Conformation and possible role of hypermodified nucleosides adjacent to 3'-end of anticodon in tRNA: N-(purin-6-ylcarbamoyl)-L-threonine riboside

The crystal structure of N-(purin-6-ylcarbamoyl)-L-threonine riboside was determined from three-dimensional x-ray diffraction data. The N⁶-substituent is distal ($\text{trans}$) to the imidazole ring, leading to a bifurcated hydrogen interaction involving two intramolecular contacts with the hydrogen on N(threonine): a hydrogen bond to N(1) of adenine and a close contact to the hydroxyl oxygen of threonine. The conformation of the molecule and the internal hydrogen bond completely block the two sites N⁶-H and N¹ of adenine from taking part in the Watson-Crick base pairing. This inability to base pair according to the Watson-Crick scheme appears as a common structural feature in all modified bases adjacent to the 3′-end of anticodons. These results, along with Crick's hypothesis for codon recognition, suggest that the hypermodified bases adjacent to the anticodons may be important in (i) preventing the misreading of the codons by bases adjacent to anticodons and (ii) promoting a single stranded conformation for the anticodon loops.     

Incorporation of 3H-adenine into free cytokinins by cytokinin-autonomous tobacco callus tissue

Cytokinin-autonomous tobacco callus was incubated in defined mineral medium containing ³H-adenine for 60 minutes. Radioactivity was incorporated into the four predominant free cytokinins, ribosyl-$\text{trans}$-zeatin, $\text{trans}$-zeatin, N⁶-(Δ²-isopentenyl) adenosine and N⁶-(Δ²-isopentenyl) adenine. The bases were more abundant than their respective ribosides, N⁶-(Δ²-isopentenyl) adenine being the most abundant cytokinin. No discrete peaks of radioactivity could be detected on the HPLC column eluate corresponding to the elution volumes of $\text{cis}$-zeatin and ribosyl-$\text{cis}$-zeatin.     

Calcium induction of transglutaminase and the formation of epsilon(gamma-glutamyl) lysine cross-links in cultured mouse epidermal cells

A lysine tRNA (anticodon U¹UU) was isolated from rat liver mitochondria and sequenced. The sequence, pCAUUGCGAm¹Am²GCUUAGAGCm²GUUAACCU$\text{U}{}^1\text{UU}$-t⁶AAGUUAAAGUUAGAGACAACAAAUCUCCACAAUGACCA_OH, can be written in cloverleaf form. It exhibits many unorthodox features, perhaps the most strikking of which is the small size of the D-arm consisting of only 9 nucleotides. The anticodon loop contains 2 hypermodified nucleotides, U¹27 (probably 5-methoxycarbonylmethyluridine) and t⁶A30 (N-[N-(9-β-D-ribofuranosylpurin-6-yl)carbamoyl]threonine). The presence of U¹ in the first (“wobble”) position of the anticodon probably prevents the lysine tRNA from reading asparagine (AAY) codons. t⁶A, which is 3′-adjacent to the anticodon in most tRNAs recognizing codons starting with A, and other modified nucleosides occupy expected positions. We hypothesize that enzymes modifying the wobble position and the position 3′-adjacent to the anticodon recognize specific nucleotides in the anticodon.     

Structure-activity studies of β-carboline analogs

A number of β-carboline analogs have been obtained or synthesized, and their $\text{in vitro}$ receptor affinities and $\text{in vivo}$ antagonist activities determined. The choice of analogs was made in order to explore the importance of the N₉-H, the aromatic nitrogen and the C₃-ester moiety for high-receptor affinity and antagonist activity of this class of benzodiazepine antagonist. Among the analogs investigated, we describe the properties of 3-cyano-β-carboline ($\text{lh}$), the first potent β-carboline antagonist without a carbonyl at the C₃-position.The results obtained indicate: (1) Specific interactions of the C₃-substituent with key cationic receptor sites rather than electron-withdrawing properties are important for high-receptor affinity and antagonist activity. (2) Specific in-plane interactions of the atomatic nitrogen with a cationic receptor site, rather than stacking with neutral aromatic residues of the receptor are also important for high affinity and antagonist activity. (3) While the presence of an N₉H enhances receptor affinity, interaction with an anionic receptor site does not appear essential for antagonist activity.     

