共查询到20条相似文献,搜索用时 109 毫秒
1.
Dahrouge S Hogg WE Russell G Tuna M Geneau R Muldoon LK Kristjansson E Fletcher J 《CMAJ》2012,184(2):E135-E143
Background:
Several jurisdictions attempting to reform primary care have focused on changes in physician remuneration. The goals of this study were to compare the delivery of preventive services by practices in four primary care funding models and to identify organizational factors associated with superior preventive care.Methods:
In a cross-sectional study, we included 137 primary care practices in the province of Ontario (35 fee-for-service practices, 35 with salaried physicians [community health centres], 35 practices in the new capitation model [family health networks] and 32 practices in the established capitation model [health services organizations]). We surveyed 288 family physicians. We reviewed 4108 randomly selected patient charts and assigned prevention scores based on the proportion of eligible preventive manoeuvres delivered for each patient.Results:
A total of 3284 patients were eligible for at least one of six preventive manoeuvres. After adjusting for patient profile and contextual factors, we found that, compared with prevention scores in practices in the new capitation model, scores were significantly lower in fee-for-service practices (β estimate for effect on prevention score = −6.3, 95% confidence interval [CI] −11.9 to −0.6) and practices in the established capitation model (β = −9.1, 95% CI −14.9 to −3.3) but not for those with salaried remuneration (β = −0.8, 95% CI −6.5 to 4.8). After accounting for physician characteristics and organizational structure, the type of funding model was no longer a statistically significant factor. Compared with reference practices, those with at least one female family physician (β = 8.0, 95% CI 4.2 to 11.8), a panel size of fewer than 1600 patients per full-time equivalent family physician (β = 6.8, 95% CI 3.1 to 10.6) and an electronic reminder system (β = 4.6, 95% CI 0.4 to 8.7) had superior prevention scores. The effect of these three factors was largely but not always consistent across the funding models; it was largely consistent across the preventive manoeuvres.Interpretation:
No funding model was clearly associated with superior preventive care. Factors related to physician characteristics and practice structure were stronger predictors of performance. Practices with one or more female physicians, a smaller patient load and an electronic reminder system had superior prevention scores. Our findings raise questions about reform initiatives aimed at increasing patient numbers, but they support the adoption of information technology.Primary care providers are increasingly interested in ensuring that preventive health care be part of their work routines.1 This reorientation fits with the evidence that recommendations from family practitioners increase substantially the likelihood of patients undergoing preventive manoeuvres,2 whereas the lack of such recommendations has been linked with patient noncompliance.3,4Studies evaluating adherence to recommended preventive care suggest that the most pervasive barriers rest with the organization of the health care system and the practice itself, such as the absence of external financial incentives for the work done and the lack of a reminder system in the office.3,5–9Countries attempting to reform their delivery of primary care and improve the delivery of preventive services have often directed their efforts in finding alternatives to the traditional fee-for-service model, in which providers receive payment for each service provided. There are two predominant alternative funding models: capitation (providers receive a fixed lump-sum payment per patient per period, independent of the number of services performed) and salaried remuneration. Some health care systems blend components of fee for service with either of these models or offer additional incentives for reaching defined quality-of-care targets. Despite considerable rhetoric, there is little evidence to point to the remuneration models associated with superior delivery of primary care services.10 The complexity of health care systems makes the evaluation of models through international comparisons difficult.In Canada, the province of Ontario has four primary care funding models (11Table 1:
Characteristics of the four primary care models in the province of Ontario in 2005/06Fee for service | Capitation | ||||
---|---|---|---|---|---|
Characteristic | Salaried (community health centres)* | Traditional* | Reformed† | New (family health networks) | Established (health services organizations) |
Year introduced | 1970s | – | 2004 | 2001 | 1970s |
Group size, no. of physicians | > 1 (no specific size requirement) | 1 | ≥ 3 | ≥ 3 | ≥ 3 |
Physician remuneration | Salary | Fee for service | Fee for service and incentives | Capitation with 10% fee- for-service component, and incentives | Capitation and incentives |
Patient enrolment | Required; no limit on size of roster | Not required | Required; no limit on size of roster | Required; disincentive to enrol > 2400 | Required; disincentive to enrol > 2400 |
Incentive for enhanced preventive care‡ | |||||
Influenza immunization (age ≥ 65 yr) | None | None | None | April 2002 | July 2003 |
Colorectal cancer screening (age 50–74 yr) | None | None | April 2006 | April 2006 | April 2006 |
Breast cancer screening (age 50–70 yr) | None | None | None | April 2002 | April 2003 |
Cervical cancer screening (age 35–70 yr) | None | None | None | April 2002 | April 2003 |
2.
Background:
Canada has a growing multinational immigrant population. Many commonly used cognitive assessment tools have known cultural biases and are difficult to use in ethnically diverse patient populations. The Rowland Universal Dementia Assessment Scale (RUDAS) is a cognitive assessment tool that was created for culturally and linguistically diverse populations. We performed a systematic review and meta-analysis to assess the psychometric characteristics of the RUDAS and to compare it with other available tools.Methods:
We identified studies that assessed the psychometric properties of the RUDAS compared with a reference standard for diagnosing dementia or compared the RUDAS to other cognitive assessment tools. Two independent reviewers screened the abstracts and full-text articles and reviewed bibliographies for further references. We extracted data using standardized forms and assessed studies for risk of bias.Results:
Our search resulted in 148 articles, from which 11 were included. The RUDAS was assessed in 1236 participants and was found to have a pooled sensitivity of 77.2% (95% confidence interval [CI] 67.4–84.5) and a pooled specificity of 85.9% (95% CI 74.8–92.6) yielding a positive likelihood ratio of 5.5 (95% CI 2.9–10.7) and a negative likelihood ratio of 0.27 (95% CI 0.17–0.40). A pooled estimate of the correlation between the RUDAS and the Mini-Mental State Examination (MMSE) was 0.77 (95% CI 0.72–0.81). Results of the RUDAS were less affected by language and education level than the MMSE.Interpretation:
The RUDAS is a brief and freely available cognitive assessment tool with reasonable psychometric characteristics that may be particularly useful in patients with diverse backgrounds.The prevalence of dementia is rising in Canada and around the world. More than 35 million people have dementia globally, and this number is expected to triple by 2050.1 Currently, 58% of the burden of dementia worldwide is in low- and middle-income countries, with an expected increase to more than 70% by 2050.1 Canada is a diverse country with a large immigrant population, and in 2012, more than 11 000 immigrants coming to Canada were older than 65 years.2 The top 4 countries from which Canadian immigrants originate (China, the Philippines, India and Pakistan) are low- and middle-income countries.3 With the aging immigrant population in Canada and the increasing prevalence of dementia worldwide, the number of Canadian immigrants with dementia is expected to rise substantially in the coming decades. Consequently, we need to ensure that adequate cognitive assessment tools are available to maximize chances of early diagnosis and management of dementia, as this can improve clinical outcomes and quality of life, and save health care costs.4,5Several formal brief tools for cognitive assessment are commonly used in Canada. These include the Mini-Mental State Examination (MMSE), which was developed in 1975,6 and the Montreal Cognitive Assessment (MoCA), developed in 2003.7 Both tools are widely used, and the MMSE is one of the most commonly used cognitive instruments worldwide.8 Despite their widespread use, these tools have known difficulties in patients with a low level of education and in those who do not speak English as a first language.8,9 A further limitation to using the MMSE is its current copyright status, which requires the test to be purchased for each administration.The Rowland Universal Dementia Assessment Scale (RUDAS) was developed in 2004 in Australia and was designed specifically to address the challenges of detecting cognitive impairment in culturally and linguistically diverse populations.10 The RUDAS is a 6-item questionnaire that assesses multiple cognitive domains and can be administered in less than 10 minutes (10 This initial cross-sectional validation study included 90 participants (45 with dementia and 45 without) from the community. The mean age was 79.5 years, and less than half of the participants had more than 6 years of education. Both the interrater (intraclass correlation coefficient [ICC] 0.99) and test–retest (ICC 0.98) reliabilities of the RUDAS were very high. Compared with the criteria of the Diagnostic and Statistical Manual of Mental Disorders, 4th edition (DSM-IV), the RUDAS was found to have a sensitivity of 89% (95% confidence interval [CI] 76–96) and specificity of 98% (95% CI 88–97). Performance on the RUDAS was not affected by years of education (p = 0.20) or preferred language (p = 0.33).10Table 1:
The Rowland Universal Dementia Assessment ScaleCognitive domain | Question* | Points |
---|---|---|
Registration | Given 4 grocery items to register (and recall later) | 0 |
Visuospatial orientation | Left/right orientation with body parts | 5 |
Praxis | Alternating hand movements with fist and palm | 2 |
Visuoconstructional drawing | Copying image of a cube | 3 |
Judgment | Safety precautions when crossing a street | 4 |
Memory recall | Recalling 4 grocery items from above | 8 |
Language | Animal naming in 1 minute | 8 |
Total score | /30 |
3.
Patti J. Miller Claudio L. Afonso Erica Spackman Melissa A. Scott Janice C. Pedersen Dennis A. Senne Justin D. Brown Chad M. Fuller Marcela M. Uhart William B. Karesh Ian H. Brown Dennis J. Alexander David E. Swayne 《Journal of virology》2010,84(21):11496-11504
The biological, serological, and genomic characterization of a paramyxovirus recently isolated from rockhopper penguins (Eudyptes chrysocome) suggested that this virus represented a new avian paramyxovirus (APMV) group, APMV10. This penguin virus resembled other APMVs by electron microscopy; however, its viral hemagglutination (HA) activity was not inhibited by antisera against any of the nine defined APMV serotypes. In addition, antiserum generated against this penguin virus did not inhibit the HA of representative viruses of the other APMV serotypes. Sequence data produced using random priming methods revealed a genomic structure typical of APMV. Phylogenetic evaluation of coding regions revealed that amino acid sequences of all six proteins were most closely related to APMV2 and APMV8. The calculation of evolutionary distances among proteins and distances at the nucleotide level confirmed that APMV2, APMV8, and the penguin virus all were sufficiently divergent from each other to be considered different serotypes. We propose that this isolate, named APMV10/penguin/Falkland Islands/324/2007, be the prototype virus for APMV10. Because of the known problems associated with serology, such as antiserum cross-reactivity and one-way immunogenicity, in addition to the reliance on the immune response to a single protein, the hemagglutinin-neuraminidase, as the sole base for viral classification, we suggest the need for new classification guidelines that incorporate genome sequence comparisons.Viruses from the Paramyxoviridae family have caused disease in humans and animals for centuries. Over the last 40 years, many paramyxoviruses isolated from animals and people have been newly described (16, 17, 22, 29, 31, 32, 36, 42, 44, 46, 49, 58, 59, 62-64). Viruses from this family are pleomorphic, enveloped, single-stranded, nonsegmented, negative-sense RNA viruses that demonstrate serological cross-reactivity with other paramyxoviruses related to them (30, 46). The subfamily Paramyxovirinae is divided into five genera: Respirovirus, Morbillivirus, Rubulavirus, Henipavirus, and Avulavirus (30). The Avulavirus genus contains nine distinct avian paramyxovirus (APMV) serotypes (Table (Table1),1), and information on the discovery of each has been reported elsewhere (4, 6, 7, 9, 12, 34, 41, 50, 51, 60, 68).
