Triple helix-forming oligonucleotides conjugated to indolocarbazole poisons direct topoisomerase I-mediated DNA cleavage to a specific site.

Topoisomerase I is an ubiquitous DNA-cleaving enzyme and an important therapeutic target in cancer chemotherapy for camptothecins as well as for indolocarbazole antibiotics such as rebeccamycin. To achieve a sequence-specific cleavage of DNA by topoisomerase I, a triple helix-forming oligonucleotide was covalently linked to indolocarbazole-type topoisomerase I poisons. The three indolocarbazole-oligonucleotide conjugates investigated were able to direct topoisomerase I cleavage at a specific site based upon sequence recognition by triplex formation. The efficacy of topoisomerase I-mediated DNA cleavage depends markedly on the intrinsic potency of the drug. We show that DNA cleavage depends also upon the length of the linker arm between the triplex-forming oligonucleotide and the drug. Based on a known structure of the DNA-topoisomerase I complex, a molecular model of the oligonucleotide conjugates bound to the DNA-topoisomerase I complex was elaborated to facilitate the design of a potent topoisomerase I inhibitor-oligonucleotide conjugate with an optimized linker between the two moieties. The resulting oligonucleotide-indolocarbazole conjugate at 10 nM induced cleavage at the triple helix site 2-fold more efficiently than 5 microM of free indolocarbazole, while the other drug-sensitive sites were not cleaved. The rational design of drug-oligonucleotide conjugates carrying a DNA topoisomerase poison may be exploited to improve the efficacy and selectivity of chemotherapeutic cancer treatments by targeting specific genes and reducing drug toxicity.     

Recognition and cleavage of DNA by rebeccamycin- or benzopyridoquinoxaline conjugated of triple helix-forming oligonucleotides

Indolocarbazole and benzopyridoquinoxaline derivatives have been shown to have anti-tumor activity and to stimulate DNA topoisomerase I-mediated cleavage. Two indolocarbazole compounds (R-6 and R-95) and one benzopyridoquinoxaline derivative (BPQ(1256)) were covalently attached to the 3'-end of a 16mer triple helix-forming oligonucleotide (TFO). These conjugates bind to DNA with a higher affinity than the unsubstituted oligonucleotides. Furthermore, they induce topoisomerase I-mediated and triplex-directed DNA cleavage in a sequence-specific manner.     

The camptothecin-resistant topoisomerase I mutant F361S is cross-resistant to antitumor rebeccamycin derivatives. A model for topoisomerase I inhibition by indolocarbazoles.

DNA topoisomerase I is a major cellular target for antitumor indolocarbazole derivatives (IND) such as the antibiotic rebeccamycin and the synthetic analogue NB-506 which is undergoing phase I clinical trials. We have investigated the mechanism of topoisomerase I inhibition by a rebeccamycin analogue, R-3, using the wild-type human topoisomerase I and a well-characterized recombinant enzyme, F361S. The catalytic activity of this mutant remains fully intact, but the enzyme is resistant to inhibition by camptothecin (CPT). Here we show that the mutated enzyme is cross-resistant to the rebeccamycin analogue. Despite their profound structural differences, CPT and R-3 interfere similarly with the activity of the wild-type and mutant topoisomerase I enzymes, and the drug-induced cleavable complexes are equally sensitive to the NaCl concentration. CPT and IND likely recognize identical structural elements of the topoisomerase I-DNA covalent complex; however, differences do exist in terms of sequence-specificity of topoisomerase I-mediated DNA cleavage. For the first time, a molecular model showing that CPT and IND share common steric and electronic features is proposed. The model helps to identify a specific pharmacophore for topoisomerase I inhibitors.     

Induction of mammalian DNA topoisomerase I mediated DNA cleavage by antitumor indolocarbazole derivatives.

