Combinatorial selection of a single stranded DNA thioaptamer targeting TGF-beta1 protein

A phosphorothioate single-stranded DNA aptamer (thioaptamer) targeting transforming growth factor-beta1 (TGF-beta1) was isolated by in-vitro combinatorial selection. The aptamer selection procedure was designed to modify the backbone of single-stranded DNA aptamers, where 5' of both A and C are phosphorothioates, since this provides enhanced nuclease resistance as well as higher affinity than that of a phosphate counterpart. The thioaptamer selected from a combinatorial library (5x10(14) sequences) binds to TGF-beta1 protein with an affinity of 90 nM. In this report, sequence, predicted secondary structure, and binding affinity of the selected thioaptamer (T18_1_3) are presented.     

Specific recognition of a DNA immunogen by its elicited antibody

DNA recognition by antibodies is a key feature of autoimmune diseases, yet model systems with structural information are very limited. The monoclonal antibody ED-10 recognizes one of the strands of the DNA duplex used in the immunogenic complex. Modifications of the 5' end decrease the binding affinity and short oligonucleotides retain high binding affinity. We determined crystal structures for the Fab bound to a 6-mer oligonucleotide containing the specific sequence that raised the antibody and compared it with the unliganded Fab. Only the first two bases from the 5' end (dTdC) display electron density and we observe four key hydrogen bonds at the interface. The thymine ring is stacked between TrpH50 and TrpH95, and the cytosine ring is packed against TyrL32. Upon DNA binding, TyrH97 and TrpH95 rearrange to allow subnanomolar binding affinity, five orders of magnitude higher than other reported complexes, possibly because of having gone through affinity maturation. This structure represents the first bona fide antibody DNA immunogen complex described in atomic detail.     

Combinatorial selection of a RNA thioaptamer that binds to Venezuelan equine encephalitis virus capsid protein

A phosphorothioate RNA aptamer (thioaptamer) targeting the capsid protein of Venezuelan equine encephalitis virus (VEEV) was isolated by in vitro combinatorial selection. The selected thioaptamer had a strong binding affinity (approximately 7nM) and high specificity for the target protein. For the binding to the protein, the overall tertiary structure of the thioaptamer is required. We introduce two theoretical methods to examine the effect of phosphorothioate modification on the enhancement of binding affinity and one experimental method to examine the nature of the multiple bands of thioaptamer in a native gel.     

Multiple components are required for sequence recognition of the AP1 site in the gibbon ape leukemia virus enhancer.

At least two subunits contributed to the formation in vitro of a specific complex binding to the AP1 consensus sequence (TGAGTCA) in the gibbon ape leukemia virus (GALV) enhancer in MLA144 cells. This complex can be dissociated on a monomeric GALV oligonucleotide affinity column. One protein, termed the core protein, was retained on the oligonucleotide affinity column. The second protein flowed through the oligonucleotide affinity column and, when alone, did not bind to DNA; however, when present with the core protein, it bound strongly and very specifically to the GALV sequence. MLA144 cells contained only trace amounts of c-fos and c-jun by immunoblot analysis, suggesting that the proteins specifically binding to the GALV AP1 site were distinct from c-fos and c-jun. In addition to the major complex that recognized the GALV element, MLA144 cells contained a minor complex that is chromatographically different from and antigenically related to c-fos. The factor in the flowthrough complemented a human T-cell nuclear extract (Jurkat cell line), which, when alone, had no assayable complex that specifically bound to the GALV enhancer; this complementation gave rise to a specific complex similar to that seen in MLA144 cells. Together, these results suggest that the GALV enhancer can interact with multicomponent protein complexes in a cell-line-specific manner.     

Sequence requirements for binding of Rep68 to the adeno-associated virus terminal repeats.