Open in a separate windowaRequires the addition of an exogenous protease.bProtease requirement depends on the isolate examined.cPutative.Six of these serotypes were classified in the latter half of the 1970s, when the most reliable assay available to classify paramyxoviruses was the hemagglutination inhibition (HI) assay (61). However, there are multiple problems associated with the use of serology, including the inability to classify some APMVs by comparing them to the sera of the nine defined APMVs alone (2, 8). In addition, one-way antigenicity and cross-reactivity between different serotypes have been documented for many years (4, 5, 14, 25, 29, 33, 34, 41, 51, 52, 60). The ability of APMVs, like other viruses, to show antigenic drift as it evolves over time (37, 43, 54) and the wide use and availability of precise molecular methods, such as PCR and genome sequencing, demonstrate the need for a more practical classification system.The genetic diversity of APMVs is still largely unexplored, as hundreds of avian species have never been surveyed for the presence of viruses that do not cause significant signs of disease or are not economically important. The emergence of H5N1 highly pathogenic avian influenza (HPAI) virus as the cause of the largest outbreak of a virulent virus in poultry in the past 100 years has spurred the development of surveillance programs to better understand the ecology of avian influenza (AI) viruses in aquatic birds around the globe, and in some instances it has provided opportunities for observing other viruses in wild bird populations (15, 53). In 2007, as part of a seabird health surveillance program in the Falkland Islands (Islas Malvinas), oral and cloacal swabs and serum were collected from rockhopper penguins (Eudyptes chrysocome) and environmental/fecal swab pools were collected from other seabirds.While AI virus has not yet been isolated from penguins in the sub-Antarctic and Antarctic areas, there have been two reports of serum antibodies positive to H7 and H10 from the Adélie species (11, 40). Rare isolations of APMV1, both virulent (45) and of low virulence (8), have been reported from Antarctic penguins. Sera positive for APMV1 and AMPV2 have also been reported (21, 24, 38, 40, 53). Since 1981, paramyxoviruses have been isolated from king penguins (Aptenodytes patagonicus), royal penguins (Eudyptes schlegeli), and Adélie penguins (Pygoscelis adeliae) from Antarctica and little blue penguins (Eudyptula minor) from Australia that cannot be identified as belonging to APMV1 to -9 and have not yet been classified (8, 11, 38-40). The morphology, biological and genomic characteristics, and antigenic relatedness of an APMV recently isolated from multiple penguin colonies on the Falkland Islands are reported here. Evidence that the virus belongs to a new serotype (APMV10) and a demonstration of the advantages of a whole genome system of analysis based on random sequencing followed by comparison of genetic distances are presented. Only after all APMVs are reported and classified will epidemiological information be known as to how the viruses are moving and spreading as the birds travel and interact with other avian species. 相似文献
TABLE 1.
Characteristics of prototype viruses APMV1 to APMV9 and the penguin virusStrain | Host | Disease | Distribution | Fusion cleavagec | GI accession no. |
---|---|---|---|---|---|
APMV1/Newcastle disease virus | >250 species | High mortality | Worldwide | GRRQKRF | 45511218 |
Inapparent | Worldwide | GGRQGRLa | 11545722 | ||
APMV2/Chicken/CA/Yucaipa/1956 | Turkey, chickens, psittacines, rails, passerines | Decrease in egg production and respiratory disease | Worldwide | DKPASRF | 169144527 |
APMV3/Turkey/WI/1968 | Turkey | Mild respiratory disease and moderate egg decrease | Worldwide | PRPSGRLa | 209484147 |
APMV3/Parakeet/Netherlands/449/1975 | Psittacines, passerines, flamingos | Neurological, enteric, and respiratory disease | Worldwide | ARPRGRLa | 171472314 |
APMV4/Duck/Hong Kong/D3/1975 | Duck, geese, chickens | None known | Worldwide | VDIQPRF | 210076708 |
APMV5/Budgerigar/Japan/Kunitachi/1974 | Budgerigars, lorikeets | High mortality, enteric disease | Japan, United Kingdom, Australia | GKRKKRFa | 290563909 |
APMV6/Duck/Hong Kong/199/1977 | Ducks, geese, turkeys | Mild respiratory disease and increased mortality in turkeys | Worldwide | PAPEPRLb | 15081567 |
APMV7/Dove/TN/4/1975 | Pigeons, doves, turkeys | Mild respiratory disease in turkeys | United States, England, Japan | TLPSSRF | 224979458 |
APMV8/Goose/DE/1053/1976 | Ducks, geese | None known | United States, Japan | TYPQTRLa | 226343050 |
APMV9/Duck/NY/22/1978 | Ducks | None known | Worldwide | RIREGRIa | 217068693 |
APMV10/Penguin/Falkland Islands/324/2007 | Rockhopper penguins | None Known | Falkland Islands | DKPSQRIa | 300432141 |
4.
5.
Relatively little is known about the small subset of peroxisomal proteins with predicted protease activity. Here, we report that the peroxisomal LON2 (At5g47040) protease facilitates matrix protein import into Arabidopsis (Arabidopsis thaliana) peroxisomes. We identified T-DNA insertion alleles disrupted in five of the nine confirmed or predicted peroxisomal proteases and found only two—lon2 and deg15, a mutant defective in the previously described PTS2-processing protease (DEG15/At1g28320)—with phenotypes suggestive of peroxisome metabolism defects. Both lon2 and deg15 mutants were mildly resistant to the inhibitory effects of indole-3-butyric acid (IBA) on root elongation, but only lon2 mutants were resistant to the stimulatory effects of IBA on lateral root production or displayed Suc dependence during seedling growth. lon2 mutants displayed defects in removing the type 2 peroxisome targeting signal (PTS2) from peroxisomal malate dehydrogenase and reduced accumulation of 3-ketoacyl-CoA thiolase, another PTS2-containing protein; both defects were not apparent upon germination but appeared in 5- to 8-d-old seedlings. In lon2 cotyledon cells, matrix proteins were localized to peroxisomes in 4-d-old seedlings but mislocalized to the cytosol in 8-d-old seedlings. Moreover, a PTS2-GFP reporter sorted to peroxisomes in lon2 root tip cells but was largely cytosolic in more mature root cells. Our results indicate that LON2 is needed for sustained matrix protein import into peroxisomes. The delayed onset of matrix protein sorting defects may account for the relatively weak Suc dependence following germination, moderate IBA-resistant primary root elongation, and severe defects in IBA-induced lateral root formation observed in lon2 mutants.Peroxisomes are single-membrane-bound organelles found in most eukaryotes. Peroxin (PEX) proteins are necessary for various aspects of peroxisome biogenesis, including matrix protein import (for review, see Distel et al., 1996; Schrader and Fahimi, 2008). Most matrix proteins are imported into peroxisomes from the cytosol using one of two targeting signals, a C-terminal type 1 peroxisome-targeting signal (PTS1) or a cleavable N-terminal type 2 peroxisome-targeting signal (PTS2) (Reumann, 2004). PTS1- and PTS2-containing proteins are bound in the cytosol by soluble matrix protein receptors, escorted to the peroxisome membrane docking complex, and translocated into the peroxisome matrix (for review, see Platta and Erdmann, 2007). Once in the peroxisome, many matrix proteins participate in metabolic pathways, such as β-oxidation, hydrogen peroxide decomposition, and photorespiration (for review, see Gabaldon et al., 2006; Poirier et al., 2006).In addition to metabolic enzymes, several proteases are found in the peroxisome matrix. Only one protease, DEG15/Tysnd1, has a well-defined role in peroxisome biology. The rat Tysnd1 protease removes the targeting signal after PTS2-containing proteins enter the peroxisome and also processes certain PTS1-containing β-oxidation enzymes (Kurochkin et al., 2007). Similarly, the Arabidopsis (Arabidopsis thaliana) Tysnd1 homolog DEG15 (At1g28320) is a peroxisomal Ser protease that removes PTS2 targeting signals (Helm et al., 2007; Schuhmann et al., 2008).In contrast with DEG15, little is known about the other eight Arabidopsis proteins that are annotated as proteases in the AraPerox database of putative peroxisomal proteins (Reumann et al., 2004; Carter et al., 2004; Shimaoka et al., 2004), which, in combination with the minor PTS found in both of these predicted proteases (Reumann, 2004), suggests that these enzymes may not be peroxisomal. Along with DEG15, only two of the predicted peroxisomal proteases, an M16 metalloprotease (At2g41790), which we have named PXM16 for peroxisomal M16 protease, and a Lon-related protease (At5g47040/LON2; Ostersetzer et al., 2007), are found in the proteome of peroxisomes purified from Arabidopsis suspension cells (Eubel et al., 2008). DEG15 and LON2 also have been validated as peroxisomally targeted using GFP fusions (Ostersetzer et al., 2007; Schuhmann et al., 2008).
Open in a separate windowaMajor PTS1 (Reumann, 2004).bMinor PTS1 (Reumann, 2004).cValidated PTS1 (Reumann et al., 2007).dMinor PTS2 (Reumann, 2004).PXM16 is the only one of the nine Arabidopsis M16 (pitrilysin family) metalloproteases (García-Lorenzo et al., 2006; Rawlings et al., 2008) containing a predicted PTS. M16 subfamilies B and C contain the plastid and mitochondrial processing peptidases (for review, see Schaller, 2004), whereas PXM16 belongs to M16 subfamily A, which includes insulin-degrading peptidases (Schaller, 2004). A tomato (Solanum lycopersicum) M16 subfamily A protease similar to insulin-degrading enzymes with a putative PTS1 was identified in a screen for proteases that cleave the wound response peptide hormone systemin (Strassner et al., 2002), but the role of Arabidopsis PXM16 is unknown.Arabidopsis LON2 is a typical Lon protease with three conserved domains: an N-terminal domain, a central ATPase domain in the AAA family, and a C-terminal protease domain with a Ser-Lys catalytic dyad (Fig. 1A; Lee and Suzuki, 2008). Lon proteases are found in prokaryotes and in some eukaryotic organelles (Fig. 1C) and participate in protein quality control by cleaving unfolded proteins and can regulate metabolism by controlling levels of enzymes from many pathways, including cell cycle, metabolism, and stress responses (for review, see Tsilibaris et al., 2006). Four Lon homologs are encoded in the Arabidopsis genome; isoforms have been identified in mitochondria, plastids, and peroxisomes (Ostersetzer et al., 2007; Eubel et al., 2008; Rawlings et al., 2008). Mitochondrial Lon protesases are found in a variety of eukaryotes (Fig. 1A) and function both as ATP-dependent proteases and as chaperones promoting protein complex assemblies (Lee and Suzuki, 2008). LON2 is the only Arabidopsis Lon isoform with a canonical C-terminal PTS1 (SKL-COOH; Ostersetzer et al., 2007) or found in the peroxisome proteome (Eubel et al., 2008; Reumann et al., 2009). Functional studies have been conducted with peroxisomal Lon isoforms found in the proteome of peroxisomes purified from rat hepatic cells (pLon; Kikuchi et al., 2004) and the methylotrophic yeast Hansenula polymorpha (Pln; Aksam et al., 2007). Rat pLon interacts with β-oxidation enzymes, and a cell line expressing a dominant negative pLon variant has decreased β-oxidation activity, displays defects in the activation processing of PTS1-containing acyl-CoA oxidase, and missorts catalase to the cytosol (Omi et al., 2008). H. polymorpha Pln is necessary for degradation of a misfolded, peroxisome-targeted version of dihydrofolate reductase and for degradation of in vitro-synthesized alcohol oxidase in peroxisomal matrix extracts, but does not contribute to degradation of peroxisomally targeted GFP (Aksam et al., 2007).Open in a separate windowFigure 1.Diagram of LON2 protein domains, gene models for LON2, PXM16, DEG15, PED1, PEX5, and PEX6, and phylogenetic relationships of LON family members. A, Organization of the 888-amino acid LON2 protein. Locations of the N-terminal domain conserved among Lon proteins, predicted ATP-binding Walker A and B domains (black circles), active site Ser (S) and Lys (K) residues (asterisks), and the C-terminal Ser-Lys-Leu (SKL) peroxisomal targeting signal (PTS1) are shown (Lee and Suzuki, 2008). B, Gene models for LON2, PXM16, DEG15, PED1, PEX5, and PEX6 and locations of T-DNA insertions (triangles) or missense alleles (arrows) used in this study. Exons are depicted by black boxes, introns by black lines, and untranslated regions by gray lines. C, Phylogenetic relationships among LON homologs. Sequences were aligned using MegAlign (DNAStar) and the ClustalW method. The PAUP 4.0b10 program (Swofford, 2001) was used to generate an unrooted phylogram from a trimmed alignment corresponding to Arabidopsis LON2 residues 400 to 888 (from the beginning of the ATPase domain to the end of the protein). The bootstrap method was performed for 500 replicates with distance as the optimality criterion. Bootstrap values are indicated at the nodes. Predicted peroxisomal proteins have C-terminal PTS1 signals in parentheses and are in light-gray ovals. Proteins in the darker gray oval have N-terminal extensions and include mitochondrial and chloroplastic proteins. Sequence identifiers are listed in Supplemental Table S2.In this work, we examined the roles of several putative peroxisomal proteases in Arabidopsis. We found that lon2 mutants displayed peroxisome-deficient phenotypes, including resistance to the protoauxin indole-3-butyric acid (IBA) and age-dependent defects in peroxisomal import of PTS1- and PTS2-targeted matrix proteins. Our results indicate that LON2 contributes to matrix protein import into Arabidopsis peroxisomes. 相似文献
Table I.