DNA topoisomerases have been shown to be important therapeutic targets in cancer chemotherapy. We found that KT6006 and KT6528, synthetic antitumor derivatives of indolocarbazole antibiotic K252a, were potent inducers of a cleavable complex with topoisomerase I. In DNA cleavage assay using purified calf thymus DNA topoisomerase I and supercoiled pBR322 DNA, KT6006 induced topoisomerase I mediated DNA cleavage in a dose-dependent manner at drug concentrations up to 50 microM, while DNA cleavage induced by KT6528 was saturated at 5 microM. The maximal amount of nicked DNA produced by KT6006 was more than 50% of substrate DNA, which was comparable to that of camptothecin. Heat treatment (65 degrees C) of the reaction mixture containing these compounds and topoisomerase I resulted in a substantial reduction in DNA cleavage, suggesting that topoisomerase I mediated DNA cleavage induced by KT6006 and KT6528 is through the mechanism of stabilizing the reversible enzyme-DNA "cleavable complex". Both KT6006 and KT6528 did not induce topoisomerase II mediated DNA cleavage in vitro. KT6006 and KT6528 were found to induce nearly identical topoisomerase I mediated DNA cleavage patterns, which was distinctly different from that with camptothecin. In contrast to the similarity between KT6006 and KT6528 in their structures and the nature of their cleavable complex with topoisomerase I, these drugs have different properties with respect to their interaction with DNA: KT6006 is a very weak intercalator whereas KT6528 is a strong intercalator with potentials comparable to that of adriamycin. These results indicate that KT6006 and KT6528 represent a new distinct class of mammalian DNA topoisomerase I active antitumor drugs.     

Linkage of a triple helix-forming oligonucleotide to amsacrine-4-carboxamide derivatives modulates the sequence-selectivity of topoisomerase II-mediated DNA cleavage

Amsacrine-4-carboxamide-oligonucleotide conjugates were synthesized and studied for their capacity to form DNA triple helices and to alter human topoisomerase II binding and cleavage properties. The intercalating agent was attached to the 3'- or the 5'-end of a 24 nt triple helix-forming oligonucleotide via linkers of different lengths. The stability of these DNA triple helices was investigated by gel retardation and melting temperature studies using a synthetic 70 bp DNA duplex target. The effect of the conjugates on DNA cleavage by topoisomerase II was evaluated using the 70 bp duplex and a 311 bp restriction fragment containing the same triple helix site. The conjugate with the amsacrine derivative linked to the 3' end of the TFO via a hexaethylene glycol linker modulates the extent of DNA cleavage by topoisomerase II at specific sites.     

Linkage of a Triple Helix-Forming Oligonucleotide to Amsacrine-4-carboxamide Derivatives Modulates the Sequence-Selectivity of Topoisomerase II-Mediated DNA Cleavage

Abstract

Amsacrine-4-carboxamide-oligonucleotide conjugates were synthesized and studied for their capacity to form DNA triple helices and to alter human topoisomerase II binding and cleavage properties. The intercalating agent was attached to the 3′- or the 5′-end of a 24 nt triple helix-forming oligonucleotide via linkers of different lengths. The stability of these DNA triple helices was investigated by gel retardation and melting temperature studies using a synthetic 70 bp DNA duplex target. The effect of the conjugates on DNA cleavage by topoisomerase II was evaluated using the 70 bp duplex and a 311 bp restriction fragment containing the same triple helix site. The conjugate with the amsacrine derivative linked to the 3′ end of the TFO via a hexaethylene glycol linker modulates the extent of DNA cleavage by topoisomerase II at specific sites.     

New technique for uncoupling the cleavage and religation reactions of eukaryotic topoisomerase I. The mode of action of camptothecin at a specific recognition site.

A new technique for uncoupling the cleavage and religation half-reactions of topoisomerase I at a specific site has been developed. The technique takes advantage of a suicidal DNA substrate to attain enzyme-mediated cleavage without concomitant religation. Efficient religation can be achieved, subsequently, by addition of an oligonucleotide capable of hybridising to the non-cleaved strand of the suicide DNA substrate. The technique was used to study the effect of different compounds on the half-reactions of topoisomerase I. It was shown that topoisomerase I-mediated cleavage was inhibited by NaCl concentrations higher than 200 mM, while the religation reaction seemed unaffected by concentrations as high as 3 M-NaCl. The divalent cations Mg2+, Ca2+ and Mn2+ were found to enhance the cleavage but not the religation reaction of topoisomerase I, whereas Cu2+ and Zn2+ inhibited both reactions. Furthermore, the effect of the anti-neoplastic agent, camptothecin, on the half-reactions of topoisomerase I was investigated. It was found that the drug did not affect the cleavage reaction of topoisomerase I at the studied site, while the religation reaction of the enzyme was inhibited. Camptothecin was found to stabilise the enzyme-DNA cleavage complex even when the drug was added after complex formation.     

