Automated classification of RNA 3D motifs and the RNA 3D Motif Atlas

The analysis of atomic-resolution RNA three-dimensional (3D) structures reveals that many internal and hairpin loops are modular, recurrent, and structured by conserved non-Watson–Crick base pairs. Structurally similar loops define RNA 3D motifs that are conserved in homologous RNA molecules, but can also occur at nonhomologous sites in diverse RNAs, and which often vary in sequence. To further our understanding of RNA motif structure and sequence variability and to provide a useful resource for structure modeling and prediction, we present a new method for automated classification of internal and hairpin loop RNA 3D motifs and a new online database called the RNA 3D Motif Atlas. To classify the motif instances, a representative set of internal and hairpin loops is automatically extracted from a nonredundant list of RNA-containing PDB files. Their structures are compared geometrically, all-against-all, using the FR3D program suite. The loops are clustered into motif groups, taking into account geometric similarity and structural annotations and making allowance for a variable number of bulged bases. The automated procedure that we have implemented identifies all hairpin and internal loop motifs previously described in the literature. All motif instances and motif groups are assigned unique and stable identifiers and are made available in the RNA 3D Motif Atlas (http://rna.bgsu.edu/motifs), which is automatically updated every four weeks. The RNA 3D Motif Atlas provides an interactive user interface for exploring motif diversity and tools for programmatic data access.     

Nucleotide sequence of small chromatin-associated RNA (fr3 RNA)

A small RNA found in the fraction on non-histone chromosomal proteins or rat liver and chicken reticulocytes [Holoubek, V., Deacon, N.J., Buckle, D.W. and Naora, H. (1983) Eur. J. Biochem. 137, 249-256] has been isolated from rat liver and then sequenced. The RNA is 30 nucleotides long and has the following composition: 5'AGUGGGGGACUGCGUUCGCGCUCUCCCCUG3'. This sequence is identical with the sequence of the last 30 nucleotides at the 3' end of small nuclear U1 RNA.     

RNA 3D Modules in Genome-Wide Predictions of RNA 2D Structure

Recent experimental and computational progress has revealed a large potential for RNA structure in the genome. This has been driven by computational strategies that exploit multiple genomes of related organisms to identify common sequences and secondary structures. However, these computational approaches have two main challenges: they are computationally expensive and they have a relatively high false discovery rate (FDR). Simultaneously, RNA 3D structure analysis has revealed modules composed of non-canonical base pairs which occur in non-homologous positions, apparently by independent evolution. These modules can, for example, occur inside structural elements which in RNA 2D predictions appear as internal loops. Hence one question is if the use of such RNA 3D information can improve the prediction accuracy of RNA secondary structure at a genome-wide level. Here, we use RNAz in combination with 3D module prediction tools and apply them on a 13-way vertebrate sequence-based alignment. We find that RNA 3D modules predicted by metaRNAmodules and JAR3D are significantly enriched in the screened windows compared to their shuffled counterparts. The initially estimated FDR of 47.0% is lowered to below 25% when certain 3D module predictions are present in the window of the 2D prediction. We discuss the implications and prospects for further development of computational strategies for detection of RNA 2D structure in genomic sequence.     

Identification and nuclear localization of yeast pre-messenger RNA processing components: RNA2 and RNA3 proteins

Temperature-sensitive mutations in the RNA2 through RNA11 genes of yeast prevent the processing of nuclear pre-mRNAs. We have raised antisera that detect the RNA2 and RNA3 proteins in immunoblots of extracts of yeast containing high copy number RNA2 and RNA3 plasmids. Subcellular fractionation of yeast cells that overproduce the RNA2 and RNA3 proteins has revealed that these proteins are enriched in nuclear fractions. Indirect immunofluorescence results have indicated that these proteins are localized in yeast nuclei. These localization results are consistent with the fact that these genes have a role in processing yeast pre-mRNA.     