Putative Arabidopsis proteases predicted or demonstrated to be peroxisomalAGI Identifier | Alias | Protein Class | T-DNA Insertion Alleles | PTS | Localization Evidence | Localization References |
---|---|---|---|---|---|---|
At1g28320 | DEG15 | PTS2-processing protease | SALK_007184 (deg15-1) | SKL>a | GFP | Reumann et al., 2004; Helm et al., 2007; Eubel et al., 2008; Schuhmann et al., 2008) |
Proteomics | ||||||
Bioinformatics | ||||||
At2g41790 | PXM16 | Peptidase M16 family protein | SALK_019128 (pxm16-1) | PKL>b | Proteomics | Reumann et al., 2004, 2009; Eubel et al., 2008) |
SALK_023917 (pxm16-2) | Bioinformatics | |||||
At5g47040 | LON2 | Lon protease homolog | SALK_128438 (lon2-1) | SKL>a | GFP | Reumann et al., 2004, 2009; Ostersetzer et al., 2007; Eubel et al., 2008) |
SALK_043857 (lon2-2) | Proteomics | |||||
Bioinformatics | ||||||
At2g18080 | Ser-type peptidase | SALK_020628 | SSI>c | Bioinformatics | (Reumann et al., 2004) | |
SALK_102239 | ||||||
At2g35615 | Aspartyl protease | SALK_090795 | ANL>b | Bioinformatics | (Reumann et al., 2004) | |
SALK_036333 | ||||||
At3g57810 | Ovarian tumor-like Cys protease | SKL>a | Bioinformatics | (Reumann et al., 2004) | ||
At4g14570 | Acylaminoacyl-peptidase protein | CKL>b | Bioinformatics (peroxisome) | (Reumann et al., 2004; Shimaoka et al., 2004) | ||
Proteomics (vacuole) | ||||||
At4g20310 | Peptidase M50 family protein | RMx5HLd | Bioinformatics | (Reumann et al., 2004) | ||
At4g36195 | Ser carboxypeptidase S28 family | SSM>b | Bioinformatics (peroxisome) | (Carter et al., 2004; Reumann et al., 2004) | ||
Proteomics (vacuole) |
6.
7.
Todd J. Ward Thomas Usgaard Peter Evans 《Applied and environmental microbiology》2010,76(19):6680-6684
A 30-probe assay was developed for simultaneous classification of Listeria monocytogenes isolates by lineage (I to IV), major serogroup (4b, 1/2b, 1/2a, and 1/2c), and epidemic clone (EC) type (ECI, ECIa, ECII, and ECIII). The assay was designed to facilitate rapid strain characterization and the integration of subtype data into risk-based inspection programs.Listeria monocytogenes is a facultative intracellular pathogen that can cause serious invasive illness (listeriosis) in humans and other animals. L. monocytogenes is responsible for over 25% of food-borne-disease-related deaths attributable to known pathogens and is a leading cause of food recalls due to microbial adulteration (12, 21). However, not all L. monocytogenes subtypes contribute equally to human illness, and substantial differences in the ecologies and virulence attributes of different L. monocytogenes subtypes have been identified (9, 13, 14, 23, 24, 33, 35, 36). Among the four major evolutionary lineages of L. monocytogenes, only lineages I and II are commonly isolated from contaminated food and human listeriosis patients (19, 27, 29, 33). Lineage I strains are overrepresented among human listeriosis isolates, particularly those associated with epidemic outbreaks, whereas lineage II strains are overrepresented in foods and the environment (13, 14, 24). Lineage III strains account for approximately 1% of human listeriosis cases but are common among animal listeriosis isolates and appear to be a host-adapted group that is poorly adapted to food-processing environments (6, 34-36). The ecological and virulence attributes of lineage IV are poorly understood, as this lineage is rare and was only recently described based on a small number of strains (19, 26, 29, 33).L. monocytogenes is differentiated into 13 serotypes; however, four major serogroups (4b, 1/2b, 1/2a, and 1/2c) from within lineages I and II account for more than 98% of human and food isolates (16, 31). Serogroups refer to evolutionary complexes typified by a predominant serotype but which include very rare serotypes that represent minor evolutionary variants (7, 9, 33). Phylogenetic analyses have indicated that rare serotypes may have evolved recently, or even multiple times, from one of the major serotypes (9), and numerous molecular methods fail to discriminate minor serotypes as independent groups (1, 4, 7, 9, 18, 22, 33, 38, 39). Serotyping is one of the most common methods for L. monocytogenes subtyping, and serogroup classifications are a useful component of strain characterization because ecotype divisions appear largely congruent with serogroup distinctions (16, 34). Serogroup 4b strains are of particular public health concern because contamination with these strains appears to increase the probability that a ready-to-eat (RTE) food will be implicated in listeriosis (16, 28). Serogroup 4b strains account for approximately 40% of sporadic listeriosis and also are responsible for the majority of listeriosis outbreaks despite being relatively rare contaminants of food products (9, 13, 17, 30, 34). In addition, serogroup 4b strains are associated with more severe clinical presentations and higher mortality rates than other serogroups (11, 16, 20, 31, 34). Serogroups 1/2a and 1/2b are overrepresented among food isolates but also contribute significantly to human listeriosis, whereas serogroup 1/2c rarely causes human illness and may pose a lower risk of listeriosis for humans (16). Serogroup-specific differences in association with human listeriosis are consistent with the prevalence of virulence-attenuating mutations in inlA within these serogroups (32, 34); however, a number of additional factors likely contribute to these differences.Four previously described epidemic clones (ECs; ECI, ECIa, ECII, and ECIII) of L. monocytogenes have been implicated in numerous listeriosis outbreaks and have contributed significantly to sporadic illness (15, 34). ECI, ECIa, and ECII are distinct groups within serogroup 4b that were each responsible for repeated outbreaks of listeriosis in the United States and Europe. ECIII is a lineage II clone of serotype 1/2a that persisted in the same processing facility for more than a decade prior to causing a multistate outbreak linked to contaminated turkey (15, 25). While there has been speculation that epidemic clones possess unique adaptations that explain their frequent involvement in listeriosis outbreaks (9, 34, 37), it is not clear that epidemic clones are more virulent than other strains with the same serotype. However, contamination of RTE food with EC strains would be cause for increased concern due to the previous involvement of these clones in major outbreaks of listeriosis (16).As a result of the L. monocytogenes subtype-specific differences in ecology, virulence, and association with human illness, molecular subtyping technologies have the potential to inform assessments of relative risk and to improve risk-based inspection programs. The objective of the present study was to develop a single assay for rapid and accurate classification of L. monocytogenes isolates by lineage, major serogroup, and epidemic clone in order to facilitate strain characterization and the integration of subtype data into inspection programs that are based on assessment of relative risk.A database of more than 5.3 Mb of comparative DNA sequences from 238 L. monocytogenes isolates (9, 33-35) was scanned for single nucleotide polymorphisms that could be used to differentiate lineages, major serogroups, and epidemic clones via a targeted multilocus genotyping (TMLGT) approach. The acronym TMLGT is used to distinguish this approach from previously published multilocus genotyping (MLGT) assays that were lineage specific and designed for haplotype discrimination (9, 33). To provide for simultaneous interrogation of the selected polymorphisms via TMLGT, six genomic regions (Table (Table1)1) were coamplified in a multiplex PCR. While the previous MLGT assays were based on three lineage-specific multiplexes and required prior identification of lineage identity, TMLGT was designed to target variation across all of the lineages simultaneously and is based on a unique set of amplicons. PCR was performed in 50-μl volumes with 1× High Fidelity PCR buffer (Invitrogen Life Technologies), 2 mM MgSO4, 100 μM deoxynucleoside triphosphate (dNTP), 300 nM primer, 1.5 U Platinum Taq high-fidelity DNA polymerase (Invitrogen Life Technologies), and 100 ng of genomic DNA. PCR consisted of an initial denaturation of 90 s at 96°C, followed by 40 cycles of 30 s at 94°C, 30 s at 50°C, and 90 s at 68°C. Amplification products were purified using Montage PCR cleanup filter plates (Millipore) and served as a template for allele-specific primer extension (ASPE) reactions utilizing subtype-specific probes.
Open in a separate windowaCorresponding nucleotide positions in the complete genome sequence of L. monocytogenes strain EGD-e (GenBank accession number ).bSee IUPAC codes for definition of degenerate bases.ASPE was performed in multiplex reactions including 30 probes, with each lineage (I to IV), major serogroup (4b, 1/2b, 1/2a, and 1/2c), and epidemic clone (ECI, ECIa, ECII, and ECIII) targeted by two different probes (Table NC_003210(Table2).2). In addition, positive-control probes were included to confirm the presence of each amplicon in the multiplex PCR. As serogroups and epidemic clones are nested within a particular lineage, probes for these groups were designed to be specific within the appropriate lineage and values for these probes were evaluated only for isolates of the appropriate lineage. For example, serogroup 1/2a probes were evaluated only for isolates that were positive for lineage II probes. ASPE probes were designed with a unique 5′ sequence tag specific to individual sets of xMAP fluorescent polystyrene microspheres (Luminex Corporation) used to sort extension products. Extension and hybridization reactions were performed as described previously (9) except microspheres were twice pelleted by centrifugation (4 min at 2,250 × g) and resuspended in 75 μl 1× TM buffer prior to being pelleted and resuspended in 100 μl 1× TM buffer containing 2 μg/ml streptavidin-R-phycoerythrin (Invitrogen Life Technologies). Samples were incubated for 15 min at 37°C prior to detecting the microsphere complexes with a Luminex 100 flow cytometer (Luminex Corporation). The median fluorescence intensity (MFI) from biotinylated extension products attached to 100 microspheres was measured for each probe. The average MFI from three template-free control samples was also determined and subtracted from the raw MFI of each sample to account for background fluorescence. Probe performance was initially evaluated via the index of discrimination (ID) as described by Ducey et al. (9), and probes with ID values less than 2.0 were redesigned.