We have used reciprocal competition binding experiments with mutant substrates and chemical modification interference assays to precisely define the sequences within the adeno-associated virus (AAV) terminal repeat (TR) that are involved in site-specific binding to the AAV Rep protein. Mutagenesis experiments were done with a 43-bp oligonucleotide which contained the Rep binding element (RBE) within the A stem of the TR. Experiments in which two adjacent base pairs of the RBE were substituted simultaneously with nucleotides that produced transversions identified a 22-bp sequence (CAGTGAGCGAGCGAGCGCGCAG) in which substitutions measurably affected the binding affinity. Although the 22-bp RBE contains the GAGC motifs that have been found in all known Rep binding sites, our results suggest that the GAGC motifs alone are not the only sequences specifically recognized by Rep. The effects of substitutions within the 22-bp sequence were relatively symmetrical, with nucleotides at the periphery of the RBE having the least effect on binding affinity and those in the middle having the greatest effect. Dinucleotide mutations within 18 (GTGAGCGAGCGAGC) of the 22 bp were found to decrease the binding affinity by at least threefold. Dinucleotide mutations within a 10-bp core sequence (GCGAGCGAGC) were found to decrease binding affinity by more than 10-fold. Single-base substitutions within the 10-bp core sequence lowered the binding affinity by variable amounts (up to fivefold). The results of the mutagenesis analysis suggested that the A-stem RBE contains only a single Rep binding site rather than two or more independent sites. To confirm the results of the mutant analysis and to determine the relative contribution of each base to binding, chemical modification experiments using dimethyl sulfate and hydrazine were performed on both the linear A-stem sequence and the entire AAV TR in both the flip and flop hairpinned configurations. Interference assays on the linear A stem identified the 18-bp sequence described above as essential for binding. G, C, and T residues on both strands contributed to binding, and the interference pattern correlated well with the results of the mutagenesis experiments. Interference assays with complete hairpinned TR substrates also identified the 18-bp sequence as important for binding. However, the interference patterns on the two strands within the RBE and the relative contributions of the individual bases to binding were clearly different between the hairpinned substrates and the linear A-stem binding element. Interference assays also allowed us to search for residues within the small internal palindromes of the TR (B and C) that contribute to binding. The largest effect was seen by modification of two T residues within the sequence CTTTG. This sequence was present in the same position relative to the terminal resolution site (trs) in both the flip and flop orientations of the TR. In addition, the interference pattern suggested that the remaining bases within the CTTTG motif as well as other bases within the B and C palindromes make contacts with the Rep protein, albeit with lower affinities. Regardless of whether the TR was in the flip or flop orientation, most of the contact points were clustered in the small internal palindrome furthest away from the trs. We also determined the relative binding affinity of linear substrates containing a complete RBE with hairpinned substrates and found that linear substrates bound Rep less efficiently. Our results were consistent with our previous model that there are three distinct elements within the hairpinned AAV TR that contribute to binding affinity or to efficient nicking at the trs: the A-stem RBE, the secondary structure element which consists of the B and C palindromes, and the trs.     

The chemistry of copper binding to PrP: is there sufficient evidence to elucidate a role for copper in protein function?

There has been an enormous body of literature published in the last 10 years concerning copper and PrP (prion protein). Despite this, there is still no generally accepted role for copper in the function of PrP or any real consensus as to how and to what affinity copper associates with the protein. The present review attempts to look at all the evidence for the chemistry, co-ordination and affinity of copper binding to PrP, and then looks at what effect this has on the protein. We then connect this evidence with possible roles for PrP when bound to copper. No clear conclusions can be made from the available data, but it is clear from the present review what aspects of copper association with PrP need to be re-investigated.     

Binding of herpes simplex virus-1 US11 to specific RNA sequences

Herpes simplex virus-1 US11 is a RNA-binding protein with a novel RNA-binding domain. US11 has been reported to exhibit sequence- and conformation-specific RNA-binding, but the sequences and conformations important for binding are not known. US11 has also been described as a double-stranded RNA (dsRNA)-binding protein. To investigate the US11–RNA interaction, we performed in vitro selection of RNA aptamers that bind US11 from a RNA library consisting of >10¹⁴ 80 base sequences which differ in a 30 base randomized region. US11 bound specifically to selected aptamers with an affinity of 70 nM. Analysis of 23 selected sequences revealed a strong consensus sequence. The US11 RNA-binding domain and ≤46 bases of selected RNA containing the consensus sequence were each sufficient for binding. US11 binding protected the consensus motif from hydroxyl radical cleavage. RNase digestions of a selected aptamer revealed regions of both single-stranded RNA and dsRNA. We observed that US11 bound two different dsRNAs in a sequence non-specific manner, but with lower affinity than it bound selected aptamers. The results define a relatively short specific sequence that binds US11 with high affinity and indicate that dsRNA alone does not confer high-affinity binding.     

