Sse8387I, a useful eight base cutter for mammalian genome analysis (influence of methylation on the activity of Sse8387I).

To develop restriction enzymes that are useful for genome analysis, we previously performed screening and isolated Sse8387I from Streptomyces sp. strain 8387. Sse8387I is a restriction enzyme that recognizes 5'-CCTGCA/GG-3' and cleaves DNA at the site shown by the diagonal (Nucleic Acid Res., 18, 5637-5640). The present study evaluated the effects of methylation that is important when Sse8387I is used for genome analysis. Sse8387I lost cleavage activity after methylation of adenine or methylation of cytosine at any site in the recognition sequence. However, the recognition sequence of Sse8387I contains no CG sequence, which is the mammalian methylation sequence. In addition, we evaluated the effects of methylation of CG at sites other than the recognition sequence. The cleavage activity of Sse8387I was maintained even when CG sequences were present immediately before or after, or near the recognition sequence, and cytosine was methylated. These results suggest that CG methylation does not affect the cleavage activity of Sse8387I. Therefore, Sse8387I seems to be very useful for mammalian genome analysis.     

Construction of physical and genetic maps of Chlamydia trachomatis serovar L2 by pulsed-field gel electrophoresis.

We constructed the physical map of Chlamydia trachomatis serovar L2 by using three restriction endonucleases, NotI (GC[GGCCGC), SgrAI (C(A/G)[CCGG(T/G)G), and Sse8387I (CCTGCA[GG), and we analyzed the fragments by pulsed-field gel electrophoresis. A total of 25 restriction endonuclease sites and 13 genes and/or operons were located on the map. The genome size was determined to be 1,045 kb. Neither highly transcribed chlamydia genes nor developmental cycle-specific genes were clustered on the genome.     

The Sse9I restriction-modification system: organization of genes and comparative analysis of proteins structures

A nucleotide sequence was established for the full-length Sporosarcina species 9D operon coding for enzymes of type II restriction-modification system Sse9I. These enzymes recognize the tetranucleotide DNA sequence 5'-AATT-3'. The operon was shown to consist of three genes that are situated with the order: sse9IC-sse9IR-sse9IM and are transcribed in the same direction. These genes encode the control protein (C.Sse9I), restriction endonuclease (R.Sse9I) and DNA-methyltransferase (M.Sse9I), respectively. A specific DNA sequence (C-box) presumably recognized by C-protein was found immediately upstream of sse9IC gene. The comparative analysis of amino acid sequences of C.Sse9I and R.Sse9I with those of relative proteins has been done. It was found that R.Sse9I revealed the most homology with the segments of R.MunI (5'-CAATTG-3') and R.EcoRI (5'-GAATTC-3'), where amino acid residues, responsible for recogniton of AATT core sequence are located. The sse9IR gene was cloned into the temperature-inducible expression vector, and recombinant Sse9I restriction endonuclease preparation was isolated.     

Evaluation of randomly amplified polymorphic DNA and pulsed field gel electrophoresis techniques for molecular typing of Dermatophilus congolensis

This study aimed to evaluate molecular typing methods useful for standardization of strains in experimental work on dermatophilosis. Fifty Dermatophilus congolensis isolates, collected from sheep, cattle, horse and a deer, were analyzed by randomly amplified polymorphic DNA (RAPD) method using twenty-one different primers, and the results were compared with those obtained by typing with a pulsed field gel electrophoresis (PFGE) method using the restriction digest enzyme Sse8387I. The typeability, reproducibility and discriminatory power of RAPD and Sse8387I-PFGE typing were calculated. Both typing methods were highly reproducible. Of the two techniques, Sse8387I-PFGE was the least discriminating (Dice Index (DI), 0.663) and could not distinguish between epidemiologically related isolates, whereas RAPD showed an excellent discriminatory power (DI, 0.7694-0.9722). Overall, the degree of correlation between RAPD and PFGE typing was significantly high (r, 0.8822). We conclude that the DNA profiles generated by either RAPD or PFGE can be used to differentiate epidemiologically unrelated isolates. The results of this study strongly suggest that at least two independent primers are used for RAPD typing in order to improve its discriminatory power, and that PFGE is used for confirmation of RAPD results.     

FseI, a new type II restriction endonuclease that recognizes the octanucleotide sequence 5'' GGCCGGCC 3''.

A Type II restriction endonuclease, designated FseI, has been partially purified from a Frankia species (NRRL 18528). This enzyme cleaves Adenovirus 2 DNA at three sites, but does not cleave the DNAs from bacteriophages lambda, T7, and phi X174, the animal virus SV40, pUC18 and pBR322. FseI recognizes the octanucleotide sequence 5' GGCCGG decreases CC 3' and cleaves as indicated by the arrow. The frequency of occurrence of FseI sites within sequenced regions of the human genome is similar to that for NotI sites.     