Open in a separate windowaNA, not applicable for positive amplicon control probes.bLuminex microsphere sets (Luminex Corporation) used for hybridization reactions are indicated following the hyphen.cn, number of isolates representing the target subtype among the 906 tested isolates.dThe 5′ sequence tag portions of extension probes are capitalized. See IUPAC codes for definitions of degenerate bases.eID, index of discrimination.Validation of the TMLGT assay was performed using 906 L. monocytogenes isolates for which the lineage, major serogroup, and epidemic clone type had been determined independently (see Table S1 in the supplemental material). A subset of 92 isolates, including at least five isolates from each lineage, serogroup, and epidemic clone type, was used to evaluate the discriminatory power of subtype-specific probes and the repeatability of the assay (see Table S1). Two independent runs of the 30-probe TMLGT assay produced identical results for these 92 isolates. In addition, genotypes matched expectations for all isolate/probe combinations, and the fluorescence intensities for positive genotypes (those targeted by a particular probe) were 3.8 to 58.3 (mean, 18.5) times as high as background values for isolates with negative genotypes (those not targeted by a particular probe) (Table (Table2).2). The performances of individual probes also were assessed in terms of sensitivity and specificity, where sensitivity is defined as the percentage of positive samples that produced positive results and specificity indicates the percentage of negative samples that produce negative results (5). Based on results from all 906 isolates analyzed by TMLGT, probe sensitivity was at least 98.6% and 23 of the 24 subtype-specific probes exhibited 100% sensitivity (Table (Table2).2). The specificities for all probes were also greater than 98.6%, and 21 of the 24 subtype-specific probes exhibited 100% specificity (Table (Table22).All but three of the 906 isolates in the validation panel were fully and accurately typed relative to lineage, serogroup, and epidemic clone by using the TMLGT assay (typeability, 99.9%; accuracy of isolate assignment, 99.8%). One of the lineage II isolates, NRRL B-33880, could not be assigned to a serogroup based on the TMLGT results because this isolate was positive for one of the serogroup 1/2a probes (VGCb-40) and one of the serogroup 1/2c probes (LMO-9). This isolate was previously identified as a member of serogroup 1/2c based on mapping lineage-specific MLGT data onto a multilocus phylogeny (34) but produced a serogroup 1/2a-specific banding pattern (data not shown) with the multiplex PCR assay described by Doumith et al. (7). Similar strains, including the common laboratory strain EGD-e, were found to have genomes that are more similar to serogroup 1/2c strains than to strains from the 1/2a serogroup (8, 33) and likely represent intermediates in the evolution of the 1/2c clade from 1/2a ancestors. There is a poor correlation between genomic and antigenic variation for such isolates (34), consistent with the ambiguous results produced by application of the TMLGT assay to NRRL B-33880. The two other problematic isolates, NRRL B-33555 and NRRL B-33559, were accurately identified based on TMLGT data as lineage II isolates from the 1/2a serogroup. However, these two isolates were positive for both ECIII-specific probes in the TMLGT assay but have lineage-specific MLGT haplotypes (Lm2.46), indicating that they are representatives of a sister group closely related to ECIII (33).In 2005, the Food Safety and Inspection Service (FSIS) implemented an approach to inspection that includes consideration of relative risk in order to determine L. monocytogenes sampling frequency among establishments that produce certain RTE products. This approach incorporates information on production volume, outgrowth potential in the product, steps taken to prevent postlethality contamination, and FSIS sampling history. However, L. monocytogenes subtype-specific variation in ecology and virulence indicates that information on the lineage, major serogroup, and epidemic clone identities of isolates could be used to inform assessments of relative risk and to improve inspection programs that are based on consideration of risk. Several PCR-based methods have been described for differentiation of various combinations of these subgroups (1-3, 5, 7, 10, 35, 37); however, these approaches have focused on a single subgroup or a smaller set of subgroups than is differentiated by TMLGT analysis. Although we previously developed a set of three MLGT assays that can be used to differentiate all of the major serogroups and epidemic clones of L. monocytogenes (9, 33, 34), those assays did not include probes for lineage discrimination and require identification of the lineage prior to application of one of three unique sets of probes. In addition, the MLGT assays were designed to maximize strain discrimination, as opposed to subgroup identification, and require the use of at least twice as many probes as is needed for TMLGT analysis. MLGT data analysis is also more complicated than analysis of TMLGT data, and serogroup or epidemic clone type identification via MLGT requires phylogenetic analyses to place novel haplotypes within an established phylogenetic framework.In the present study, we developed the first assay for simultaneous discrimination of the four lineages, the four major serogroups, and the four previously described epidemic clones of L. monocytogenes. The assay includes multiple markers for each of these subtype probes as well as control probes to ensure that negative probe data were not the result of amplification failure, providing a high degree of internal validation required for use in inspection programs that consider risk in making sampling decisions. In addition, the utility of the assay has been validated with a large and diverse panel of 906 isolates, including 567 isolates from FSIS surveillance of RTE products and processing facilities (see Table S1 in the supplemental material). Data produced by the TMLGT assay are amenable to high-throughput analysis, and a simple spreadsheet utility has been developed to semiautomate subtype identifications and to alert investigators to potentially conflicting probe data (available upon request). In addition to having a potential application in inspection programs, the TMLGT assay provides a rapid and accurate means of characterizing L. monocytogenes isolates from different environments, which would facilitate pathogen tracking and improve understanding of L. monocytogenes ecology. 相似文献
TABLE 1.
Primers used in multiplex amplification for the TMLGT assayAmplicon | Positiona | Gene(s) | Primer | Sequence (5′-3′)b |
---|---|---|---|---|
INLa | 455381-456505 | inlA | inl2-a1 | GTCCTTGATAGTCTACTG |
inl2-a2 | ACCAAATTAGTAATCTAGCAC | |||
INLb | 457726-458752 | inlB | inl-f1d | GAATTRTTTAGYCAAGAATGT |
inlb-r | CTACCGGRACTTTATAGTAYG | |||
LMO | 325116-326096 | lmo0298-lmo0300 | lmo-a1 | AAGGCTTACAAGATGGCT |
lmo1a-1r | AAATAATAYGTGATACCGAC | |||
VGCa | 205366-206622 | plcA, hly | plca-f | CTCATCGTATCRTGTGTACC |
hly-r | TCTGGAAGGTCKTGTAGGTTC | |||
VGCb | 208447-209465 | mpl | ra_mpl-f | GTGGAYAGAACTCATAAAGG |
ra_mpl-r | ACTCCCTCCTYGTGATASGCT | |||
VGCc | 209728-211239 | actA | vgc1a-2f | TTCMATRCCAGCAGAACG |
vgc1a-2r | GCAGACCTAATAGCAATGTTG |
TABLE 2.
TMLGT probes and probe performance dataProbeb | Target (n)c | Probe sequenced | IDe | Sensitivity (%) | Specificity (%) |
---|---|---|---|---|---|
VGCb-21 | Lineage I (506) | AATCCTTTCTTTAATCTCAAATCAgcggaagcttgggaagcggtc | 7.3 | 100 | 100 |
VGCa-94 | Lineage I | CTTTCTATCTTTCTACTCAATAATcaacccgatgttcttcctgtc | 51.7 | 100 | 100 |
VGCc-8 | Lineage II (340) | AATCCTTTTACATTCATTACTTACattagctgattcgctttcct | 14.1 | 100 | 100 |
INLb-51 | Lineage II | TCATTTCAATCAATCATCAACAATagcgccaataaagctggc | 21.9 | 100 | 100 |
VGCb-19 | Lineage III (50) | TCAATCAATTACTTACTCAAATACccgctattaaaatgtactcca | 31.0 | 100 | 100 |
VGCb-29 | Lineage III | AATCTTACTACAAATCCTTTCTTTggtataccgctattaaaatgt | 45.1 | 100 | 100 |
LMO-17 | Lineage IV (10) | CTTTAATCCTTTATCACTTTATCAgaaccaaacaatgttattggt | 11.8 | 100 | 100 |
VGCa-27 | Lineage IV | CTTTTCAAATCAATACTCAACTTTttaacgacggtaacgtgccac | 58.3 | 100 | 100 |
INLb-84 | Serogroup 4b (213) | TCAACTAACTAATCATCTATCAATggtaaaaatatgcgaatattg | 9.7 | 100 | 100 |
INLb-85 | Serogroup 4b | ATACTACATCATAATCAAACATCActcgtgaacaagctttcc | 5.5 | 100 | 100 |
INLb-16 | Serogroup 1/2b (293) | AATCAATCTTCATTCAAATCATCAggtaaaaatatgcgtatctta | 11.7 | 100 | 100 |
INLb-100 | Serogroup 1/2b | CTATCTTTAAACTACAAATCTAACgtgaataagctatcggtctat | 13.0 | 100 | 100 |
LMO-42 | Serogroup 1/2a (268) | CTATCTTCATATTTCACTATAAACtggcgttgctgrctaagtttg | 6.6 | 100 | 100 |
VGCb-40 | Serogroup 1/2a | CTTTCTACATTATTCACAACATTAaatcaagcsgctcatatgaag | 10.4 | 100 | 98.6 |
LMO-9 | Serogroup 1/2c (72) | TAATCTTCTATATCAACATCTTACtttactggtgaaatggcg | 13.5 | 100 | 100 |
VGCb-5 | Serogroup 1/2c | CAATTCAAATCACAATAATCAATCaagattacgaatcgcttccac | 20.8 | 98.6 | 100 |
LMO-10 | ECI (111) | ATCATACATACATACAAATCTACAatgattaaaagtcagggaaag | 19.0 | 100 | 100 |
LMO-28 | ECI | CTACAAACAAACAAACATTATCAAaatcgaggcttacgaacgt | 23.7 | 100 | 100 |
VGCc-80 | ECIa (44) | CTAACTAACAATAATCTAACTAACactacaacgaaaacagcgc | 10.7 | 100 | 100 |
VGCa-35 | ECIa | CAATTTCATCATTCATTCATTTCAgttacttttatgtcgagt | 9.2 | 100 | 100 |
LMO-12 | ECII (35) | TACACTTTCTTTCTTTCTTTCTTTataccgattatttggacggtt | 3.8 | 100 | 100 |
LMO-30 | ECII | TTACCTTTATACCTTTCTTTTTACgacttgtagcagttgatttcaa | 7.5 | 100 | 100 |
VGCc-45 | ECIII (10) | TCATTTCACAATTCAATTACTCAActcttatttgcttttgttggtc | 21.1 | 100 | 99.4 |
INLa-3 | ECIII | TACACTTTATCAAATCTTACAATCgagcttaatgaaaatcagcta | 17.0 | 100 | 99.4 |
INLa-1 | INLa control | CTTTAATCTCAATCAATACAAATCagaagtggaagctgggaa | NAa | NA | NA |
INLb-13 | INLb control | CAATAAACTATACTTCTTCACTAAtgcacctaaacctccgac | NA | NA | NA |
LMO-88 | LMO control | TTACTTCACTTTCTATTTACAATCccgtttccttatgccaca | NA | NA | NA |
VGCa-23 | VGCa control | TTCAATCATTCAAATCTCAACTTTcaagycctaagacgccaatcg | NA | NA | NA |
VGCb-25 | VGCb control | CTTTTCAATTACTTCAAATCTTCAgcatgcgttagttcatgrcca | NA | NA | NA |
VGCc-82 | VGCc control | TACATACACTAATAACATACTCATgactgcatgctagaatctaag | NA | NA | NA |
8.
Replication-Defective Adenovirus Vectors with Multiple Deletions Do Not Induce Measurable Vector-Specific T Cells in Human Trials
下载免费PDF全文
![点击此处可从《Journal of virology》网站下载免费的PDF全文](/ch/ext_images/free.gif)
Richard A. Koup Laurie Lamoreaux David Zarkowsky Robert T. Bailer C. Richter King Jason G. D. Gall Douglas E. Brough Barney S. Graham Mario Roederer 《Journal of virology》2009,83(12):6318-6322
The magnitude and character of adenovirus serotype 5 (Ad5)-specific T cells were determined in volunteers with and without preexisting neutralizing antibodies (NAs) to Ad5 who received replication-defective Ad5 (rAd5)-based human immunodeficiency virus vaccines. There was no correlation between T-cell responses and NAs to Ad5. There was no increase in magnitude or activation state of Ad5-specific CD4+ T cells at time points where antibodies to Ad5 and T-cell responses to the recombinant gene products could be measured. These data indicate that rAd5-based vaccines containing deletions in the E1, E3, and E4 regions do not induce appreciable expansion of vector-specific CD4+ T cells.Replication-defective adenoviruses (rAd) have been engineered to provide high levels of expression of foreign inserts with minimum expression of adenovirus proteins, making them excellent candidates for vaccine and gene therapy applications (3, 16). Despite promising immunogenicity, a prophylactic vaccine trial of a serotype 5 rAd (rAd5) vector expressing human immunodeficiency virus (HIV) Gag, Pol, and Nef genes (Step trial) was recently halted due to an increase in HIV infections among volunteers who had preexisting neutralizing antibodies (NAs) to Ad5 (7). This finding raises the possibility that the presence of Ad5-specific T-cell responses (specifically CD4+ T-cell responses) in subjects with preexisting Ad5 NAs could be boosted by rAd5 vaccines, thereby providing an expanded susceptible target cell population that could be more easily infected by HIV. If this mechanism were operative, it would have broad implications for the future use of rAd viruses, and indeed other virus vectors, as vaccines or therapeutic agents within HIV-susceptible populations (2, 12, 15). We therefore measured the frequency, magnitude, and activation status of rAd5-specific T cells in HIV-uninfected volunteers who had received rAd5-based HIV vaccines in the presence or absence of preexisting NAs to Ad5.We studied 31 volunteers enrolled in two NIAID Institutional Review Board-approved phase I clinical trials of rAd5-based HIV vaccines. VRC 006 was a dose escalation study evaluating a single inoculation of a rAd5 mixture expressing EnvA, EnvB, EnvC, and fusion protein Gag/PolB at 109, 1010, and 1011 total particle units (10). VRC 008 evaluated DNA priming by needle and syringe or Biojector, followed by rAd5 boosting. Both studies enrolled healthy, HIV-uninfected adults; used the same rAd5 products; and evaluated immunogenicity on the day of and 4 weeks after rAd5 immunization. Both of these trials involved rAd5 products that contained deletions in the E1, E3, and E4 regions (8, 10).NAs to Ad5 were determined for all volunteers as previously described (19). A 90% NA titer of 12 or more was considered positive and taken as evidence of preexisting humoral immunity to Ad5. Volunteers were chosen for assessment of Ad5-specific T-cell responses based upon the availability of peripheral blood mononuclear cell samples at key time points and the presence or absence of preexisting NAs to Ad5. Only volunteers who received the vaccine (not the placebo) were included. Table Table11 lists the volunteers who were tested for Ad5-specific T-cell responses and their NA titers to Ad5 before and after rAd5 vaccination. All volunteers, except for one (volunteer 12) who had a less-than-maximum NA titer to Ad5 before vaccination, had an increase in titer by 4 weeks after vaccination, indicating the successful “take” of the rAd5-based vaccine. There was no correlation between rAd5 dose and increase in Ad5 NA titer.