Conformation of acetylaminofluorene and aminofluorene modified guanosine and guanosine derivatives

Acetylaminofluorene and aminofluorene modified Guo, GMP, d(GpA) and d(ApG) have been studied by circular dichroism and ¹H nuclear magnetic resonance. Aminofluorene modified Guo is preferentially in the $\text{anti}$ conformation and acetylaminofluorene modified Guo in the $\text{syn}$ conformation. It is proposed that the $\text{anti}$ conformation of aminofluorene modified Guo is stabilized by an intra molecular hydrogen bond between the NH group of aminofluorene residue and the 5′-OH group of the sugar. The results on the modified dinucleoside monophosphates are analyzed according to this hypothesis.     

Complex formation between transfer RNAs with complementary anticodons: use of matrix bound tRNA

It is shown that yeast tRNA^Phe, chemically coupled by its oxidized 3′CpCpA end behaves exactly as free tRNA^Phe in its ability to form a specific complex with $\text{E. coli}$ tRNA₂^Glu having a complementary anticodon. The results support models of tRNA in which the 3′CpCpA_OH end and the anticodon are not closely associated in the tertiary structure, and provide a convenient tool of general use to characterize others pairs of tRNA having complementary anticodons, as well as for highly selective purification of certain tRNA species.     

Conformation of N4-acetylcytidine,a modified nucleoside of tRNA,and stereochemistry of codon-anticodon interaction

The crystal structure of N⁴-acetylcytidine (ac⁴C) a modified nucleoside of tRNA, has been determined from three-dimensional x-ray diffractometer data. The N⁴-substituent is proximal to C(5), quite contrary to expectations from solution studies of N⁴-methylcytosine. This orientation of the N⁴-substituent will not block Watson-Crick base pairing for reading the third codon by tRNA_M^Met, and hence the discriminatory function suggested for ac⁴C might arise due to non-standard conformation of the polynucleotide backbone of the anticodon around the Wobble base. A common characteristic of the modified nucleosides that occur at the Wobble position is their inability to shield the Watson-Crick base pairing sites; this is quite consistent with the necessity for reading the third base of the codon. This is in sharp contrast to the modifications of the nucleosides adjacent to the 3′-end of anticodons, all of which prevent Watson-Crick base pairing.     

Structure-activity relationship of cytokinins: crystal structure and conformation of 6-furfurylaminopurine (kinetin).

The crystal structure of 6-furfurylaminopurine (kinetin) was determined from three-dimensional x-ray diffraction data. The N⁶-substituent is distal to the imidazole ring. The molecules are linked across centers of inversion by pairs of N(6)-H···N(7) and N(9)-H···N(3) hydrogen bonds, utilizing the Hoogsteen sites for base pairing. From an analysis of the conformational preferences of cytokinins, an “active conformation” favourable for eliciting maximal cytokinin activity is proposed. The loss of cytokinin activity due to various chemical modifications such as the substitution at N¹, alteration of the methylene bridge, is correlated to the inability of cytokinins to achieve the active conformation.     

Cytokinins regulate calcium binding to a glycoprotein from fungal cells

A glycoprotein that binds about 20 atoms of Ca per mole has been purified from the osmotic shock fluid of some unicellular coenocytic water-molds, $\text{Achlya}$ spp. and $\text{Blastocladiella emersonii}$. The binding of calcium is allosterically regulated by N⁶-(substituted)adenine derivatives, cytokinins. Pyrimidines, purine and pyrimidine nucleosides, auxins, and benzimidazole derivatives are ineffective in inhibiting calcium binding. Lysozyme partially inactivates the molecule so that a high affinity calcium binding site is destroyed. Trypsin and pronase inactivate the molecule so that Ca⁺⁺ binding to both high and low affinity sites is affected. Cytokinins inhibit calcium binding to both sites.     