RNAapt3D: RNA aptamer 3D-structural modeling database

RNA aptamers are oligonucleotides with high binding affinity and specificity for target molecules and are expected to be a new generation of therapeutic molecules and targeted delivery materials. The tertiary structure of RNA molecules and RNA-protein interaction sites are increasingly important as potential targets for new drugs. The pathological mechanisms of diseases must be understood in detail to guide drug design. In developing RNA aptamers as drugs, information about the interaction mechanisms and structures of RNA aptamer-target protein complexes are useful. We constructed a database, RNA aptamer 3D-structural modeling (RNAapt3D), consisting of RNA aptamer data that are potential drug candidates. The database includes RNA sequences and computationally predicted RNA tertiary structures based on secondary structures and implements methods that can be used to predict unknown structures of RNA aptamer-target molecule complexes. RNAapt3D should enable the design of RNA aptamers for target molecules and improve the efficiency and productivity of candidate drug selection. RNAapt3D can be accessed at https://rnaapt3d.medals.jp.     

Sexually dimorphic RNA helicases DDX3X and DDX3Y differentially regulate RNA metabolism through phase separation

1. Download : Download high-res image (160KB)
2. Download : Download full-size image

     

Characterization of a novel 5' subgenomic RNA3a derived from RNA3 of Brome mosaic bromovirus

The synthesis of 3' subgenomic RNA4 (sgRNA4) by initiation from an internal sg promoter in the RNA3 segment was first described for Brome mosaic bromovirus (BMV), a model tripartite positive-sense RNA virus (W. A. Miller, T. W. Dreher, and T. C. Hall, Nature 313:68-70, 1985). In this work, we describe a novel 5' sgRNA of BMV (sgRNA3a) that we propose arises by premature internal termination and that encapsidates in BMV virions. Cloning and sequencing revealed that, unlike any other BMV RNA segment, sgRNA3a carries a 3' oligo(A) tail, in which respect it resembles cellular mRNAs. Indeed, both the accumulation of sgRNA3a in polysomes and the synthesis of movement protein 3a in in vitro systems suggest active functions of sgRNA3a during protein synthesis. Moreover, when copied in the BMV replicase in vitro reaction, the minus-strand RNA3 template generated the sgRNA3a product, likely by premature termination at the minus-strand oligo(U) tract. Deletion of the oligo(A) tract in BMV RNA3 inhibited synthesis of sgRNA3a during infection. We propose a model in which the synthesis of RNA3 is terminated prematurely near the sg promoter. The discovery of 5' sgRNA3a sheds new light on strategies viruses can use to separate replication from the translation functions of their genomic RNAs.     

Microglia recognize double-stranded RNA via TLR3

Microglia are CNS resident innate immune cells of myeloid origin that become activated and produce innate proinflammatory molecules upon encountering bacteria or viruses. TLRs are a phylogenetically conserved diverse family of sensors for pathogen-associated molecular patterns that drive innate immune responses. We have recently shown that mice deficient in TLR3 (TLR3(-/-) mice) are resistant to lethal encephalitis and have reduced microglial activation after infection with West Nile virus, a retrovirus that produces dsRNA. We wished to determine whether microglia recognize dsRNA through the TLR3 pathway. In vitro, murine wild-type primary cultured microglia responded to synthetic dsRNA polyinosinic-polycytidylic acid (poly(I:C)) by increasing TLR3 and IFN-beta mRNA and by morphologic activation. Furthermore, wild-type microglia dose dependently secreted TNF-alpha and IL-6 after poly(I:C) challenge, whereas TLR3(-/-) microglia produced diminished cytokines. Activation of MAPK occurred in a time-dependent fashion following poly(I:C) treatment of wild-type microglia, but happened with delayed kinetics in TLR3(-/-) microglia. As an in vivo model of encephalitis, wild-type or TLR3(-/-) mice were injected intracerebroventricularly with poly(I:C) or LPS, and microglial activation was assessed by cell surface marker or phospho-MAPK immunofluorescence. After intracerebroventricular injection of poly(I:C), microgliosis was clearly evident in wild-type mice but was nearly absent in TLR3(-/-) animals. When taken together, our results demonstrate that microglia recognize dsRNA through TLR3 and associated signaling molecules and suggest that these cells are key sensors of dsRNA-producing viruses that may invade the CNS.     