Open in a separate windowaPU, particle units.HIV-specific T-cell responses were measured by multiparameter flow cytometry after 6 h of stimulation with peptides (15-mers overlapping by 11) corresponding to the HIV EnvA protein (one of the vaccine inserts expressed in the Ad5 vectors), as previously described (13). Overlapping peptides corresponding to the major Ad5 surface protein (hexon), the Ad5 early regulatory protein (E2A), and Ad5 ORF1, -2, and -3 proteins were used to assess Ad5-specific T-cell responses, and additional markers of cell viability (ViViD), T-cell memory (CD45RO and CD27), and activation/division (CCR5, CD38, HLA-DR, and Ki67) were added to the panel for these assessments. Antibodies and fluorochromes used in this panel were CCR5-Cy7-phycoerythrin (PE), CD38-allophycocyanin, Ki67-fluorescein isothiocyanate, and CD3-Cy7-allophycocyanin, all from BD PharMingen; CD8-Cy55-PE from BD Biosciences; CD27-Cy5-PE and CD45RO-Texas Red-PE, both from Beckman Coulter; CD4-Cy5.5-PE from Caltag; CD14- and CD19-PacificBlue, CD57-QDot545, and HLA-DR-Alexa680, conjugated according to standard protocols [http://drmr.com/abcon/index.html]); gamma interferon-PE and interleukin-2-PE from BD Biosciences; and a violet amine dye from Invitrogen. Cells were analyzed on an LSRII instrument (Becton Dickinson), and data analysis was performed using FlowJo, version 8.1.1 (TreeStar). The gating strategy is shown in Fig. Fig.1A1A.Open in a separate windowFIG. 1.CD4+ and CD8+ T-cell responses to Ad5. (A) Gating tree used to determine antigen-specific T-cell frequencies. Single CD3+ ViViD− CD14− CD19− cells were gated on CD4 or CD8 cells. Naïve CD27+ CD45RO− cells were gated out, and the frequency of cells expressing gamma interferon (IFNg) and/or interleukin-2 (IL2) was determined. FSC-A, forward scatter area; FSC-H, forward scatter height; SSC-A, side scatter area. (B) Frequencies of CD4+ and CD8+ T-cell responses after stimulation with Ad5 hexon or E2A peptides were plotted against the prevaccination Ad5 NA titer. The prevaccine T-cell response was used. (C) Frequencies of CD4+ and CD8+ T-cell responses to Ad5 hexon, E2A, and HIV EnvA before and 4 weeks after rAd5 vaccination are shown for subjects with (Ad5 NA titer of >12) and without (Ad5 NA titer of <12) preexisting NAs to Ad5. Boxed areas represent interquartile ranges, and horizontal lines represent medians.Previously, we had found no T-cell responses to Ad5 ORF1, -2, or -3, so data from these antigen stimulations are not shown. As shown in Fig. Fig.1B,1B, T-cell responses to Ad5 hexon and E2A were detected, but there was no association between the NA response to Ad5 and the T-cell responses to these Ad5 proteins. Volunteers with an absence of NAs to Ad5 often had very strong CD4+ and CD8+ T-cell responses to Ad5 proteins. This probably reflects the degree of protein sequence homology between different adenovirus serotypes (11) and suggests that T-cell responses to adenoviruses may be significantly cross-reactive, while NAs are serotype specific. It also indicates that the NA response to Ad5 cannot be used as a surrogate for either a CD4+ or a CD8+ T-cell response to that adenovirus serotype.We next asked whether Ad5-specific T-cell responses were boosted by a single rAd5 vaccination in subjects with or without preexisting NAs to Ad5. At the time point 4 weeks after vaccination, there was clear evidence of boosting of the insert-specific (EnvA) CD4+ and CD8+ T-cell responses in volunteers with and without preexisting NAs to Ad5 (Fig. (Fig.1C).1C). The results of the Ad5-specific responses were consistent across volunteers who had received prior DNA immunization (VRC 008) and those who had not (VRC 006), so the results are combined in Fig. Fig.1C1C and show no increase in Ad5 hexon- or E2A-specific CD4+ T-cell responses after rAd5 immunization irrespective of Ad5 NA status. There was evidence of an increase in the CD8+ T-cell response to Ad5 hexon (P = 0.004 by paired t test), but not that to E2A, after rAd5 vaccination. These results, while showing evidence of adenovirus-specific CD8+ T-cell boosting by rAd5 vaccination, do not indicate an expansion of Ad5-specific CD4+ T cells that could serve as a substrate for HIV infection in subjects with or without NAs to Ad5.Having failed to demonstrate an expansion of Ad5-specific CD4+ T cells after vaccination, we assessed whether the activation profile of the unexpanded Ad5-specific CD4+ T cells was changed by vaccination. The gating tree is shown in Fig. Fig.2A.2A. Ad5 hexon- and E2A-specific CD4+ T cells expressed activation markers CCR5, CD38, and HLA-DR and a marker of recent cell division, Ki67, more frequently than did total memory CD4+ T cells (Fig. (Fig.2B).2B). However, none of these markers were significantly increased on total or Ad5-specific CD4+ T cells after vaccination in volunteers with or without preexisting NAs to Ad5.Open in a separate windowFIG. 2.Vaccine-induced activation of Ad5-specific CD4+ T cells. (A) Total CD4+ memory cells or Ad5-specific CD4+ memory cells (as gated in Fig. Fig.1A)1A) were further defined by expression of Ki67, CD38, CCR5, and HLA-DR. (B) Percentages of Ad5 hexon-specific cells, E2A-specific cells, or total memory CD4+ T cells that express CCR5, CD38, HLA-DR, or Ki67 before and 4 weeks after rAd5 vaccination are shown for subjects with (Ad5 NA titer of >12) (left) and without (Ad5 NA titer of >12) (right) preexisting NAs to Ad5. The phenotype was assessed only for those responders for whom at least 10 cytokine-positive events were counted. None of the comparisons of pre- and postvaccination marker expression were significant at a P value of 0.02 by paired t test. Boxed areas represent interquartile ranges, and horizontal lines represent medians.Expansion of Ad5-specific T cells after rAd5-based vaccination or gene therapy has been reported by others (14, 20, 21). Those studies evaluated Ad5-specific responses to rAd5 vectors with only the adenovirus E1 gene deleted (as used in the Step trial vaccines). The vectors used here contained deletions of the adenovirus E1, E3, and E4 genes (8, 10). While adenovirus gene deletions can render the vectors replication defective (6, 9), they do not necessarily completely shut off all adenovirus protein expression (20, 21). To demonstrate the importance of E4 deletions in limiting expression of adenovirus gene products, we measured the level of adenovirus protein synthesis in infected A549 cells as previously described (1, 4, 5). Cells were infected with adenovirus vectors with E1 and E3 deletions or with E1, E3, and E4 deletions at the same multiplicity of infection (10 focus-forming units per cell). At 24 h postinfection, [35S]methionine was added for 1 h. Levels of total and adenovirus protein synthesis in the infected and mock-infected cells were compared (Fig. (Fig.3).3). Adenovirus early protein single-stranded DNA binding protein, as well as late gene products hexon, penton, and fiber, was immunoprecipitated, fractionated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and resolved by autoradiography. The results show that the amount of newly synthesized adenovirus proteins in cells infected with adenovirus with E1, E3, and E4 deletions is significantly lower than that for an adenovirus vector with E1 and E3 deletions. Therefore, our inability to detect a vaccine-induced increase in the frequency and character of the Ad5-specific T-cell response could relate to the very low levels of adenovirus proteins that were probably expressed in vivo by the rAd5 vectors with multiple deletions.Open in a separate windowFIG. 3.Ad5 protein expression in vitro after infection with different Ad5 vectors. A549 cells were infected with adenovirus vectors with E1 and E3 deletions or with E1, E3, and E4 deletions and [35S]methionine labeled, and levels of total and adenovirus protein synthesis in the infected and mock-infected cells were compared after sodium dodecyl sulfate-polyacrylamide gel electrophoresis and autoradiography. Markers for the adenovirus early protein single-stranded DNA binding protein (DBP) and capsid proteins hexon, penton base, and fiber are shown.We were therefore unable to demonstrate (i) that Ad5-specific CD4+ T cells were restricted to subjects with preexisting Ad5 NAs, (ii) that rAd5 vaccination expanded or increased the activation of Ad5-specific CD4+ T cells, or (iii) that there was a substantial effect on the magnitude or character of the Ad5-specific CD4+ T-cell response to vaccination based upon preexisting NAs to Ad5. While the kinetics of Ad5-specific T-cell responses after rAd5-based vaccination are not known, it is clear that insert-specific responses are increased at 4 weeks after vaccination and subsequently contract (10). It is therefore reasonable to assume that if Ad5-specific responses were similarly affected, they would be detected at the 4-week-postvaccination time point.It is possible that rAd5 vaccines expand a preexisting mucosal T-cell response to Ad5 that is not reflected within the blood. While we do not have mucosal samples from our vaccine volunteers to directly address this possibility, it is likely that expansion of a mucosal response would be reflected to some degree within the blood.The mechanism underlying the increase in HIV infections in vaccinees with NAs to Ad5 in the Step trial is yet to be determined (2, 7, 12, 15, 17). Confounding factors and alternative hypotheses have recently been proposed to account for the increased acquisition (7, 12, 15, 18). Until there is a better understanding of the processes involved, future studies of rAd5-based products should proceed with appropriate safety considerations and monitoring of adenovirus-specific responses. In addition, the use of vaccine regimens involving single injections of vectors with multiple deletions may help mitigate risk. 相似文献
TABLE 1.
Ad5 serostatus before and after vaccinationVolunteer | Prior DNA immunization | rAd5 dose (PUa) | Ad5 NA titer
| |
---|---|---|---|---|
Prevaccine | Postvaccine | |||
1 | No | 1011 | <12 | 739 |
2 | No | 1011 | <12 | 834 |
3 | No | 1011 | <12 | 4,787 |
4 | No | 1011 | <12 | 806 |
5 | No | 1011 | <12 | 1,033 |
6 | No | 1010 | <12 | 130 |
7 | No | 1010 | <12 | 1,354 |
8 | Yes | 1010 | <12 | 1,387 |
9 | Yes | 1010 | <12 | 575 |
10 | Yes | 1010 | <12 | 170 |
11 | Yes | 1010 | <12 | >8,748 |
12 | Yes | 1010 | <12 | <12 |
13 | No | 1011 | 30 | >8,748 |
14 | No | 109 | 46 | >8,748 |
15 | No | 109 | 70 | 328 |
16 | No | 1010 | 176 | >8,748 |
17 | No | 1010 | 478 | 6,198 |
18 | No | 109 | 2,472 | >8,748 |
19 | No | 109 | 3,502 | >8,748 |
20 | No | 1010 | 4,820 | >8,748 |
21 | No | 109 | 5,078 | >8,748 |
22 | No | 1011 | 6,162 | >8,748 |
23 | No | 109 | >8,748 | >8,748 |
24 | No | 1011 | >8,748 | >8,748 |
25 | Yes | 1010 | 643 | >8,748 |
26 | Yes | 1010 | 942 | >8,748 |
27 | Yes | 1010 | 1,510 | >8,748 |
28 | Yes | 1010 | 1,611 | >8,748 |
29 | Yes | 1010 | 2,934 | >8,748 |
30 | Yes | 1010 | >8,748 | >8,748 |
31 | Yes | 1010 | >8,748 | >8,748 |
9.
10.