Interaction of manganese with fragments, complementary fragment recombinations, and whole molecules of yeast phenylalanine specific transfer RNA

Binding of Mn²⁺ to the whole molecule, fragments and complementary fragment recombinations of yeast tRNA^Phe, and to synthetic polynucleotides was studied by equilibrium dialysis. The comparison of the binding patterns of the fragments, fragment recombinations and synthetic polynucleotides with that of intact tRNA^Phe permits reasonable conclusions concerning the nature and location of the various classes of sites on tRNA^Phe. Binding of Mn²⁺ to intact tRNA^Phe consists of a co-operative and a non-co-operative phase. There are about 17 “strong” sites and several “weak” ones. Five of the 17 strong sites are associated with the co-operative phase. This phase is completely lacking in the binding of Mn²⁺ to tRNA^Phe fragments (5′-$\text{1}\text{2}$, 3′-$\text{1}\text{2}$, 5′-$\text{3}\text{5}$, 3′-$\text{2}\text{5}$), poly-(A):poly(U) and poly(I):poly(C) helices, and single stranded poly(A) and poly(U). This argues that the co-operative sites arise from the tRNA tertiary structure. This conclusion is further strengthened by the observation that cooperativity is present in a tRNA^Phe molecule which has been split in the anticodon loop, but it is absent in one which has been split in the extra loop. It is in the vicinity of the latter loop, but not the former, that tertiary interactions are seen in the crystal structure. The remaining 12 strong sites are “independent” and appear to be associated with cloverleaf helical sections.     

The influence of spermine on the structural dynamics of yeast tRNAPhe

A tRNA^Phe derivative carrying ethidium at position 37 in the anticodon loop has been used to study the effect of spermine on conformational transitions of the tRNA. As previously reported (Ehrenberg, M., Rigler, R. and Wintermeyer, W. (1979) Biochemistry 18, 4588–4599) in the tRNA derivative the ethidium is present in three states (T₁–T₃) characterized by different fluorescence decay rates. T-jump experiments show two transitions between the states, a fast one (relaxation time 10–100 ms) between T₁ and T₂, and a slow one (100–1000 ms) between T₂ and T₃. In the presence of spermine the fast transition shows a negative temperature coefficient indicating the existence of a preequilibrium with a negative reaction enthalpy. Spermine shifts the distribution of states towards T₃, as does Mg²⁺, but the final ratio $\text{[}\text{T}{}_2\text{]}\text{[}\text{T}{}_1\text{]}$ obtained with spermine is higher than with Mg²⁺, which we tentatively interpret to mean that spermine stabilizes one particular conformation of the anticodon loop.     

Purification and nucleoside composition of a Q* - containing aspartic acid tRNA from Drosophila.

One form of aspartic acid tRNA from $\text{Drosophila}$,$\text{melanogaster}$ (tRNA_2δ^Asp) is selectively bound to columns of Con A-Sepharose. Unlike the other Q-containing tRNAs of $\text{Drosophila}$, it therefore appears that tRNA^Asp contains the more highly modified nucleoside, Q¹ (mannose form) in its anticodon. This is further supported by the chromatographic insensitivity of tRNA_2δ^Asp to NaIO₄ treatment. Utilizing Con A-Sepharose chromatography, tRNA_2δ^Asp from $\text{Drosophila}$ was purified and its nucleoside composition determined by chemical tritium labelling. In addition to the major nucleosides, this tRNA contains rT, hU, m⁵C, ψ, and Q¹, but no other modified nucleosides. Its nucleoside composition is very similar to yeast tRNA^Asp.     

Analysis of the inhibitor binding to the nucleoside site of phosphorylase b

The binding of inhibitors to site I of rabbit muscle phsphorylase $\text{b}$ has beenstudied kinetically and thermodynamically for caffeine, adenine and adenosine. The effect of ligands on the tertiary structure has been investigated by studying the protection against 5,5′-dithiobis (2-nitrobenzoic acid) (DTNB) titration of the slow-reacting sulphydryl groups of the enzyme. Calorimetric and cysteinyl protection data taken together suggest that these inhibitors bind to both sites N and I even under conditions of saturation by glucose. Calorimetric results show that inhibitor binding to sites I and N at 25°C is driven enthalpically, although both $\text{Δ}\text{H}$ and $\text{Δ}\text{S}$ of interaction are significant. We conclude that attractive dispersion forces ought to be the main ones responsible for inhibitor binding to site I. AMP-activated phosphorylase $\text{b}$ is inhibited by both caffeine and adenine by cooperative and exclusive binding to the inactive $\text{T}$ conformation. The binding of the substrate (phosphate) and AMP when adenine is present was found to be exlusive to the active $\text{R}$ conformation, whereas non-exclusive binding of the activator was observed when caffeine was added.     