Widespread RNA 3'-end oligouridylation in mammals

Nontemplated 3'-end oligouridylation of RNA occurs in many species, including humans. Unlike the familiar phenomenon of polyadenylation, nontemplated addition of uridines to RNA is poorly characterized in higher eukaryotes. Recent studies have reported nontemplated 3'-end oligouridylation of small RNAs and mRNAs. Oligouridylation is involved in many aspects of microRNA biology from biogenesis to turnover of the mature species, and it may also mark long mRNAs for degradation by promoting decapping of the protective 5'-cap structure. To determine the prevalence of oligouridylation in higher eukaryotes, we used next-generation sequencing technology to deeply examine the population of small RNAs in human cells. Our data revealed widespread nontemplated nucleotide addition to the 3' ends of many classes of RNA, with short stretches of uridine being the most frequently added nucleotide.     

SmD3 Regulates Intronic Noncoding RNA Biogenesis

Accumulation of excess lipid in nonadipose tissues is associated with oxidative stress and organ dysfunction and plays an important role in diabetic complications. To elucidate molecular events critical for lipotoxicity, we used retroviral promoter trap mutagenesis to generate mutant Chinese hamster ovary cell lines resistant to lipotoxic and oxidative stress. A previous report of a mutant from this screen demonstrated that under lipotoxic conditions, small nucleolar RNAs (snoRNAs) in the rpL13a gene accumulate in the cytosol and serve as critical mediators of lipotoxic cell death. We now report a novel, independent mutant in which a single provirus disrupted one allele of the gene encoding the spliceosomal protein SmD3, creating a model of haploinsufficiency. We show that snoRNA expression and the abundance of snoRNA-containing intron lariats are decreased in SmD3 mutant cells, even though haploinsufficiency of SmD3 supports pre-mRNA splicing. The mechanism through which SmD3 regulates the expression of intronic snoRNAs likely involves effects of SmD3 on the levels of small nuclear RNAs (snRNAs) U4 and U5. Our data implicate SmD3 as a critical determinant in the processing of intronic noncoding RNAs in general and as an upstream mediator of metabolic stress response pathways through the regulation of snoRNA expression.     

3' nontranslated RNA signals required for replication of hepatitis C virus RNA

We describe a mutational analysis of the 3' nontranslated RNA (3'NTR) signals required for replication of subgenomic hepatitis C virus (HCV) RNAs. A series of deletion mutants was constructed within the background of an HCV-N replicon that induces the expression of secreted alkaline phosphatase in order to examine the requirements for each of the three domains comprising the 3'NTR, namely, the highly conserved 3' terminal 98-nucleotide (nt) segment (3'X), an upstream poly(U)-poly(UC) [poly(U/UC)] tract, and the variable region (VR) located at the 5' end of the 3'NTR. Each of these domains was found to contribute to efficient replication of the viral RNA in transiently transfected hepatoma cells. Replication was not detected when any of the three putative stem-loop structures within the 3'X region were deleted. Similarly, complete deletion of the poly(U/UC) tract abolished replication. Replacement of a minimum of 50 to 62 nt of poly(U/UC) sequence was required for detectable RNA replication when the native sequence was restored in a stepwise fashion from its 3' end. Lengthier poly(U/UC) sequences, and possibly pure homopolymeric poly(U) tracts, were associated with more efficient RNA amplification. Finally, while multiple deletion mutations were tolerated within VR, each led to a partial loss of replication capacity. The impaired replication capacity of the deletion mutants could not be explained by reduced translational activity or by decreased stability of the RNA, suggesting that each of these mutations may impair recognition of the RNA by the viral replicase during an early step in negative-strand RNA synthesis. The results indicate that the 3'-most 150 nt of the HCV-N genome [the 3'X region and the 3' 52 nt of the poly(U/UC) tract] contain RNA signals that are essential for replication, while the remainder of the 3'NTR plays a facilitating role in replication but is not absolutely required.     

DDX3 DEAD-box RNA helicase is required for hepatitis C virus RNA replication

DDX3, a DEAD-box RNA helicase, binds to the hepatitis C virus (HCV) core protein. However, the role(s) of DDX3 in HCV replication is still not understood. Here we demonstrate that the accumulation of both genome-length HCV RNA (HCV-O, genotype 1b) and its replicon RNA were significantly suppressed in HuH-7-derived cells expressing short hairpin RNA targeted to DDX3 by lentivirus vector transduction. As well, RNA replication of JFH1 (genotype 2a) and release of the core into the culture supernatants were suppressed in DDX3 knockdown cells after inoculation of the cell culture-generated HCVcc. Thus, DDX3 is required for HCV RNA replication.