Cladistic analysis of 5S rRNA and 16S rRNA secondary and primary structure—The evolution of eukaryotes and their relation to archaebacteria

Summary The secondary structure of 5S rRNA has been elucidated by a cladistic analysis resulting in minimal models for eukaryotes, eubacteria, and halophilic-methanogenic archaebacteria, as well as for an ur-5S rRNA. This ancestor of all present-day 5S rRNA molecules is compared with an ur-tRNA and can be fitted into a tRNA-like structure allowing tertiary-structure interactions at the equivalent positions. A phylogenetic analysis of eukaryotic 5SrRNA and 16S rRNA sequences confirms particular monophyletic taxa: rhodophytes (red algae), chlorobionts (green algae and plants), metazoans (multicellular animals), euglenozoans (euglenids and trypanosomatids), a group of zygomycetes (excluding Kickxellales), a group of ascomycetes (excluding Protomycetales), two distinct groups of basidiomycetes, and a group consisting of phaeophyceans (brown algae) and oomycetes (water molds). The Euglenozoa show a distinct relation to the Eumycota (true fungi) and Metazoa. An analysis of archaebacterial sequences substantiates the paraphyletic nature of this third urkingdom defining the eubacteria as a sister group of the halophile-methanogens and defining the eukaryotes as a sister group of a particular lineage of the eocytes/sulfur-dependents. The latter fact implies that even the eocytes/sulfur-dependent archaebacteria are paraphyletic.Presented at the FEBS Symposium on Genome Organization and Evolution, held in Crete, Greece, September 1–5, 1986Dedicated to the memory of Erik Huysmans who died on July 8, 1986, at the age of 29.     

Early evolution and the origin of eukaryotes

Our understanding of evolutionary relationships in the eukaryotic world has been revolutionized by molecular systematics. Phylogenies based upon comparisons of rRNAs define five major eukaryotic assemblages plus a series of paraphyletic protist lineages. Comparison of conserved genes that were duplicated prior to the divergence of eubacteria, archaebacteria, and eukaryotes, positions the root of the universal tree within the eubacterial line of descent. In this review a novel model is presented which uses the rRNA and protein based phylogenies to describe the evolutionary origins of eukaryotes.     

Sequence of the 16S rRNA gene from the thermoacidophilic archaebacteriumSulfolobus solfataricus and its evolutionary implications

Summary The sequence of the small-subunit rRNA from the thermoacidophilic archaebacteriumSulfolobus solfataricus has been determined and compared with its counterparts from halophilic and methanogenic archaebacteria, eukaryotes, and eubacteria. TheS. solfataricus sequence is specifically related to those of the other archaebacteria, to the exclusion of the eukaryotic and eubacterial sequences, when examined either by evolutionary distance matrix analyses or by the criterion of minimum change (maximum parsimony). The archaebacterial 16S rRNA sequences all conform to a common secondary structure, with theS. solfataricus structure containing a higher proportion of canonical base pairs and fewer helical irregularities than the rRNAs from the mesophilic archaebacteria.S. solfataricus is unusual in that its 16S rRNA-23S rRNA intergenic spacer lacks a tRNA gene.     

The nucleotide sequence of the 5S rRNA from the archaebacterium Thermoplasma acidophilum.

The complete nucleotide sequence of the 5S ribosomal RNA isolated from the archaebacterium Thermoplasma acidophilum has been determined. The sequence is: pG GCAACGGUCAUAGCAGCAGGGAAACACCAGAUCCCAUUCCGAACUCGACGGUUAAGCCUGCUGCGUAUUGCGUUGUACU GUAUGCCGCGAGGGUACGGGAAGCGCAAUAUGCUGUUACCAC(U)OH. The homology with the 55 rRNA from another archaebacterial species, Halobacterium cutirubrum, is only 60.6% and other 55 rRNAs are even less homologous. Examination of the potential for forming secondary structure is revealing. T. acidophilum does not conform to the usual models employed for either procaryotic or eucaryotic 5S rRNAs. Instead this 5S rRNA has a mixture of the characteristic features of each. On the whole this 5S rRNA does however appear more eucaryotic than eubacterial. These results give further support to the notion that the archaebacteria represent an extremely early divergence among entities with procaryotic organization.     