TraY DNA recognition of its two F factor binding sites

F factor TraY, a ribbon-helix-helix DNA-binding protein, performs two roles in bacterial conjugation. TraY binds the F origin of transfer (oriT) to promote nicking of plasmid DNA prior to conjugative transfer. TraY also binds the P(Y) promoter to up-regulate tra gene expression. The two plasmid regions bound by TraY share limited sequence identity, yet TraY binds them with similar affinities. TraY recognition of the two sites was first probed using in vitro footprinting methods. Hydroxyl radical footprinting at both oriT and P(Y) sites indicated that bound TraY protected the DNA backbone bordering three adjacent DNA subsites. Analytical ultracentrifugation results for TraY:oligonucleotide complexes were consistent with two of these subsites being bound cooperatively, and the third being occupied at higher TraY concentrations. Methylation protection and interference footprinting identified several guanine bases contacted by or proximal to bound TraY, most located within these subsites. TraY affinity for variant oriT sequences with base substitutions at or near these guanine bases suggested that two of the three subsites correspond to high-affinity, cooperatively bound imperfect inverted GA(G/T)A repeats. Altering the spacing or orientation of these sites reduced binding. TraY mutant R73A failed to protect two symmetry-related oriT guanine bases in these repeats from methylation, identifying possible direct TraY-DNA contacts. The third subsite appears to be oriented as an imperfect direct repeat with its adjacent subsite, although base substitutions at this subsite did not reduce binding. Although unusual for ribbon-helix-helix proteins, this binding site arrangement occurs at both F TraY sites, consistent with it being functionally relevant.     

A consensus DNA-binding site for the androgen receptor.

We have used a DNA-binding site selection assay to determine a consensus binding sequence for the androgen receptor (AR). A purified fusion protein containing the AR DNA-binding domain was incubated with a pool of random sequence oligonucleotides, and complexes were isolated by gel mobility shift assays. Individually selected sites were characterised by nucleotide sequencing and compiled to give a consensus AR-binding element. This sequence is comprised of two 6-basepair (bp) asymmetrical elements separated by a 3-bp spacer, 5'-GGA/TACANNNTGTTCT-3', similar to that described for the glucocorticoid response element. Inspection of the consensus revealed a slight preference for G or A nucleotides at the +1 position in the spacer and for A and T nucleotides in the 3'-flanking region. Therefore, a series of oligonucleotides was designed in which the spacer and flanking nucleotides were changed to the least preferred sequence. Competition experiments with these oligonucleotides and the AR fusion protein indicated that an oligonucleotide with both the spacer and flanking sequences changed had greater than 3-fold less affinity than the consensus sequence. The functional activity of these oligonucleotides was also assessed by placing them up-stream of a reporter gene in a transient transfection assay and correlated with the affinity with which the AR fusion protein bound to DNA. Therefore, sequences surrounding the two 6-bp half-sites influence both the binding affinity for the receptor and the functional activity of the response element.     

Nonspecific prion protein-nucleic Acid interactions lead to different aggregates and cytotoxic species

A misfolded form of the prion protein (PrP) is the primary culprit in mammalian prion diseases. It has been shown that nucleic acids catalyze the misfolding of cellular PrP into a scrapie-like conformer. It has also been observed that the interaction of PrP with nucleic acids is nonspecific and that the complex can be toxic to cultured cells. No direct correlation has yet been drawn between changes in PrP structure and toxicity due to nucleic acid binding. Here we asked whether different aggregation, stability, and toxicity effects are detected when nonrelated DNA sequences interact with recombinant PrP. Using spectroscopic techniques to analyze PrP tertiary and secondary structure and cellular assays to assess toxicity, we found that rPrP-DNA interactions lead to different aggregated species, depending on the sequence and size of the oligonucleotide tested. A 21-mer DNA sequence (D67) induced higher levels of aggregation and also dissimilar structural changes in rPrP, compared to binding to oligonucleotides with the same length and different nucleotide sequences or different GC contents. The rPrP-D67 complex induced significant cell dysfunction, which appears to be correlated with the biophysical properties of the complex. Although sequence specificity is not apparent for PrP-nucleic acid interactions, we believe that particular nucleic acid patterns, possibly related to GC content, oligonucleotide length, and structure, govern PrP recognition. Understanding the structural and cellular effects observed for PrP-nucleic acid complexes may shed light on the still mysterious pathology of the prion protein.     