PSF/p54(nrb) stimulates "jumping" of DNA topoisomerase I between separate DNA helices

We have previously shown [Straub et al. (1998) J. Biol. Chem. 273, 26261] that the pyrimidine tract binding protein associated splicing factor PSF/p54(nrb) binds and stimulates DNA topoisomerase I. Here we show that cleavage and religation half-reactions of topoisomerase I are unaffected by PSF/p54(nrb), whereas the propensity of the enzyme to jump between separate DNA helices is stimulated. To demonstrate such an effect, topoisomerase I was first captured in suicidal cleavage of an oligonucleotide substrate. Subsequently, a cleavage/ligation equilibrium was established by adding a ligation donor under conditions allowing recleavage of the ligated substrate. Finally, a second oligonucleotide was added to the mixture, which also allowed suicidal cleavage by topoisomerase I, but did not accommodate the ligation donor of the first oligonucleotide. Thus, topoisomerase I was given the choice to engage in repeated cleavage/ligation cycles of the first oligonucleotide or to jump to the second suicide substrate and get trapped. PSF/p54(nrb) enhanced the cleavage rate of the second oligonucleotide (11-fold), suggesting that it stimulates the dissociation of topoisomerase I after ligation. Thus, stimulation of topoisomerase I catalysis by PSF/p54(nrb) seems to be affected by mobilization of the enzyme.     

Design and optimization of camptothecin conjugates of triple helix-forming oligonucleotides for sequence-specific DNA cleavage by topoisomerase I.

To achieve a sequence-specific DNA cleavage by topoisomerase I, derivatives of the antitumor drug camptothecin have been covalently linked to triple helix-forming oligonucleotides that bind in a sequence-specific manner to the major groove of double-helical DNA. Triplex formation at the target sequence positions the drug selectively at the triplex site, thereby stimulating topoisomerase I-mediated DNA cleavage at this site. In a continuous effort to optimize this strategy, a broad set of conjugates consisting of (i) 16-20-base-long oligonucleotides, (ii) alkyl linkers of variable length, and (iii) camptothecin derivatives substituted on the A or B quinoline ring were designed and synthesized. Analysis of the cleavage sites at nucleotide resolution reveals that the specificity and efficacy of cleavage depends markedly on the length of both the triple-helical structure and the linker between the oligonucleotide and the poison. The optimized hybrid molecules induced strong and highly specific cleavage at a site adjacent to the triplex. Furthermore, the drug-stabilized DNA-topoisomerase I cleavage complexes were shown to be more resistant to salt-induced reversal than the complexes induced by camptothecin alone. Such rationally designed camptothecin conjugates could provide useful antitumor drugs directed selectively against genes bearing the targeted triplex binding site. In addition, they represent a powerful tool to probe the molecular interactions in the DNA-topoisomerase I complex.     

Effect of local DNA sequence on topoisomerase I cleavage in the presence or absence of camptothecin.