Studies on DNA polymerases and topoisomerases in archaebacteria

We have isolated DNA polymerases and topoisomerases from two thermoacidophilic archaebacteria: Sulfolobus acidocaldarius and Thermoplasma acidophilum. The DNA polymerases are composed of a single polypeptide with molecular masses of 100 and 85 kDa, respectively. Antibodies against Sulfolobus DNA polymerase did not cross react with Thermoplasma DNA polymerase. Whereas the major DNA topoisomerase activity in S. acidocaldarius is an ATP-dependent type I DNA topoisomerase with a reverse gyrase activity, the major DNA topoisomerase activity in T. acidophilum is a ATP-independent relaxing activity. Both enzymes resemble more the eubacterial than the eukaryotic type I DNA topoisomerase. We have found that small plasmids from halobacteria are negatively supercoiled and that DNA topoisomerase II inhibitors modify their topology. This suggests the existence of an archaebacterial type II DNA topoisomerase related to its eubacterial and eukaryotic counterparts. As in eubacteria, novobiocin induces positive supercoiling of halobacterial plasmids, indicating the absence of a eukaryotic-like type I DNA topoisomerase that relaxes positive superturns.     

Evolutionary change in 5S rRNA secondary structure and a phylogenic tree of 352 5S rRNA species

The secondary structure models of 5S rRNA have been constructed from the primary structure of 352 5S rRNA species available at present. All the 5S rRNAs examined can take essentially the same secondary structure, however they reveal characteristic differences between eukaryotes, metabacteria (= archaebacteria) and eubacteria. These three types of models can be further subgrouped by minor but characteristic differences. A phylogenic tree of organisms has been constructed using these 5S rRNA sequences by the weighted pairing method (WPG method). The tree reveals that there exist several major groups of eubacteria which seem to have diverged into different directions in the early stages of bacterial evolution. After emergence of eubacteria, metabacteria and eukaryotes separated from each other from their common ancestor. In the eukaryotic evolution, red algae (Rhodophyta) emerged first, and thereafter, thraustocytrids-Proctista, Ascomycota, green plants (green algae and land plants), Basidiomycota, Chromophyta (brown algae, diatoms and golden-yellow algae), slime- and water molds, various protozoans, and animals emerged in this order.     

Characterization of a Yellowstone hot spring microbial community by 5S rRNA sequences.

The microorganisms inhabiting a 91 degrees C hot spring in Yellowstone National Park were characterized by sequencing 5S rRNAs isolated from the mixed, natural microflora without cultivation. By comparisons of these sequences with reference sequences, the phylogenetic relationships of the hot spring organisms to better characterized ones were established. Quantitation of the total 5S-sized rRNAs revealed a complex microbial community of three dominant members, a predominant archaebacterium affiliated with the sulfur-metabolizing (dependent) branch of the archaebacteria, and two eubacteria distantly related to Thermus spp. The archaebacterial and the eubacterial 5S rRNAs each constituted about half the examined population.     

Characterization of a Yellowstone hot spring microbial community by 5S rRNA sequences

The microorganisms inhabiting a 91 degrees C hot spring in Yellowstone National Park were characterized by sequencing 5S rRNAs isolated from the mixed, natural microflora without cultivation. By comparisons of these sequences with reference sequences, the phylogenetic relationships of the hot spring organisms to better characterized ones were established. Quantitation of the total 5S-sized rRNAs revealed a complex microbial community of three dominant members, a predominant archaebacterium affiliated with the sulfur-metabolizing (dependent) branch of the archaebacteria, and two eubacteria distantly related to Thermus spp. The archaebacterial and the eubacterial 5S rRNAs each constituted about half the examined population.     