Mariska M.G. Leeflang Anne W.S. Rutjes Johannes B. Reitsma Lotty Hooft Patrick M.M. Bossuyt 《CMAJ》2013,185(11):E537-E544
Background:
Anecdotal evidence suggests that the sensitivity and specificity of a diagnostic test may vary with disease prevalence. Our objective was to investigate the associations between disease prevalence and test sensitivity and specificity using studies of diagnostic accuracy.Methods:
We used data from 23 meta-analyses, each of which included 10–39 studies (416 total). The median prevalence per review ranged from 1% to 77%. We evaluated the effects of prevalence on sensitivity and specificity using a bivariate random-effects model for each meta-analysis, with prevalence as a covariate. We estimated the overall effect of prevalence by pooling the effects using the inverse variance method.Results:
Within a given review, a change in prevalence from the lowest to highest value resulted in a corresponding change in sensitivity or specificity from 0 to 40 percentage points. This effect was statistically significant (p < 0.05) for either sensitivity or specificity in 8 meta-analyses (35%). Overall, specificity tended to be lower with higher disease prevalence; there was no such systematic effect for sensitivity.Interpretation:
The sensitivity and specificity of a test often vary with disease prevalence; this effect is likely to be the result of mechanisms, such as patient spectrum, that affect prevalence, sensitivity and specificity. Because it may be difficult to identify such mechanisms, clinicians should use prevalence as a guide when selecting studies that most closely match their situation.Diagnostic accuracy plays a central role in the evaluation of medical diagnostic tests. Test accuracy may be expressed as sensitivity and specificity, as positive and negative predictive values or as positive and negative likelihood ratios.1 Some feel that the positive and negative predictive values of a test are more clinically relevant measures than sensitivity and specificity. However, predictive values directly depend on disease prevalence and can therefore not directly be translated from one situation to another.2 In contrast, a test’s sensitivity and specificity are commonly believed not to vary with disease prevalence.3–5Stability of sensitivity and specificity is an assumption that underlies the use of Bayes theorem in clinical diagnosis. Bayes theorem can be applied in clinical practice by using the likelihood ratio of a test and the probability of the disease before the test was done (pretest probability) to estimate the probability of disease after the test was done.2 Because likelihood ratios are a function of sensitivity and specificity, it is assumed that the likelihood ratios also remain the same when prevalence varies.A number of studies have shown that sensitivity and specificity may not be as stable as thought.6–10 We previously summarized the possible mechanisms through which differences in disease prevalence may lead to changes in a test’s sensitivity and specificity.10 Prevalence affects diagnostic accuracy because of clinical variability or through artifactual differences, as described in the theoretical framework in 6,7 Artifactual differences can result from using additional exclusion criteria, verification bias or an imperfect reference standard. For example, using an imperfect reference standard may lead to an underestimate of diagnostic accuracy, but as prevalence increases, the extent to which this happens will vary.8,9Table 1:
Theoretical framework of how disease prevalence and test accuracy may be related10Factor | Effect on prevalence | Effect on accuracy |
---|---|---|
Clinical variability | ||
Patient spectrum |
|
|
Referral filter |
|
|
Reader expectations |
|
|
Artifactual variability | ||
Distorted inclusion of participants |
|
|
Verification bias |
|
|
Imperfect reference standard |
|
|
11.
12.
Robert Ng Lakshmanan Govindasamy Brittney L. Gurda Robert McKenna Olga G. Kozyreva R. Jude Samulski Kristin N. Parent Timothy S. Baker Mavis Agbandje-McKenna 《Journal of virology》2010,84(24):12945-12957
The three-dimensional structure of adeno-associated virus (AAV) serotype 6 (AAV6) was determined using cryo-electron microscopy and image reconstruction and using X-ray crystallography to 9.7- and 3.0-Å resolution, respectively. The AAV6 capsid contains a highly conserved, eight-stranded (βB to βI) β-barrel core and large loop regions between the strands which form the capsid surface, as observed in other AAV structures. The loops show conformational variation compared to other AAVs, consistent with previous reports that amino acids in these loop regions are involved in differentiating AAV receptor binding, transduction efficiency, and antigenicity properties. Toward structure-function annotation of AAV6 with respect to its unique dual glycan receptor (heparan sulfate and sialic acid) utilization for cellular recognition, and its enhanced lung epithelial transduction compared to other AAVs, the capsid structure was compared to that of AAV1, which binds sialic acid and differs from AAV6 in only 6 out of 736 amino acids. Five of these residues are located at or close to the icosahedral 3-fold axis of the capsid, thereby identifying this region as imparting important functions, such as receptor attachment and transduction phenotype. Two of the five observed amino acids are located in the capsid interior, suggesting that differential AAV infection properties are also controlled by postentry intracellular events. Density ordered inside the capsid, under the 3-fold axis in a previously reported, conserved AAV DNA binding pocket, was modeled as a nucleotide and a base, further implicating this capsid region in AAV genome recognition and/or stabilization.Adeno-associated viruses (AAVs) are nonpathogenic single-stranded DNA (ssDNA) parvoviruses that belong to the Dependovirus genus and require helper viruses, such as Adenovirus or Herpesvirus, for lytic infection (4, 8, 22, 67). These viruses package a genome of ∼4.7 kb inside an icosahedral capsid (∼260 Å in diameter) with a triangulation number equal to 1 assembled from a total of 60 copies of their overlapping capsid viral protein (VP) 1 (VP1), VP2, and VP3 in a predicted ratio of 1:1:8/10 (10). The VPs are encoded from a cap open reading frame (ORF). VP3 is 61 kDa and constitutes 90% of the capsid''s protein composition. The less abundant VPs, VP1 (87 kDa) and VP2 (73 kDa), share the same C-terminal amino acid sequence with VP3 but have additional N-terminal sequences. A rep ORF codes for four overlapping proteins required for replication and DNA packaging.To date, more than 100 AAV isolates have been identified (21). Among the human and nonhuman primate AAVs isolated, 12 serotypes (AAV serotype 1 [AAV1] to AAV12) have been described and are classified into six phylogenetic clades on the basis of their VP sequences and antigenic reactivities, with AAV4 and AAV5 considered to be clonal isolates (21). AAV1 and AAV6, which represent clade A, differ by only 6 out of 736 VP1 amino acids (5 amino acids within VP3) and are antigenically cross-reactive. Other clade representatives include AAV2 (clade B), AAV2-AAV3 hybrid (clade C), AAV7 (clade D), AAV8 (clade E), and AAV9 (clade F) (21).The AAVs are under development as clinical gene delivery vectors (e.g., see references 5, 9, 12, 13, 24, 25, 53, and 61), with AAV2, the prototype member of the genus, being the most extensively studied serotype for this application. AAV2 has been successfully used to treat several disorders, but its broad tissue tropism makes it less effective for tissue-specific applications and the prevalence of preexisting neutralizing antibodies in the human population (11, 43) limits its utilization, especially when readministration is required to achieve a therapeutic outcome. Efforts have thus focused on characterizing the capsid-associated tissue tropism and transduction properties conferred by the capsid of representative serotypes of other clades (21). Outcomes of these studies include the observation that AAV1 and AAV6, for example, transduce liver, muscle, and airway epithelial cells more efficiently (e.g., up to 200-fold) than AAV2 (27, 28, 30). In addition, the six residues (Table (Table1)1) that differ between the VPs of AAV1 and AAV6 (a natural recombinant of AAV1 and AAV2 [56]) confer functional disparity between these two viruses. For example, AAV6 shows ∼3-fold higher lung cell epithelium transduction than AAV1 (27), and AAV1 and AAV6 bind terminally sialylated proteoglycans as their primary receptor, whereas AAV6 additionally binds to heparan sulfate (HS) proteoglycans with moderate affinity (70, 71). Therefore, a comparison of the AAV1 and AAV6 serotypes and, in particular, their capsid structures can help pinpoint the capsid regions that confer differences in cellular recognition and tissue transduction.
Open in a separate windowaMutant residues in boldface have an AAV6 parental original; those underlined have an AAV1 parental origin.bS, sialic acid; HS, heparan sulfate; HS+, HS positive.cThe sialic acid binding phenotypes of these mutants were not discussed in the respective publications but are assumed to be still present.dThe glycan targets for these mutants were not discussed in this publication; thus, the phenotypes indicated are assumed.eThis mutant is sialic acid independent (S-ind) for cellular transduction.The structures of AAV1 to AAV5 and AAV8 have been determined by X-ray crystallography and/or cryo-electron microscopy and image reconstruction (cryo-EM) (23, 36, 47, 52, 66, 73; unpublished data), and preliminary characterization of crystals has also been reported for AAV1, AAV5, AAV7, and AAV9 (15, 45, 46, 55). The capsid VP structures contain a conserved eight-stranded (βB to βI) β-barrel core and large loop regions between the strands that form the capsid surface. The capsid surface is characterized by depressions at the icosahedral 2-fold axes of symmetry, finger-like projections surrounding the 3-fold axes, and canyon-like depressions surrounding the 5-fold axes. A total of nine variable regions (VRs; VRI to VRIX) were defined when the two most disparate structures, AAV2 and AAV4, were compared (23). The VRs contain amino acids that contribute to slight differences in surface topologies and distinct functional phenotypes, such as in receptor binding, transduction efficiency, and antigenic reactivity (10, 23, 37, 47).The structure of virus-like particles (VLPs) of AAV6, produced in a baculovirus/Sf9 insect cell expression system, has been determined by two highly complementary approaches, cryo-EM and X-ray crystallography. The AAV6 VP structure contains the general features already described for the AAVs and has conformational differences in the VRs compared to the VRs of other AAVs. The 9.7-Å-resolution cryoreconstructed structure enabled the localization of the C-α positions of five of the six amino acids that differ between highly homologous AAV6 and AAV1 but did not provide information on the positions of the side chains or their orientations. The X-ray crystal structure determined to 3.0-Å resolution enabled us to precisely map the atomic positions of these five residues at or close to the icosahedral 3-fold axes of the capsid. Reported mutagenesis and biochemical studies had functionally annotated the six residues differing between AAV1 and AAV6 with respect to their roles in receptor attachment and differential cellular transduction. Their disposition identifies the 3-fold capsid region as playing essential roles in AAV infection. 相似文献
TABLE 1.
Amino acid differences between AAV1 and AAV6 and their reported mutantsAAV | Amino acid at positiona: | Glycan targetb | Reference | ||||||
---|---|---|---|---|---|---|---|---|---|
129 | 418 | 531 | 532 | 584 | 598 | 642 | |||
AAV1 | L | E | E | D | F | A | N | S | 70 |
AAV1-E/K | L | E | K | D | F | A | N | HS+ (and S)c | 70 |
AAV6 | F | D | K | D | L | V | H | HS and S | 70 |
AAV6.1 | F | D | E | D | L | V | H | HS− (and S)c | 40, 70 |
AAV6.2 | L | D | K | D | L | V | H | HS (and S)c | 40, 70 |
AAV6R2 | L | D | E | D | L | V | H | HS− (and S)c | 40 |
HAE1 | L | E | E | D | L | V | N | (HS− and S)d | 39 |
HAE2 | L | D | K | D | L | V | N | (HS and S)d | 39 |
shH10 | F | D | K | N | L | V | N | HS (and S-inde) | 33 |
13.