In order to investigate the mechanism of topoisomerase I inhibition by camptothecin, we studied the induction of DNA cleavage by purified mammalian DNA topoisomerase I in a series of oligonucleotides and analyzed the DNA sequence locations of preferred cleavage sites in the SV40 genome. The oligonucleotides were derived from the sequence of the major camptothecin-induced cleavage site in SV40 DNA (Jaxel, C., Kohn, K. W., and Pommier, Y. (1988) Nucleic Acids Res. 16, 11157 to 11170) with the cleaved bond in their center. DNA length was critical since cleavage was detectable only in 30 and 20 base pair-(bp) oligonucleotides, but not in a 12-bp oligonucleotide. Cleavage was at the same position in the oligonucleotides as in SV40 DNA. Its intensity was greater in the 30- than in the 20-bp oligonucleotide, indicating that sequences more than 10 bp away from the cleavage site may influence intensity. Camptothecin-induced DNA cleavage required duplex DNA since none of the single-stranded oligonucleotides were cleaved. Analysis of base preferences around topoisomerase I cleavage sites in SV40 DNA indicated that camptothecin stabilized topoisomerase I preferentially at sites having a G immediately 3' to the cleaved bond. Experiments with 30-bp oligonucleotides showed that camptothecin produced most intense cleavage in a complementary duplex having a G immediately 3' to the cleavage site. Weaker cleavage was observed in a complementary duplex in which the 3'G was replaced with a T. The identity of the 3' base, however, did not affect topoisomerase I-induced DNA cleavage in the absence of drug. These results indicate that camptothecin traps preferentially a subset of the enzyme cleavage sites, those having a G immediately 3' to the cleaved bond. This strong preference suggests that camptothecin binds reversibly to the DNA at topoisomerase I cleavage sites, in analogy to a model previously proposed for inhibitors of topoisomerase II (Capranico, G., Kohn, K.W., and Pommier, Y. (1990) Nucleic Acids Res. 18, 6611-6619).     

Mechanistic study of E. coli DNA topoisomerase I: cleavage of oligonucleotides.

E. coli DNA topoisomerase I catalyzes DNA topoisomerization by transiently breaking and rejoining single DNA strands (1). When an enzyme-DNA incubation mixture is treated with alkaline or detergent, DNA strand cleavage occurs, and the enzyme becomes covalently linked to the 5'-phosphoryl end of the cleaved DNA (2). Using oligonucleotides of defined length and sequence composition, this cleavage reaction is utilized to study the mechanism of E. coli DNA topoisomerase I. dA7 is the shortest oligonucleotide tested that can be cleaved by the enzyme. dT8 is the shortest oligo(dT) that can be cleaved. The site of cleavage in both cases is four nucleotides from the 3' end of the oligonucleotide. No cleavage can be observed for oligo(dC) and oligo(dG) of length up to eleven bases long. dC15 and dC16 are cleaved at one tenth or less the efficiency of oligo(dA) and oligo(dT) of comparable length.     

Inhibition of Mycobacterium smegmatis topoisomerase I by specific oligonucleotides

DNA topoisomerase I from Mycobacterium smegmatis unlike many other type I topoisomerases is a site specific DNA binding protein. We have investigated the sequence specific DNA binding characteristics of the enzyme using specific oligonucleotides of varied length. DNA binding, oligonucleotide competition and covalent complex assays show that the substrate length requirement for interaction is much longer ( approximately 20 nucleotides) in contrast to short length substrates (eight nucleotides) reported for Escherichia coli topoisomerase I and III. P1 nuclease and KMnO(4) footprinting experiments indicate a large protected region spanning about 20 nucleotides upstream and 2-3 nucleotides downstream of the cleavage site. Binding characteristics indicate that the enzyme interacts efficiently with both single-stranded and double-stranded substrates containing strong topoisomerase I sites (STS), a unique property not shared by any other type I topoisomerase. The oligonucleotides containing STS effectively inhibit the M. smegmatis topoisomerase I DNA relaxation activity.     

Oligodeoxynucleotide-directed photo-induced cross-linking of HIV proviral DNA via triple-helix formation.

The HIV proviral genome contains two copies of a 16 bp homopurine.homopyrimidine sequence which overlaps the recognition and cleavage site of the Dra I restriction enzyme. Psoralen was attached to the 16-mer homopyrimidine oligonucleotide, d5'(TTTTCT-TTTCCCCCCT)3', which forms a triple helix with this HIV proviral sequence. Two plasmids, containing part of the HIV proviral DNA, with either one (pLTR) or two (pBT1) copies of the 16-bp homopurine.homopyrimidine sequence and either 4 or 14 Dra I cleavage sites, respectively, were used as substrates for the psoralen-oligonucleotide conjugate. Following UV irradiation the two strands of the DNA targeted sequence were cross-linked at the triplex-duplex junction. The psoralen-oligonucleotide conjugate selectively inhibited Dra I enzymatic cleavage at sites overlapping the two triple helix-forming sequences. A secondary triplex-forming site of 8 contiguous base pairs was observed on the pBT1 plasmid when binding of the 16 base-long oligonucleotide was allowed to take place at high oligonucleotide concentrations. Replacement of a stretch of six cytosines in the 16-mer oligomer by a stretch of six guanines increased binding to the primary sites and abolished binding to the secondary site under physiological conditions. These results demonstrate that oligonucleotides can be designed to selectively recognize and modify specific sequences in HIV proviral DNA.     