The sequence ofTetrahymena thermophila 5S ribosomal ribonucleic acid

The primary structure ofTetrahymena thermophila 5S rRNA is reported. A secondary structure model is presented which can encompass most published eukaryotic 5S rRNA sequences. Unlike other eukaryotic 5S rRNAs,Tetrahymena is found to contain the sequence-CGAAC- beginning at position 40. The presence of this segment had previously been thought to be an exclusive characteristic of eubacterial 5S rRNAs.     

In vitro incorporation of eubacterial, archaebacterial and eukaryotic 5S rRNAs into large ribosomal subunits of Bacillus stearothermophilus.

Bacillus stearothermophilus large ribosomal subunits were reconstituted in the presence of 5S rRNAs from different origins and tested for their biological activities. The results obtained have shown that eubacterial and archaebacterial 5S rRNAs can easily substitute for B. stearothermophilus 5S rRNA in the reconstitution, while eukaryotic 5S rRNAs yield ribosomal subunits with reduced biological activities. From our results we propose an interaction between nucleotides 42-47 of 5S rRNA and nucleotides 2603-2608 of 23S rRNA during the assembly of the 50S ribosomal subunit. Other experiments with eukaryotic 5.8S rRNAs reveal, if at all, a very low incorporation of these RNA species into the reconstituted ribosomes.     

Characterization of a separate small domain derived from the 5' end of 23S rRNA of an alpha-proteobacterium.

We demonstrate the presence of a separate processed domain derived from the 5' end of 23S rRNA in ribosomes of Rhodopseudomonas palustris, a member of the alpha-++proteobacteria. Previous sequencing studies predicted intervening sequences (IVS) at homologous positions within the 23S rRNA genes of several alpha-proteobacteria, including R.palustris, and we find a processed 23S rRNA 5' domain in unfractionated RNA from several species. 5.8S rRNA from eukaryotic cytoplasmic large subunit ribosomes and the bacterial processed 23S rRNA 5' domain share homology, possess similar structures and are both derived by processing of large precursors. However, the internal transcribed spacer regions or IVSs separating them from the main large subunit rRNAs are evolutionarily unrelated. Consistent with the difference in sequence, we find that the site and mechanism of IVS processing also differs. Rhodopseudomonas palustris IVS-containing RNA precursors are cleaved in vitro by Escherichia coli RNase III or a similar activity present in R.palustris extracts at a processing site distinct from that found in eukaryotic systems and this results in only partial processing of the IVS. Surprisingly, in a reaction unlike characterized cases of eubacterial IVS processing, an RNA segment larger than the corresponding DNA insertion is removed which contains conserved sequences. These sequences, by analogy, serve to link the 23S rRNA 5' rRNA domains or 5.8S rRNAs to the main portion of other prokaryotic 23S rRNAs or to eukaryotic 28S rRNAs, respectively.     

The number, physical organization and transcription of ribosomal RNA cistrons in an archaebacterium: Halobacterium halobium.

Because it is now clear that archaebacteria may be as distinct from eubacteria as either group is from eukaryotic cells, and because a specifically archaebacterial ancestry has been proposed for the nuclear-cytoplasmic component of eukaryotic cells, we undertook to characterize, for the first time, the ribosomal RNA cistrons of an archaebacterium (Halobacterium halobium). We found these cistrons to be physically linked in the order 16S-23S-5S, and obtained evidence that they are also transcribed from a common promoter(s) in the order 5'-16S-23S-5S-3'. We showed that, although slightly larger immediate precursors of 16S and 23S are readily seen, no common precursor of both 16S and 23S can be easily detected in vivo. In all these respects the archaebacterium H. halobium is like a eubacterium and unlike the nuclear-cytoplasmic component of eukaryotic cells. We found, however, that it differs from eubacteria of comparable (large) genome size in having only one copy of the rRNA gene cluster per genome.     