Katharine J. Bar Hui Li Annie Chamberland Cecile Tremblay Jean Pierre Routy Truman Grayson Chuanxi Sun Shuyi Wang Gerald H. Learn Charity J. Morgan Joseph E. Schumacher Barton F. Haynes Brandon F. Keele Beatrice H. Hahn George M. Shaw 《Journal of virology》2010,84(12):6241-6247
Recent studies indicate that sexual transmission of human immunodeficiency virus type 1 (HIV-1) generally results from productive infection by only one virus, a finding attributable to the mucosal barrier. Surprisingly, a recent study of injection drug users (IDUs) from St. Petersburg, Russia, also found most subjects to be acutely infected by a single virus. Here, we show by single-genome amplification and sequencing in a different IDU cohort that 60% of IDU subjects were infected by more than one virus, including one subject who was acutely infected by at least 16 viruses. Multivariant transmission was more common in IDUs than in heterosexuals (60% versus 19%; odds ratio, 6.14; 95% confidence interval [CI], 1.37 to 31.27; P = 0.008). These findings highlight the diversity in HIV-1 infection risks among different IDU cohorts and the challenges faced by vaccines in protecting against this mode of infection.Elucidation of virus-host interactions during and immediately following the transmission event is one of the great challenges and opportunities in human immunodeficiency virus (HIV)/AIDS prevention research (14-16, 31, 34, 45). Recent innovations involving single-genome amplification (SGA), direct amplicon sequencing, and phylogenetic inference based on a model of random virus evolution (18-20, 43) have allowed for the identification of transmitted/founder viruses that actually cross from donor to recipient, leading to productive HIV type 1 (HIV-1) infection. Our laboratory and others have made the surprising finding that HIV-1 transmission results from productive infection by a single transmitted/founder virus (or virally infected cell) in ∼80% of HIV-infected heterosexuals and in ∼60% of HIV-infected men who have sex with men (MSM) (1, 13, 18, 24). These studies thus provided a precise quantitative estimate for the long-recognized genetic bottleneck in HIV-1 transmission (6, 11-13, 17, 25, 28, 30, 35, 38, 42, 47-49) and a plausible explanation for the low acquisition rate per coital act and for graded infection risks associated with different exposure routes and behaviors (15, 36).In contrast to sexual transmission of HIV-1, virus transmission resulting from injection drug use has received relatively little attention (2, 3, 29, 42) despite the fact that injection drug use-associated transmission accounts for as many as 10% of new infections globally (26, 46). We hypothesized that SGA strategies developed for identifying transmitted/founder viruses following mucosal acquisition are applicable to deciphering transmission events following intravenous inoculation and that, due to the absence of a mucosal barrier, injection drug users (IDUs) exhibit a higher frequency of multiple-variant transmission and a wider range in numbers of transmitted viruses than do acutely infected heterosexual subjects. We obtained evidence in support of these hypotheses from the simian immunodeficiency virus (SIV)-Indian rhesus macaque infection model, where we showed that discrete low-diversity viral lineages emanating from single or multiple transmitted/founder viruses could be identified following intravenous inoculation and that the rectal mucosal barrier to infection was 2,000- to 20,000-fold greater than with intravenous inoculation (19). However, we also recognized potentially important differences between virus transmission in Indian rhesus macaques and virus transmission in humans that could complicate an IDU acquisition study. For example, in the SIV macaque model, the virus inocula can be well characterized genetically and the route and timing of virus exposure in relation to plasma sampling precisely defined, whereas in IDUs, the virus inoculum is generally undefined and the timing of virus infection only approximated based on clinical history and seroconversion testing (8). In addition, IDUs may have additional routes of potential virus acquisition due to concomitant sexual activity. Finally, there is a paucity of IDU cohorts for whom incident infection is monitored sufficiently frequently and clinical samples are collected often enough to allow for the identification and enumeration of transmitted/founder viruses. To address these special challenges, we proposed a pilot study of 10 IDU subjects designed to determine with 95% confidence if the proportion of multivariant transmissions in IDUs was more than 2-fold greater than the 20% frequency established for heterosexual transmission (1, 13, 18, 24). A secondary objective of the study was to determine whether the range in numbers of transmitted/founder viruses in IDUs exceeded the 1-to-6 range observed in heterosexuals (1, 13, 18, 24). To ensure comparability among the studies, we employed SGA-direct amplicon sequencing approaches, statistical methods, and power calculations identical to those that we had used previously to enumerate transmitted/founder viruses in heterosexual and MSM cohorts (1, 13, 18, 20, 24).We first surveyed investigators representing acute-infection cohorts in the United States, Canada, Russia, and China; only one cohort—the Montreal Primary HIV Infection Cohort (41)—had IDU clinical samples and clinical data available for study. The Montreal cohort of subjects with acute and early-stage HIV-1 infection was established in 1996 and recruits subjects from both academic and private medical centers throughout the city. Injection drug use is an important contributing factor to Montreal''s HIV burden, with IDUs comprising approximately 20% of the city''s AIDS cases and 35% of the cohort (21, 40, 41). A large proportion of Montreal''s IDUs use injection cocaine, with 50 to 69% of subjects reporting cocaine as their injection drug of choice (4, 5, 9, 22, 23).Subjects with documented serological evidence of recent HIV-1 infection and a concurrent history of injection drug use were selected for study. These individuals had few or no reported risk factors for sexual HIV-1 acquisition. Clinical history and laboratory tests of HIV-1 viremia and antibody seroconversion were used to determine the Fiebig clinical stage (8) and to estimate the date of infection (Table (Table1).1). One subject was determined to be in Fiebig stage III, one subject was in Fiebig stage IV, five subjects were in Fiebig stage V, and three subjects were in Fiebig stage VI. We performed SGA-direct amplicon sequencing on stored plasma samples and obtained a total of 391 3′ half-genomes (median, 25 per subject; range, 19 to 167). Nine of these sequences contained large deletions or were G-to-A hypermutated and were excluded from subsequent analysis. Sequences were aligned, visually inspected using the Highlighter tool (www.hiv.lanl.gov/content/sequence/HIGHLIGHT/highlighter.html), and analyzed by neighbor-joining (NJ) phylogenetic-tree construction. A composite NJ tree of full-length gp160 env sequences from all 10 subjects (Fig. (Fig.1A)1A) revealed distinct patient-specific monophyletic lineages, each with high bootstrap support and separated from the others by a mean genetic distance of 10.79% (median, 11.29%; range, 3.00 to 13.42%). Maximum within-patient env gene diversity ranged from 0.23% to 3.34% (Table (Table1).1). Four subjects displayed distinctly lower within-patient maximum env diversities (0.23 to 0.49%) than the other six subjects (1.48% to 3.34%). The lower maximum env diversities in the former group are consistent with infection either by a single virus or by multiple closely related viruses, while the higher diversities can be explained only by transmission of more than one virus based on empirical observations (1, 13, 18, 24) and mathematical modeling (18, 20).Open in a separate windowFIG. 1.NJ trees and Highlighter plots of HIV-1 gp160 env sequences. (A) Composite tree of 382 gp160 env sequences from all study subjects. The numerals at the nodes indicate bootstrap values for which statistical support exceeded 70%. (B) Subject ACT54869022 sequences suggest productive infection by a single virus (V1). (C) Subject HDNDRPI032 sequences suggest productive infection by as many as three viruses. (D) Subject HDNDRPI001 sequences suggest productive infection by at least five viruses with extensive interlineage recombination. Sequences are color coded to indicate viral progeny from distinct transmitted/founder viruses. Recombinant virus sequences are depicted in black. Methods for SGA, sequencing, model analysis, Highlighter plotting, and identification of transmitted/founder virus lineages are described elsewhere (18, 20, 24, 44). The horizontal scale bars represent genetic distance. nt, nucleotide.
Open in a separate windowaM, male; F, female.bNumbers of days postinfection were estimated on the basis of serological markers, clinical symptoms, or a history of a high-risk behavior leading to virus exposure.cDiversity measurements determined by PAUP* analysis.dThe model prediction of the maximum achievable env diversity 100 days after transmission is 0.60% (95% CI, 0.54 to 0.68%). Diversity values exceeding this range imply transmission and productive infection by more than one virus. Diversity values less than 0.54% can be explained by transmission of one virus or of multiple closely related viruses (18).eModel described in Keele et al. (18).fMinimum estimate of transmitted/founder viruses.gND, not determined.An example of productive clinical infection by a single virus is shown in phylogenetic tree and Highlighter plots from subject ACT54869022 (Fig. (Fig.1B).1B). A similar phylogenetic pattern of single-variant transmission was found in 4 of 10 IDU subjects (Table (Table1).1). Examples of multivariant transmission are shown for subject HDNDRPI032, for whom there was evidence of infection by 3 transmitted/founder viruses (Fig. (Fig.1C)1C) and for subject HDNDRPI001, for whom there was evidence of infection by at least 5 transmitted/founder viruses (Fig. (Fig.1D).1D). One IDU subject, HDNDRPI034, had evidence of multivariant transmission to an extent not previously seen in any of 225 subjects who acquired their infection by mucosal routes (1, 13, 18, 24) or in any of 13 IDUs, as recently reported by Masharsky and colleagues (29). We greatly extended the depth of our analysis in this subject to include 163 3′ half-genome sequences in order to increase the sensitivity of detection of low-frequency viral variants. Power calculations indicated that a sample size of 163 sequences gave us a >95% probability of sampling minor variants comprising as little as 2% of the virus population. By this approach, we found evidence of productive infection by at least 16 genetically distinct viruses (Fig. (Fig.2).2). Fourteen of these could be identified unambiguously based on the presence of discrete low-diversity viral lineages, each consisting of between 2 and 48 sequences. Two additional unique viral sequences with long branch lengths (3F8 and G10) exhibited diversity that was sufficiently great to indicate a distinct transmission event as opposed to divergence from other transmitted/founder lineages (see the legend to Fig. Fig.2).2). It is possible that still other unique sequences from this subject also represented transmitted/founder viruses, but we could not demonstrate this formally. We also could not determine if all 16 (or more) transmission events resulted from a single intravenous inoculation or from a series of inoculations separated by hours or days; however, it is likely that all transmitted viruses in this subject resulted from exposure to plasma from a single infected individual, since the maximum env diversity was only 3.34% (Fig. (Fig.1A).1A). It is also likely that transmission occurred within a brief window of time, since the period from transmission to the end of Fiebig stage III is typically only about 25 days (95% CI, 22 to 37 days) (18, 20) and the diversity observed in all transmitted/founder viral lineages in subject HDNDRPI034 was exceedingly low, consistent with model predictions for subjects with very recent infections (18, 20).Open in a separate windowFIG. 2.NJ tree and Highlighter plot of HIV-1 3′ half-genome sequences from subject HDNDRPI034. Sequences emanating from 16 transmitted/founder viruses are color coded. Fourteen transmitted/founder viral lineages comprised of 2 or more identical or nearly identical sequences could be readily distinguished from recombinant sequences (depicted in black), which invariably appeared as unique sequences containing interspersed segments shared with other transmitted/founder virus lineages. The two sequences with the longest branch lengths (3F8 and G10) were interpreted to represent rare progeny of discrete transmitted/founder viruses because their unique polymorphisms far exceeded the maximum diversity estimated to occur in the first 30 days of infection (0.22%; CI, 0.15 to 0.31%) (18) and far exceeded the diversity observed within the other transmitted/founder virus lineages. The horizontal scale bar represents genetic distance.Lastly, we compared the multiplicity of HIV-1 transmission in the Montreal IDU subjects with that of non-IDU subjects for whom identical SGA methods had been employed. In this combined-cohort analysis, we found the frequency of multiple-variant transmission in heterosexuals to be 19% (34 of 175) and in MSM 38% (19 of 50) (Table (Table2)2) (24). The current study was powered to detect a >2-fold difference in multivariant transmission between IDUs and heterosexual subjects; in fact, we observed a 3-fold-higher frequency of multiple-variant transmission in Montreal IDUs (6 of 10 subjects [60%]) than in heterosexuals (odds ratio, 6.14; 95% CI, 1.37 to 31.27; Fisher exact test, P = 0.008) and a 1.5-fold-higher frequency in Montreal IDUs than in MSM (odds ratio, 2.41; 95% CI, 0.50 to 13.20; P = 0.294, not significant). In addition, we found that the range of numbers of transmitted/founder viruses was greater in IDUs (range, 1 to 16 viruses; median, 3) than in either heterosexuals (range, 1 to 6 viruses; median, 1) or MSM (range, 1 to 10 viruses; median, 1). The finding of larger numbers of transmitted/founder viruses in IDUs was not simply the result of more intensive sampling, since the numbers of sequences analyzed in all studies were comparable. Moreover, it is notable that in studies reported elsewhere, we sampled as many as 239 sequences by SGA or as many as 500,000 sequences by 454 pyrosequencing from four acutely infected MSM subjects and in each case found evidence of productive clinical infection by only a single virus (24; W. Fischer, B. Keele, G. Shaw, and B. Korber, unpublished). These results thus suggest that IDUs may be infected by more viruses and by a greater range of viruses than is the case following mucosal transmission. On this count, our findings differ from those reported by Masharsky and coworkers for an IDU cohort from St. Petersburg, Russia (29). Their study found a low frequency of multiple virus transmissions (31%), not significantly different from that of acutely infected heterosexuals, and a low number of transmitted/founder viruses (range, 1 to 3 viruses; median, 1). Because the SGA methods employed in both studies were identical, the numbers of sequences analyzed per subject were comparable (median of 25 sequences in Montreal versus 33 in St. Petersburg), and because the discriminating power of the SGA-direct sequencing method was sufficient to distinguish transmitted/founder viruses differing by as few as 3 nucleotides, or <0.1% of nucleotides (Fig. (Fig.2,2, compare lineages V4 and V5), it is unlikely that differences in the genetic diversity of HIV-1 in the two IDU populations explain the differences in findings between the two studies. Instead, we suspect that the explanation lies in the small cohort sizes (10 versus 13 subjects) and the particular risk behaviors of the IDUs in each cohort. The Russian cohort is heavily weighted toward heroine use, whereas the Montreal cohort is weighted toward injection cocaine use, the latter being associated with more frequent drug administration and the attendant infection risks of needle sharing (4).