Reactions of type II restriction endonucleases with 8-base pair recognition sites

Type II restriction endonucleases usually recognize 4-6-base pair (bp) sites on DNA and cleave each site in a separate reaction. A few type II endonucleases have 8-bp recognition sites, but these seem unsuited for restriction, since their sites are rare on most DNA. Moreover, only one endonuclease that recognizes a target containing 8 bp has been examined to date, and this enzyme, SfiI, needs two copies of this site for its DNA cleavage reaction. In this study, several endonucleases with 8-bp sites were tested on plasmids that have either one or two copies of the relevant sequence to determine if they also need two sites. SgfI, SrfI, FseI, PacI, PmeI, Sse8781I, and SdaI all acted through equal and independent reactions at each site. AscI cleaved the DNA with one site at the same rate as that with two sites but acted processively on the latter. In contrast, SgrAI showed a marked preference for the plasmid with two sites and cleaved both sites on this DNA in a concerted manner, like SfiI. Endonucleases that require two copies of an 8-bp sequence may be widespread in nature, where, despite this seemingly inappropriate requirement, they may function in DNA restriction.     

SwaI, a unique restriction endonuclease from Staphylococcus warneri, which recognizes 5'-ATTTAAAT-3'.

A novel class-II restriction endonuclease designated SwaI was purified from Staphylococcus warneri. This enzyme cleaves adenovirus 2 DNA, SV40 DNA and M13mp7 at one site each, but does not cleave lambda, PhiX174, pBR322 or pBR328 DNA. SwaI recognizes the octanucleotide sequence 5'-ATTTAAAT-3', cleaving in the center of the recognition sequence creating blunt ended DNA fragments. SwaI was used to digest chromosomal DNA from various microorganisms and human cells.     

Physical map of the Listeria monocytogenes chromosome.

The circular physical map of the pathogenic bacterium Listeria monocytogenes LO28 (serovar 1/2c) was established by using pulsed-field gel electrophoresis. The L. monocytogenes chromosome contains eight NotI fragments of 1,100, 940, 400, 335, 280, 45, 30, and 20 kb in size and eight Sse8387I fragments of 860, 680, 680, 370, 335, 130, 70, and 25 kb. Therefore, the total length of the genome is 3,150 kb. To order the NotI fragments on the chromosome, we used a strategy which can be of general use. We first cloned chromosomal HindIII or EcoRI fragments in pBR322. DNA extracted from the total libraries was digested by NotI and ligated to a NotI-kanamycin resistance cassette obtained by cutting Tn5 with NotI. After transformation in Escherichia coli, kanamycin-resistant clones originating from NotI-containing EcoRI or HindIII fragments were isolated. The two EcoRI-NotI or HindIII-NotI fragments of each recombinant plasmid were isolated and used as probes on Southern blot hybridizations to identify and link the corresponding NotI fragments. Seven NotI fragments were ordered in this way. The last junction was demonstrated by partial digest analysis. All L. monocytogenes genes identified so far as well as the six rRNA operons were localized on the NotI map. Regions homologous to genes from closely related bacteria were also detected and localized. Southern blot analysis of simple Sse8387I digests or double Sse8387I-NotI digests probed with the various NotI probes allowed us to align the Sse8387I fragments and localize the single SfiI site, resulting in the establishment of the first genetic and physical map of the L. monocytogenes chromosome.     

A general method for inserting specific DNA sequences into cloning vehicles

A general method has been developed to introduce any double-stranded DNA molecule into cloning vehicles at different restriction endonuclease sites. In this method a chemically synthesized decadeoxyribonucleotide duplex, containing a specific restriction endonuclease sequence, is joinlex DNA is cut by the same restriction endonuclease to generate the cohesive ends. It is then inserted into the restriction endonuclease cleavage site of the cloning vehicle. To demonstrate the feasibility of this new method, we have inserted separately the synthetic lac operator DNA at the Bam I and HindIII cleavage sites of the plasmid pMB9 DNA.     

SruI restriction endonuclease from Selenomonas ruminantium

Abstract Sru I, specific restriction endonuclease, has been characterized from Selenomonas ruminantium isolated from the rumen of fallow deer. Results from the study demonstrate that S. ruminantium 18D possesses a type II restriction endonuclease, which recognizes the sequence 5'-TTT↓AAA-3'. The recognition sequence of Sru I was identified using digestions on pBR322, pBR328, pUC18, M13mp18RF, pACYC184 and λDNA. The cleavage patterns obtained were compared with computer-derived data. Sru I recognises the palindromic hexanucleotide sequence and cleaves DNA after the third T in the sequence, producing blunt ends. The purification and characterization of restriction endonuclease Sru I presented here is the first described for Selenomonas ruminantium spp. and demonstrates that this microorganism pocesses a DNA-cleaving enzyme with the same specificity as Dra I or Aha III.     