A role for the passage helix in the DNA cleavage reaction of eukaryotic topoisomerase II. A two-site model for enzyme-mediated DNA cleavage.

Eukaryotic topoisomerase II is capable of binding two separate nucleic acid helices prior to its DNA cleavage and strand passage events (Zechiedrich, E. L., and Osheroff, N (1990) EMBO J. 9, 4555-4562). Presumably, one of these helices represents the helix that the enzyme cleaves (i.e. cleavage helix), and the other represents the helix that it passes (i.e. passage helix) through the break in the nucleic acid backbone. To determine whether the passage helix is required for reaction steps that precede the enzyme's DNA strand passage event, interactions between Drosophila melanogaster topoisomerase II and a short double-stranded oligonucleotide were assessed. These studies employed a 40-mer that contained a specific recognition/cleavage site for the enzyme. The sigmoidal DNA concentration dependence that was observed for cleavage of the 40-mer indicated that topoisomerase II had to interact with more than a single oligonucleotide in order for cleavage to take place. Despite this requirement, results of enzyme DNA binding experiments indicated no binding cooperativity for the 40-mer. These findings strongly suggest a two-site model for topoisomerase II action in which the passage and the cleavage helices bind to the enzyme independently, but the passage helix must be present for efficient topoisomerase II-mediated DNA cleavage to occur.     

Conjugated eicosapentaenoic acid inhibits human topoisomerase IB with a mechanism different from camptothecin

Conjugated eicosapentaenoic acid (cEPA) has been found to have antitumor effects which has been ascribed to their ability to inhibit DNA topoisomerases and DNA polymerases. We here show that cEPA inhibits the catalytic activity of human topoisomerase I, but unlike camptothecin it does not stabilize the cleavable complex, indicating a different mechanism of action. cEPA inhibits topoisomerase by impeding the catalytic cleavage of the DNA substrate as demonstrated using specific oligonucleotide substrates, and prevents the stabilization of the cleavable complex by camptothecin. Preincubation of the inhibitor with the enzyme is required to obtain complete inhibition. Molecular docking simulations indicate that the preferred cEPA binding site is proximal to the active site with the carboxylic group strongly interacting with the positively charged K443 and K587. Taken together the results indicate that cEPA inhibitor does not prevent DNA binding but inhibits DNA cleavage, binding in a region close to the topoisomerase active site.     

Characterization of an altered DNA catalysis of a camptothecin-resistant eukaryotic topoisomerase I.

We investigated topoisomerase I activity at a specific camptothecin-enhanced cleavage site by use of a partly double-stranded DNA substrate. The cleavage site belongs to a group of DNA topoisomerase I sites which is only efficiently cleaved by wild-type topoisomerase I (topo I-wt) in the presence of camptothecin. With a mutated camptothecin-resistant form of topoisomerase I (topo I-K5) previous attempts to reveal cleavage activity at this site have failed. On this basis it was questioned whether the mutant enzyme has an altered DNA sequence recognition or a changed rate of catalysis at the site. Utilizing a newly developed assay system we demonstrate that topo I-K5 not only recognizes and binds to the strongly camptothecin-enhanced cleavage site but also has considerable cleavage/religation activity at this particular DNA site. Thus, topo I-K5 has a 10-fold higher rate of catalysis and a 10-fold higher affinity for DNA relative to topo I-wt. Our data indicate that the higher cleavage/religation activity of topo I-K5 is a result of improved DNA binding and a concomitant shift in the equilibrium between cleavage and religation towards the religation step. Thus, a recently identified point mutation which characterizes the camptothecin-resistant topo I-K5 has altered the enzymatic catalysis without disturbing the DNA sequence specificity of the enzyme.     