Open in a separate windowaFisher''s exact test of multiple-variant transmission in heterosexuals versus in IDUs.bFisher''s exact test of multiple-variant transmission in MSM versus in IDUs.The results from the present study indicate that transmission of HIV-1 to IDUs can be associated with a high frequency of multiple-variant transmission and a broad range in the numbers of transmitted viruses. This wide variation in the multiplicity of HIV-1 infection in IDUs is likely due to the absence of a mucosal barrier to virus transmission (12, 19) and differences in the virus inocula (27, 29, 32, 39). The findings substantiate concerns raised in recent HIV-1 vaccine efficacy trials that different vaccine candidates may be more efficacious in preventing infection by some exposure routes than by others (7, 10, 33, 37). They further suggest that biological comparisons of molecularly cloned transmitted/founder viruses responsible for vaginal, rectal, penile, and intravenous infection could facilitate a mechanistic understanding of HIV-1 transmission and vaccine prevention (24, 44). 相似文献
TABLE 1.
Subject demographics and HIV-1 envelope analysis resultsSubject identifier | Age (yr) | Sexa | Fiebig stage | Estimated no. of days postinfectionb | CD4 count | Plasma viral load (log) | No. of SGA amplicons | Diversity of env genes (%)c | No. of transmitted/ founder viruses | |||
---|---|---|---|---|---|---|---|---|---|---|---|---|
Mean | Interquartile range | Maximumd | Model predictione | Phylogenetic estimatef | ||||||||
HDNDRPI034 | 47 | M | III | 29 | 240 | 7.88 | 163 | 1.07 | 0.55 | 3.34 | >1 | 16 |
HDNDRPI029 | 18 | F | IV | 48 | 440 | 4.34 | 29 | 0.16 | 0.15 | 0.49 | 1 | 1 |
HTM385 | 24 | M | V | 62 | 406 | 5.37 | 22 | 0.12 | 0.08 | 0.27 | 1 | 1 |
CQLDR03 | 42 | M | V | 66 | NDg | 5.01 | 21 | 0.08 | 0.08 | 0.23 | 1 | 1 |
HDNDRPI001 | 36 | M | V | 28 | 690 | 5.94 | 25 | 0.90 | 0.63 | 1.91 | >1 | 5 |
HTM319 | 39 | M | V | 68 | 520 | 4.43 | 25 | 0.77 | 0.46 | 1.54 | >1 | 3 |
HDNDRPI032 | 37 | M | V | 73 | 1,040 | 3.53 | 19 | 1.48 | 2.99 | 3.34 | >1 | 3 |
ACTDM580208 | 39 | M | VI | 93 | 387 | 4.53 | 30 | 1.17 | 0.97 | 2.64 | >1 | 3 |
ACT54869022 | 28 | M | VI | 68 | 723 | 3.43 | 27 | 0.07 | 0.04 | 0.24 | 1 | 1 |
PSL024 | 46 | M | VI | 82 | 340 | 4.46 | 21 | 0.82 | 0.63 | 1.57 | >1 | 3 |
TABLE 2.
Multiplicity of HIV-1 infection in IDU, heterosexual, and MSM subjectsCohort | Reference | Virus subtype | Total no. of subjects | Single-variant transmission | Multiple-variant transmission | P value | Odds ratio | 95% CI | Median | Range | ||
---|---|---|---|---|---|---|---|---|---|---|---|---|
No. of subjects | % of total | No. of subjects | % of total | |||||||||
Heterosexuals | Keele et al. (18) | B | 79 | 65 | 82.30 | 14 | 17.70 | 1 | 1-4 | |||
Abrahams et al. (1) | C | 69 | 54 | 78.30 | 15 | 21.70 | 1 | 1-5 | ||||
Haaland et al. (13) | A or C | 27 | 22 | 81.50 | 5 | 18.50 | 1 | 1-6 | ||||
Total | 175 | 141 | 80.60 | 34 | 19.40 | 0.008a | 6.14 | 1.37-31.27 | 1 | 1-6 | ||
MSM | Keele et al. (18) | B | 22 | 13 | 59.10 | 9 | 40.90 | 1 | 1-6 | |||
Li et al. (24) | B | 28 | 18 | 64.30 | 10 | 35.70 | 1 | 1-10 | ||||
Total | 50 | 31 | 62.00 | 19 | 38.00 | 0.294b | 2.41 | 0.50-13.20 | 1 | 1-10 | ||
IDUs | Bar | B | 10 | 4 | 40.00 | 6 | 60.00 | 3 | 1-16 |
14.
15.
Andrew D. Morgan R. Craig MacLean Kristina L. Hillesland Gregory J. Velicer 《Applied and environmental microbiology》2010,76(20):6920-6927
Predator-prey relationships among prokaryotes have received little attention but are likely to be important determinants of the composition, structure, and dynamics of microbial communities. Many species of the soil-dwelling myxobacteria are predators of other microbes, but their predation range is poorly characterized. To better understand the predatory capabilities of myxobacteria in nature, we analyzed the predation performance of numerous Myxococcus isolates across 12 diverse species of bacteria. All predator isolates could utilize most potential prey species to effectively fuel colony expansion, although one species hindered predator swarming relative to a control treatment with no growth substrate. Predator strains varied significantly in their relative performance across prey types, but most variation in predatory performance was determined by prey type, with Gram-negative prey species supporting more Myxococcus growth than Gram-positive species. There was evidence for specialized predator performance in some predator-prey combinations. Such specialization may reduce resource competition among sympatric strains in natural habitats. The broad prey range of the Myxococcus genus coupled with its ubiquity in the soil suggests that myxobacteria are likely to have very important ecological and evolutionary effects on many species of soil prokaryotes.Predation plays a major role in shaping both the ecology and evolution of biological communities. The population and evolutionary dynamics of predators and their prey are often tightly coupled and can greatly influence the dynamics of other organisms as well (1). Predation has been invoked as a major cause of diversity in ecosystems (11, 12). For example, predators may mediate coexistence between superior and inferior competitors (2, 13), and differential trajectories of predator-prey coevolution can lead to divergence between separate populations (70).Predation has been investigated extensively in higher organisms but relatively little among prokaryotes. Predation between prokaryotes is one of the most ancient forms of predation (27), and it has been proposed that this process may have been the origin of eukaryotic cells (16). Prokaryotes are key players in primary biomass production (44) and global nutrient cycling (22), and predation of some prokaryotes by others is likely to significantly affect these processes. Most studies of predatory prokaryotes have focused on Bdellovibrionaceae species (e.g., see references 51, 55, and 67). These small deltaproteobacteria prey on other Gram-negative cells, using flagella to swim rapidly until they collide with a prey cell. After collision, the predator cells then enter the periplasmic space of the prey cell, consume the host cell from within, elongate, and divide into new cells that are released upon host cell lysis (41). Although often described as predatory, the Bdellovibrionaceae may also be considered to be parasitic, as they typically depend (apart from host-independent strains that have been observed [60]) on the infection and death of their host for their reproduction (47).In this study, we examined predation among the myxobacteria, which are also deltaproteobacteria but constitute a monophyletic clade divergent from the Bdellovibrionaceae (17). Myxobacteria are found in most terrestrial soils and in many aquatic environments as well (17, 53, 74). Many myxobacteria, including the model species Myxococcus xanthus, exhibit several complex social traits, including fruiting body formation and spore formation (14, 18, 34, 62, 71), cooperative swarming with two motility systems (64, 87), and group (or “wolf pack”) predation on both bacteria and fungi (4, 5, 8, 9, 15, 50). Using representatives of the genus Myxococcus, we tested for both intra- and interspecific variation in myxobacterial predatory performance across a broad range of prey types. Moreover, we examined whether prey vary substantially in the degree to which they support predatory growth by the myxobacteria and whether patterns of variation in predator performance are constant or variable across prey environments. The latter outcome may reflect adaptive specialization and help to maintain diversity in natural populations (57, 59).Although closely related to the Bdellovibrionaceae (both are deltaproteobacteria), myxobacteria employ a highly divergent mode of predation. Myxobacteria use gliding motility (64) to search the soil matrix for prey and produce a wide range of antibiotics and lytic compounds that kill and decompose prey cells and break down complex polymers, thereby releasing substrates for growth (66). Myxobacterial predation is cooperative both in its “searching” component (6, 31, 82; for details on cooperative swarming, see reference 64) and in its “handling” component (10, 29, 31, 32), in which secreted enzymes turn prey cells into consumable growth substrates (56, 83). There is evidence that M. xanthus employs chemotaxis-like genes in its attack on prey cells (5) and that predation is stimulated by close contact with prey cells (48).Recent studies have revealed great genetic and phenotypic diversity within natural populations of M. xanthus, on both global (79) and local (down to centimeter) scales (78). Phenotypic diversity includes variation in social compatibility (24, 81), the density and nutrient thresholds triggering development (33, 38), developmental timing (38), motility rates and patterns (80), and secondary metabolite production (40). Although natural populations are spatially structured and both genetic diversity and population differentiation decrease with spatial scale (79), substantial genetic diversity is present even among centimeter-scale isolates (78). No study has yet systematically investigated quantitative natural variation in myxobacterial predation phenotypes across a large number of predator genotypes.Given the previous discovery of large variation in all examined phenotypes, even among genetically extremely similar strains, we anticipated extensive predatory variation as well. Using a phylogenetically broad range of prey, we compared and contrasted the predatory performance of 16 natural M. xanthus isolates, sampled from global to local scales, as well as the commonly studied laboratory reference strain DK1622 and representatives of three additional Myxococcus species: M. flavescens (86), M. macrosporus (42), and M. virescens (63) (Table (Table1).1). In particular, we measured myxobacterial swarm expansion rates on prey lawns spread on buffered agar (31, 50) and on control plates with no nutrients or with prehydrolyzed growth substrate.
Open in a separate window 相似文献
TABLE 1.
List of myxobacteria used, with geographical originOrganism abbreviation used in text | Species | Strain | Geographic origin | Reference(s) |
---|---|---|---|---|
A9 | Myxococcus xanthus | A9 | Tübingen, Germany | 78 |
A23 | Myxococcus xanthus | A23 | Tübingen, Germany | 78 |
A30 | Myxococcus xanthus | A30 | Tübingen, Germany | 78 |
A41 | Myxococcus xanthus | A41 | Tübingen, Germany | 78 |
A46 | Myxococcus xanthus | A46 | Tübingen, Germany | 78 |
A47 | Myxococcus xanthus | A47 | Tübingen, Germany | 78 |
A75 | Myxococcus xanthus | A75 | Tübingen, Germany | 78 |
A85 | Myxococcus xanthus | A85 | Tübingen, Germany | 78 |
TV | Myxococcus xanthus | Tvärminne | Tvärminne, Finland | 79 |
PAK | Myxococcus xanthus | Paklenica | Paklenica, Croatia | 79 |
MAD | Myxococcus xanthus | Madeira 1 | Madeira, Portugal | 79 |
WAR | Myxococcus xanthus | Warwick 1 | Warwick, UK | 79 |
TOR | Myxococcus xanthus | Toronto 1 | Toronto, Ontario, Canada | 79 |
SUL2 | Myxococcus xanthus | Sulawesi 2 | Sulawesi, Indonesia | 79 |
KAL | Myxococcus xanthus | Kalalau | Kalalau, HI | 79 |
DAV | Myxococcus xanthus | Davis 1A | Davis, CA | 79 |
GJV1 | Myxococcus xanthus | GJV 1 | Unknown | 35, 72 |
MXFL1 | Myxococcus flavescens | Mx fl1 | Unknown | 65 |
MXV2 | Myxococcus virescens | Mx v2 | Unknown | 65 |
CCM8 | Myxococcus macrosporus | Cc m8 | Unknown | 65 |
16.
17.
18.
19.