Construction of an equalized cDNA library from Arabidopsis thaliana

Using a kinetic approach, a cDNA library composed of almost equal representations of all genes expressed in the aerial parts of 2-week-old Arabidopsis was constructed. A cDNA was synthesized with an oligo dT primer containing a Not l site. A linker containing the nucleotide sequence of Sse 8387I which recognizes octanucleotides was added at the ends of the synthesized cDNA. The cDNA was amplified by the polymerase chain reaction (PCR), denatured, and reassociated under modified conditions. Thereafter, the remaining single-stranded DNA was converted to double-stranded DNA and amplified by PCR. These equalization steps were repeated three times and the products were cloned unidirectionally into a plasmid vector. Equalization was evaluated by colony hybridization and DNA sequencing. This approach will be applicable to construct a cDNA library suitable for subtraction, differential screening, and expression screening, especially for mRNA species present at very low concentrations in a few cells of a specific tissue.     

Iterative database searches demonstrate that glycoside hydrolase families 27, 31, 36 and 66 share a common evolutionary origin with family 13

A catalytic sequence motif PDX10-30(E/D)XK is found in many restriction enzymes. On the basis of sequence similarities and mapping of the conserved residues to the crystal structure of NgoMIV we suggest that residues D160, K182, R186, R188 and E195 contribute to the catalytic/DNA binding site of the Ecl18kI restriction endonuclease. Mutational analysis confirms the functional significance of the conserved residues of Ecl18kI. Therefore, we conclude that the active site motif 159VDX21KX12E of Ecl18kI differs from the canonical PDX10-30(E/D)XK motif characteristic for most of the restriction enzymes. Moreover, we propose that two subfamilies of endonucleases Ecl18kI/PspGI/EcoRII and Cfr10I/Bse634I/NgoMIV, specific, respectively, for CCNGG/CCWGG and RCCGGY/GCCGGC sites, share conserved active site architecture and DNA binding elements.     

DNA translocation blockage, a general mechanism of cleavage site selection by type I restriction enzymes

Type I restriction enzymes bind to a specific DNA sequence and subsequently translocate DNA past the complex to reach a non-specific cleavage site. We have examined several potential blocks to DNA translocation, such as positive supercoiling or a Holliday junction, for their ability to trigger DNA cleavage by type I restriction enzymes. Introduction of positive supercoiling into plasmid DNA did not have a significant effect on the rate of DNA cleavage by EcoAI endonuclease nor on the enzyme's ability to select cleavage sites randomly throughout the DNA molecule. Thus, positive supercoiling does not prevent DNA translocation. EcoR124II endonuclease cleaved DNA at Holliday junctions present on both linear and negatively supercoiled substrates. The latter substrate was cleaved by a single enzyme molecule at two sites, one on either side of the junction, consistent with a bi-directional translocation model. Linear DNA molecules with two recognition sites for endonucleases from different type I families were cut between the sites when both enzymes were added simultaneously but not when a single enzyme was added. We propose that type I restriction enzymes can track along a DNA substrate irrespective of its topology and cleave DNA at any barrier that is able to halt the translocation process.     

FspAI, a unique type II restriction endonuclease that recognizes the octanucleotide sequence 5′-RTGC↓GCAY-3′

A new type II restriction endonuclease designated FspAI has been partially purified from a Flexibacter species Tv-m21K. FspAI recognizes the octanucleotide sequence 5′-RTGC↓GCAY-3′ and cleaves it in the center generating blunt-ended DNA fragments.     

Very efficient template/primer-independent DNA synthesis by thermophilic DNA polymerase in the presence of a thermophilic restriction endonuclease

We have found that, in the presence of a thermophilic restriction endonuclease, thermophilic DNA polymerase efficiently synthesizes and amplifies DNA in the absence of any added template and primer nucleic acid under isothermal conditions. More than 10 microg of DNA can be synthesized by 1 unit of DNA polymerase in 1 h, and the reaction proceeds until available dNTPs are consumed. We used mostly the Tsp509I restriction endonuclease (recognition sequence: decreasing AATT), the TspRI restriction endonuclease (recognition sequence: NNCA(G/C)TGNN decreasing), and Vent (exo(-)) and Vent DNA polymerase. The synthesized double-stranded DNA has a highly repetitive palindromic sequence, e.g. (AAAAATTTTT)(n) and (ATACACTGTATATACAGTGTAT)(n). In every repeating unit, there are one or two recognition sites for the restriction enzyme. Our data show that the high efficiency of the restriction-endonuclease-DNA-polymerase (RE-pol) DNA synthesis results from an efficient exponential amplification involving digestion-elongation cycles: a longer DNA with numerous recognition sites for the restriction enzyme is digested to short fragments, and the short fragments are used as seeds for elongation to synthesize longer DNA. A possible role of RE-pol DNA synthesis in the evolutionary development of genetic materials is briefly discussed.     