Sequence specificity of DNA topoisomerase I in the presence and absence of camptothecin.

Previously, we have demonstrated that in Tetrahymena DNA topoisomerase I has a strong preference in situ for a hexadecameric sequence motif AAGACTTAGAAGAAAAAATTT present in the non-transcribed spacers of r-chromatin. Here we characterize more extensively the interaction of purified topoisomerase I with specific hexadecameric sequences in cloned DNA. Treatment of topoisomerase I-DNA complexes with strong protein denaturants results in single strand breaks and covalent linkage of DNA to the 3' end of the broken strand. By mapping the position of the resulting nicks, we have analysed the sequence-specific interaction of topoisomerase I with the DNA. The experiments demonstrate that: the enzyme cleaves specifically between the sixth and seventh bases in the hexadecameric sequence; a single base substitution in the recognition sequence may reduce the cleavage extent by 95%; the sequence specific cleavage is stimulated 8-fold by divalent cations; 30% of the DNA molecules are cleaved at the hexadecameric sequence while no other cleavages can be detected in the 1.6-kb fragment investigated; the sequence specific cleavage is increased 2- to 3-fold in the presence of the antitumor drug camptothecin; at high concentrations of topoisomerase I, the cleavage pattern is altered by camptothecin; the equilibrium dissociation constant for interaction of topoisomerase I and the hexadecameric sequence can be estimated as approximately 10(-10) M.     

Zinc (II) coordination in Escherichia coli DNA topoisomerase I is required for cleavable complex formation with DNA.

Escherichia coli DNA topoisomerase I catalyzes relaxation of negatively supercoiled DNA. The reaction proceeds through a covalent intermediate, the cleavable complex, in which the DNA is cleaved and the enzyme is linked to the DNA via a phosphotyrosine linkage. Each molecule of E. coli DNA topoisomerase I has been shown to have three tightly bound zinc(II) ions required for relaxation activity (Tse-Dinh, Y.-C., and Beran-Steed, R.K. (1988) J. Biol. Chem. 263, 15857-15859). It is shown here that Cd(II) could replace Zn(II) in reconstitution of active enzyme from apoprotein. The role of metal was analyzed by studying the partial reactions. The apoenzyme was deficient in sodium dodecyl sulfate-induced cleavage of supercoiled PM2 phage DNA. Formation of covalent complex with linear single-stranded DNA was also reduced in the absence of metal. However, the cleavage of small oligonucleotide was not affected, and the apoenzyme could religate the covalently bound oligonucleotide to another DNA molecule. Assay of noncovalent complex formation by retention of 5'-labeled DNA on filters showed that the apoenzyme was not inhibited in noncovalent binding to DNA. It is proposed that zinc(II) coordination in E. coli DNA topoisomerase I is required for the transition of the noncovalent complex with DNA to the cleavable state.     

Spatial organization of topoisomerase I-mediated DNA cleavage induced by camptothecin-oligonucleotide conjugates

Triple helix-forming oligonucleotides covalently linked to topoisomerase I inhibitors, in particular the antitumor agent camptothecin, trigger topoisomerase I-mediated DNA cleavage selectively in the proximity of the binding site of the oligonucleotide vector. In the present study, we have performed a systematic analysis of the DNA cleavage efficiency as a function of the positioning of the camptothecin derivative, either on the 3′ or the 5′ side of the triplex, and the location of the cleavage site. A previously identified cleavage site was inserted at different positions within two triplex site-containing 59 bp duplexes. Sequence-specific DNA cleavage by topoisomerase I occurs only with triplex conjugates bearing the inhibitor at the 3′-end of the oligonucleotide and on the oligopyrimidine strand of the duplex. The lack of targeted cleavage on the 5′ side is attributed to the structural differences of the 3′ and 5′ duplex–triplex DNA junctions. The changes induced in the double helix by the triple-helical structure interfere with the action of the enzyme according to a preferred spatial organization. Camptothecin conjugates of oligonucleotides provide efficient tools to probe the organization of the topoisomerase I–DNA complex and will be useful to understand the functioning of topoisomerase I in living cells.