Triple-helix formation is compatible with an adjacent DNA-protein complex.

The effect of oligonucleotide-directed triple-helix formation on the binding of a protein to an immediately adjacent sequence has been examined. A double-stranded oligonucleotide was designed with a target site for the binding of a pyrimidine oligonucleotide located immediately adjacent to the recognition sequence for the herpes simplex virus type 1 (HSV-1) origin of replication binding protein, which is encoded by the UL9 gene of HSV-1. Since the optimal conditions for the binding of the UL9 protein and the pyrimidine oligonucleotide to the duplex DNA are markedly different, a pyrimidine oligonucleotide was designed to optimize binding affinity and specificity for the target duplex oligonucleotide. Consideration was given to length and sequence composition in an effort to maximize triple-strand formation under conditions amenable to the formation of the UL9-DNA complex. Using gel mobility shift assays, a trimolecular complex composed of duplex DNA bound to both a third oligonucleotide strand and the UL9 protein was detected, indicating that the UL9-DNA complex is compatible with the presence of a triple helix in the immediately adjacent sequences.     

An in vitro-selected RNA-binding site for the KH domain protein PSI acts as a splicing inhibitor element

P element somatic inhibitor (PSI) is a 97-kDa RNA-binding protein with four KH motifs that is involved in the inhibition of splicing of the Drosophila P element third intron (IVS3) in somatic cells. PSI interacts with a negative regulatory element in the IVS3 5' exon. This element contains two pseudo-5' splice sites, termed F1 and F2. To identify high affinity binding sites for the PSI protein, in vitro selection (SELEX) was performed using a random RNA oligonucleotide pool. Alignment of high affinity PSI-binding RNAs revealed a degenerate consensus sequence consisting of a short core motif of CUU flanked by alternative purines and pyrimidines. Interestingly, this sequence resembles the F2 pseudo-5' splice site in the P element negative regulatory element. Additionally, a negative in vitro selection of PCR-mutagenized P element 5' exon regulatory element RNAs identified two U residues in the F1 and F2 pseudo-5' splice sites as important nucleotides for PSI binding and the U residue in the F2 region is a nearly invariant nucleotide in the consensus SELEX motif. The high affinity PSI SELEX sequence acted as a splicing inhibitor when placed in the context of a P element splicing pre-mRNA in vitro. Data from in vitro splicing assays, UV crosslinking and RNA-binding competition experiments indicates a strong correlation between the binding affinities of PSI for the SELEX sequences and their ability to modulate splicing of P element IVS3 in vitro.     

The binding in vitro of the intermediate filament protein vimentin to synthetic oligonucleotides containing telomere sequences

The ability of the intermediate filament subunit protein vimentin to bind synthetic oligonucleotide telomere models containing repeat sequences from Oxytricha (T4G4), Saccharomyces (TGTGTG3), or Tetrahymena (T2G4) was investigated in vitro with a filter binding assay and a gel overlay assay. At low ionic strength, vimentin bound these oligonucleotides with high affinity. At higher ionic strength, the vimentin-oligonucleotide complex was less stable, such that approximately 30% of the initial binding remained at 150 mM KCl. One mole of vimentin tetramer bound approximately 1 mol of telomere oligonucleotide. Vimentin bound well oligonucleotides containing either a random duplex or random 3'-overhang, but showed a reduced affinity for a blunt-ended oligonucleotide. A control random sequence oligonucleotide was not bound by vimentin. The oligonucleotide-binding site of vimentin was shown to be localized in the non-alpha-helical N-terminal domain by assays employing purified proteolytic fragments of vimentin. Preliminary results in the gel overlay assay show that other members of the intermediate filament family, nuclear lamins A-C, all bind the synthetic oligonucleotide containing the telomere repeat sequence of Oxytricha.