tetrahymena pyriformis GL are giant palindromes

Restriction ondonuclease EcoRI was used to study the structure of the free ribosomal DNA molecules from Tetrahymena pyriformis, strain GL. From the following observations we conclude that the free rDNA molecules from Tetrahymena are giant palindromes³, each containing two genes for preribosomal RNA arranged in rotational symmetry as inverted repeating sequences. Analyses of the sizes of products of partial or complete digestion and quantitative analyses of the products of complete digestion of uniformly ³²P-labeled rDNA yielded an RI endonucleolytic cleavage map which showed that the EcoRI recognition sites are arranged symmetrically about the center of the rDNA molecule.When heat-denatured rDNA was rapidly cooled under conditions in which no renaturation would occur between separated complementary strands of DNA, molecules of half the size of the original rDNA molecule were produced. These were double-stranded DNA molecules as evidenced by their resistance to digestion with S1 nuclease. Moreover, they could be digested with EcoRI to produce fragments of sizes which would be predicted from the assumption that each single strand of the original rDNA molecule had folded back on itself to form a “hair-pin” double-stranded DNA structure. Hybridization experiments between ribosomal RNA and purified rDNA showed that each rDNA molecule contains two genes for rDNA. Hybridization of the isolated EcoRI fragments of rDNA with 25 S or 17 S rRNA suggested that the two structural genes for 17 S rRNA are located near the center of the rDNA molecule and the two genes for 25 S rRNA are found in distal positions.     

The replication origin of <Emphasis Type="Italic">Azotobacter vinelandii</Emphasis>

The putative replication origin of Azotobacter vinelandii was cloned as an autonomously replicating fragment after ligation to an antibiotic resistance cartridge. The resulting plasmids could be isolated and labelled by Southern hybridisation with the antibiotic resistance cartridge as probe and also visualised by electron microscopy. These plasmids integrated into the chromosome after a few generations, even in the recA mutant of A. vinelandii. The integrated copy of the plasmid was re-isolated from the chromosome and the DNA and its subfragments were cloned in the plasmid vector pBR322. A 200-bp DNA fragment was sufficient to allow the replication of pBR322 in an Escherichia coli polA strain. Electron microscopic analysis of this plasmid showed that replication initiated mostly within the A. vinelandii DNA fragment. The nucleotide sequence of the putative replication origin and its flanking regions was determined. In the sequence of the 200-bp fragment many of the distinctive features found in other replication origins are lacking. A greater variation from the consensus DnaA binding sequence was observed in A. vinelandii. Direct sequencing of the relevant genomic fragment was also carried after amplifying it from A. vinelandii chromosomal DNA by PCR. This confirmed that no rearrangements had taken place while the cloned fragment was resident in E. coli. It was shown by hybridisation that the 200-bp chromosomal origin fragment of A. vinelandii was present in three other field strains of Azotobacter spp.