Identification of a glucocorticoid response element in the 3'-flanking region of the human Dexras1 gene

The Dexras1 gene responds to glucocorticoids with a rapid and profound induction. A glucocorticoid response element (GRE) was identified in the 3'-flanking region (2.3 kb downstream of poly(A) signal) of the human Dexras1 gene. This element conferred rapid glucocorticoid responsiveness when inserted into a homologous promoter-driven luciferase reporter. A point mutation within the 15-bp GRE abolished this glucocorticoid responsiveness.     

Identification of a Vitamin D response element in the human insulin receptor gene promoter

The present study was designed to explore the possible presence and location of Vitamin D response elements (VDREs) in the human insulin receptor (hIR) gene promoter. To this end, the -1819 to -271 bp fragment of the hIR promoter (wild type promoter) and progressive 5' deletions of this promoter (up to -1473 and -876 bp) were linked to the luciferase pGL2-basic vector to construct the reported plasmids: phIR (-1819)-GL2, phIR(-1473)-GL2 and phIR(-876)-GL2, respectively. U-937 cells were transiently transfected with these plasmids, and then the cells were either untreated or treated for 24h with 10(-8) M 1,25-dihydroxyvitamin D(3) (1,25D(3)). Luciferase determinations revealed that, while the activity of the wild promoter was increased 1.6-fold by the hormone, the activities of progressive 5' deletions of this promoter were enhanced 1.7-, and 1.6-fold, respectively. Thus, the region extending from -876 to -271bp of the hIR promoter, appears to contain VDREs, and to be sufficient for induction by 1,25D(3). In order to identify these potential VDREs, we performed a computer search of candidate sequences by homology with a consensus VDRE sequence. This search yielded a sequence located between -761 and -732 bp (5'CGTCGGGCCTGTGGGGCGCCTCCGGGGGTC3'), which includes an overlapping AP-2 like sequence, as a good candidate. Electrophoretic mobility shift assays revealed that the Vitamin D receptor (VDR) specifically recognized this sequence, since a VDR-DNA complex was able to compete with the unlabeled probe and was cleared by the specific anti-VDR antibody 9A7. These data represent the first identification of a VDRE in the hIR gene promoter.     

Identification of protein contact sites within the glucocorticoid/progestin response element

The glucocorticoid receptor (GR) and the progestin receptor (PR) bind specifically to a variety of DNA sequences, glucocorticoid/progestin response elements (GRE/PRE), located in the proximity of responsive gene promoters. Using the isolated recombinant GR DNA-binding domain (DBD), it has recently been shown that GR interacts with the GRE/PRE, a 15-basepair partially palindromic consensus sequence, as a dimer. In this study an investigation into the GR-GRE/PRE and PR-GRE/PRE interaction has been performed using missing base contact analysis with the tyrosine aminotransferase GREII (TATII) and recombinant GR DBD as well as a fusion protein consisting of the PR DBD fused to Staph. aureus protein-A. GR and PR had identical base contact points, localized within two consecutive major grooves, binding to the same face of the DNA. Ethylation interference was also performed on the GR DBD-TATII interaction. The contact points with the backbone phosphate groups flank the contacts within the major groove for each of the two half-sites. Knowledge of the contact points within the DNA sequence together with the three-dimensional structure of the protein enables modelling of the protein-DNA interaction.