Molecular cloning and nucleotide sequence of a gene encoding a cotton palmitoyl-acyl carrier protein thioesterase.

A cotton genomic clone containing a 17.4-kb DNA segment was found to encompass a palmitoyl-acyl carrier protein (ACP) thioesterase (Fat B1) gene. The gene spans 3.6 kb with six exons and five introns, and is apparently the first plant FatB acyl-ACP thioesterase gene to be completely sequenced. The six exons are identical in nucleotide sequence to the open reading frame of the corresponding cDNA, and would encode a preprotein of 413 amino acids. The preprotein can clearly be identified as a FatB acyl-ACP thioesterase from its similarity to the deduced amino acid sequences of other FatB thioesterase preproteins. A 5'-flanking region of 914 bp was sequenced, with the potential TATA basal promoter 324 bp upstream from the ATG initiation codon. The 5'-flanking sequence also has a putative CAAT box and two presumptive basic region helixloop-helix (bHLH) elements with the consensus motif CANNTG (termed an E box), implicated as being a positive regulatory element in seed-specific gene expression.     

Cloning and characterization of the carp prolactin gene

A carp genomic DNA clone containing the carp prolactin (Prl) gene was isolated with carp Prl cDNA as a probe. The organization of the carp Prl gene was determined by restriction nuclease mapping and nucleotide sequencing. The Prl gene comprises approx. 2.8 kilobasepairs (kb) of DNA including the 5'-flanking region, five exons, four introns and the 3'-flanking region. Analysis of the 5'-flanking region reveals (1) the sequence TATATAAT at positions -38 to -31 upstream from the cap site which was found to be a guanine residue, and (2) the palindrome, CTCATTGCATATACAAATGAG at positions -79 to -59. The carp Prl gene matches with the reported cDNA except for one difference in coding region and five in the 3'-flanking region, while the encoded amino acid sequences are identical. The arrangement of exons and introns is very similar to that seen in carp GH as well as mammalian Prl, which, however, have much longer introns.     

Structure of the human prealbumin gene

Using cloned human prealbumin cDNA as a probe, Southern blot hybridization of human genomic DNA revealed that the prealbumin gene consists of an unique, single-copy DNA. The nucleotide sequences of the entire human prealbumin gene, including both 581 base pairs of the 5'- and 95 base pairs of the 3'-flanking sequences, were determined. The gene spans about 7.0 kilobase pairs and consists of four exons and three introns. As in most eukaryotic genes, the consensus TATA and CAAT sequences are found 30 and 101 nucleotides, respectively, upstream from the putative cap site, and a polyadenylation signal sequence AA-TAAA is found in the 3'-untranslated region. Unexpectedly, two independent open reading frames provided with respective regulatory sequences were found within the gene: one in the first intron and the other in the third intron.     

Complete nucleotide sequence of the gene for human heparin cofactor II and mapping to chromosomal band 22q11.

Heparin cofactor II (HCII) is a 66-kDa plasma glycoprotein that inhibits thrombin rapidly in the presence of dermatan sulfate or heparin. Clones comprising the entire HCII gene were isolated from a human leukocyte genomic library in EMBL-3 lambda phage. The sequence of the gene was determined on both strands of DNA (15,849 bp) and included 1749 bp of 5'-flanking sequence, five exons, four introns, and 476 bp of DNA 3' to the polyadenylation site. Ten complete and one partial Alu repeats were identified in the introns and 5'-flanking region. The HCII gene was regionally mapped on chromosome 22 using rodent-human somatic cell hybrids, carrying only parts of human chromosome 22, and the chronic myelogenous leukemia cell line K562. With the cDNA probe HCII7.2, containing the entire coding region of the gene, the HCII gene was shown to be amplified 10-20-fold in K562 cells by Southern analysis and in situ hybridization. From these data, we concluded that the HCII gene is localized on the chromosomal band 22q11 proximal to the breakpoint cluster region (BCR). Analysis by pulsed-field gel electrophoresis indicated that the amplified HCII gene in K562 cells maps at least 2 Mbp proximal to BCR-1. Furthermore, the HCII7.2 cDNA probe detected two frequent restriction fragment length polymorphisms with the restriction enzymes BamHI and HindIII.