Archaebacteria: the road to the universal ancestor

Living forms are now divided into three primary kingdoms, eubacteria, archaebacteria and eukaryotes. The archaebacteria demonstrate a blending of eubacterial and eukaryotic features and cast new perspectives on the nature of the universal ancestor.     

Spirochete contributions to the eukaryotic genome

Expanded genome/proteome databases and effective use of sequence alignment tools make it possible to trace the phylogeny of individual eukaryotic proteins and ultimately to identify the prokaryotes that contributed to the last eukaryotic common ancestor (LECA). I developed an application of reciprocal BLASTp that identifies (1) the prokaryotic lineages that have contributed to the nuclear genome and (2) the specific proteins acquired from prokaryotic ancestors. Eight complete eubacterial proteomes were analyzed: two free-living spirochetes, two clostridia, two actinobacteria, and two proteobacteria (one alpha and one gamma). The data reveal a spirochete genetic contribution to the eukaryotic genome including essential proteins involved in DNA binding and repair, cyclic nucleotide metabolism, acyltransferase, and signal transduction. My results, consistent with the sulfur syntrophy hypothesis that posits LECA evolved from a merger of spirochetes (eubacteria) with sulfidogenic eocytes (archaebacteria), confirm the contribution of mitochondrial genes from alpha-proteobacteria. A contribution from clostridia to eukaryote genomes was also detected whereas none was seen from either actinobacterium or Escherichia coli. The complete spirochete and clostridial genetic contributions to eukaryotes and those of other eu-and archaebacteria can be identified by this method.     

Consensus structure and evolution of 5S rRNA

A consensus structure model of 5S rRNA presenting all conserved nucleotides in fixed positions has been deduced from the primary and secondary structure of 71 eubacterial, archaebacterial, eukaryotic cytosolic and organellar molecules. Phylogenetically related groups of molecules are characterized by nucleotide deletions in helices III, IV and V, and by potential base pair interactions in helix IV. The group-specific deletions are correlated with the early branching pattern of a dendrogram calculated from nucleotide substitution data: the first major division separates the group of eubacterial and organellar molecules from a second group containing the common ancestors of archaebacterial and eukaryotic/cytosolic molecules. The earliest diverging branch of the eubacterial/organellar group includes molecules from Thermus thermophilus, T. aquaticus, Rhodospirillum rubrum, Paracoccus denitrificans and wheat mitochondria.     

Genes encoding the 7S RNA and tRNA(Ser) are linked to one of the two rRNA operons in the genome of the extremely thermophilic archaebacterium Methanothermus fervidus

Analysis of gene structure in the extremely thermophilic archaebacterium, Methanothermus fervidus, has revealed the presence of a cluster of stable RNA-encoding genes arranged 5'-7S RNA-tRNA(Ser)-16S rRNA-tRNA(Ala)-23S rRNA-5S rRNA. The genome of M. fervidus contains two rRNA operons but only one operon has the closely linked 7S RNA-encoding gene. The sequences upstream from the two rRNA operons are identical for 206 bp but diverge at the 3' base of the tRNA(Ser) gene. The secondary structures predicted for the M. fervidus 7S, 16S rRNA, tRNA(Ala) and tRNA(Ser) have been compared with those of functionally homologous molecules from moderately thermophilic and mesophilic archaebacteria. A consensus secondary structure for archaebacterial 7S RNAs has been developed which incorporates bases and structural features also conserved in eukaryotic signal-recognition-particle RNAs and eubacterial 4.5S RNAs.     

Comparative structural analysis of cytoplasmic and chloroplastic 5S rRNA from spinach.

5S rRNAs from Spinacea oleracea cytoplasmic and chloroplastic ribosomes have been subjected to digestion with the single strand specific nuclease S1 and to chemical modification of cytidines by sodium bisulphite in order to probe the RNA structure. According to these data, cytoplasmic 5S rRNA can be folded as proposed in the general eukaryotic 5S rRNA structure (1) and 5S rRNA from chloroplastides is shown to be more related to the general eubacterial structure (2).