Netropsin, distamycin A, bis-netropsins as selective inhibitors of restrictases and DNAse I

The simultaneous analysis of DNAase I "footprinting" data and restriction endonucleases inhibition data was performed on the same DNA end-labelled fragment. The inhibition induced by netropsin, a number of bis-netropsins and distamycin A was investigated. These experiments led us to the following conclusions. The restriction endonucleases inhibition by the ligands is caused by the ligand molecules binding in the close vicinity to the restriction endonuclease recognition sequence. The zone of +/- 4 bp from the center of the restriction endonuclease recognition sequence can be defined as the zone of the influence of the bounded ligand on the restriction endonuclease. But in this case the intersection of recognition sequence and the binding site occupied by a single ligand molecule is not sufficient for the inhibition to occur. Restriction endonuclease cutting sites protected by netropsin can be predicted basing upon known nucleotide sequence specificity of netropsin. Netropsin and bis-netropsins show different nucleotide sequence specificity. This fact can be used for selective inhibition of restriction endonucleases.     

Catalytic domain of restriction endonuclease BmrI as a cleavage module for engineering endonucleases with novel substrate specificities

Creating endonucleases with novel sequence specificities provides more possibilities to manipulate DNA. We have created a chimeric endonuclease (CH-endonuclease) consisting of the DNA cleavage domain of BmrI restriction endonuclease and C.BclI, a controller protein of the BclI restriction-modification system. The purified chimeric endonuclease, BmrI198-C.BclI, cleaves DNA at specific sites in the vicinity of the recognition sequence of C.BclI. Double-strand (ds) breaks were observed at two sites: 8 bp upstream and 18 bp within the C-box sequence. Using DNA substrates with deletions of C-box sequence, we show that the chimeric endonuclease requires the 5′ half of the C box only for specific cleavage. A schematic model is proposed for the mode of protein–DNA binding and DNA cleavage. The present study demonstrates that the BmrI cleavage domain can be used to create combinatorial endonucleases that cleave DNA at specific sequences dictated by the DNA-binding partner. The resulting endonucleases will be useful in vitro and in vivo to create ds breaks at specific sites and generate deletions.     

A new site-specific endonuclease, ScaI, from Streptomyces caespitosus.

A new site-specific endonuclease has been isolated from Streptomyces caespitosus and named ScaI. Based on analysis of sequences around the restriction sites in pBR322 and pBR325, the recognition sequence of ScaI endonuclease was deduced to be a new hexanucleotide 5'-AGTACT-3'. The cleavage site was determined by comparing the ScaI-cleaved product of a primer-extended M13mp18-SCA DNA, which contains an AGTACT sequence, with dideoxy chain terminator ladders of the same DNA. ScaI was found to cleave the recognition sequence between the internal T and A, leaving flush ends to the cleaved fragments.     

Determination of the substrate specificity of Bpu101 restrictase with an unusual recognition segment

A new enzyme Bpu10I was isolated from Bacillus pumilus. This enzyme is not an isoschizomer of any known restriction endonucleases. The search of possible recognition sequences was carried out in sequences ABCNiDEF (i = 0.6) on substrate DNA lambda CI857, T7, pBR322. The recognition sequence and cleavage sites of restriction endonuclease Bpu10I have been determined as CCTNAGC. GGANTCG     

New rare cutting restriction endonuclease SmII from Streptococcus milleri recognises 5'-ATTTAAAT-3'

New restriction endonuclease (restrictase) Smil of type II was detected in the bacterial strain Streptococcus milleri. Cellular lysate enzyme cut T7 and adenovirus-2 DNAs at site 5'-ATTT decreases AAAT-3' but not lambda DNA which does not contain this sequence. Intense aeration inhibited the growth of S. milleri. The content of restrictase in the cells was the greatest during the logarithmic growth phase. A total of 20,000 units of Smil were isolated from 4 g of cells by cellular extract fractionation with ammonium sulfate and subsequent chromatography on columns with Bio Gel A 0.5 m, heparin agarose, and phosphocellulose. Purified enzyme cut the synthetic oligonucleotide duplex in the center of the recognized site 5'-ATTT decreases AAAT-3'. Smil restrictase is a true isoschisomer of rare-cutting Swal enzyme. Smil belongs to a small group of enzymes which recognize octanucleotide sites and can be used for large-block fragmentation of DNA. Comparison of specificities of rare-cutting and other restrictases suggests that the enzymes recognizing octanucleotides can evolutionally originate from enzymes recognizing both hexanucleotides and tetranucleotides.