Delineation of the intimate details of the backbone conformation of pyridine nucleotide coenzymes in aqueous solution.

The noise free 300 MHz ¹H NMR spectra of β-DPN⁺, recorded in the Fourier mode at 12° and 68°C have been completely analysed by extensive computer simulation. It is shown, whether the coenzyme exists as an equilibrium mixture of folded ? extended forms (12°C) or in overwhelminghly extended forms (68°C), the backbone of both the nicotinamide and adenine fragments preferentially exist in ${}^2\text{E-gg-g′g′}$ conformation. This orientation is significantly different from those reported in the solid state for the extended species in contact with the enzyme where ${}^2\text{E-tg-g′g′}$ and ${}^3\text{E-tg-g′g′}$ orientations have been observed. It is suggested that specific interactions of the backbone with the various amino acid residues in the enzyme induces conformational aberrations in the backbone. Intimate details of the backbone conformation of the extended forms of AcPy-DPN⁺ and β-TPN⁺ are also presented.     

Identification of NG, NG-dimethylarginine in a nuclear protein from the lower eukaryote physarum polycephalum homologous to the major proteins of mammalian 40S ribonucleoprotein particles

A nuclear protein apparently homologous to the two major proteins of 40S heterogeneous nuclear ribonucleoprotein particles from mammalian cells has been isolated from the lower eukaryote $\text{Physarum polycephalum}$, purified, and found to contain a substantial amount of the unusual amino acid N^G, N^G-dimethylarginine. The apparent homology is based on similar molecular weights, basic isoelectric points and amino acid compositions including the dimethylarginine and a high content of glycine. The implications of the presence of this protein in $\text{Physarum polycephalum}$ and the possible significance of the N^G, N^G-dimethylarginine are discussed.     

Linear oligopeptides: 65′. Conformational analysis of the N-protected aromatic α-amino acid N-tert-butyloxycarbonyl-l-phenylalanine by X-ray diffraction and infrared absorption

The X-ray diffraction and i.r. absorption conformational analysis of $\text{N}\text{-tert-butyloxycarbonyl-}\text{l}\text{-phenylalanine}$ has showed the absence of intramolecularly hydrogen-bonded peptide conformations in the solid state. The molecules are held together in rows of ‘cyclic dimer’ motifs through intermolecular NH … OC (acid) and OH … OC {urethane} hydrogen bonds, the secondary amide-like group of the urethane moiety being in the unusual cis conformation, whereas the carboxylic acid group in the common syn conformation. The two molecules in the unit cell present a centrosymmetric set of ?, ψ¹, and ψ² values. In polar solvents solvated species largely predominate. In saturated hydrocarbon solution non-associated and associated (mostly involving the carboxylic acid CO as the proton acceptor) species simultaneously occur. The extent of association decreases with dilution. The amount of intramolecularly hydrogen-bonded oxy-C₇ and C₅ forms if any, should be extremely small. The type of association at saturation seems to differ from that found in the crystalline compound obtained by precipitation with saturated aliphatic hydrocarbons (from a diethyl ether solution).     

Demethylation of O6-methylguanine in a synthetic DNA polymer by an inducible activity in Escherichiacoli

$\text{O}$⁶-Methyl[8-³H]deoxyguanosine in a synthetic DNA polymer, poly(dC, dG, m⁶dG), is demethylated by cell-free extracts of $\text{Escherichia}\text{coli}\text{B}\text{r}$ adapted by exposure to $\text{N}$-methyl-$\text{N}$′-nitro-$\text{N}$-nitrosoguanidine, as shown by the appearance of ³H-labeled deoxyguanosine in hydrolysates of the recovered DNA. The demethylating activity could not be detected in extracts of nonadapted $\text{E}\text{.}\text{coli}$. These results provide direct evidence that a previously described inducible repair activity in $\text{E}\text{.}\text{coli}$ acts by demethylating $\text{O}$⁶-methylguanine at the DNA level.     

Conformational Preferences of Modified Nucleoside N(4)-Acetylcytidine, ac4C Occur at “Wobble” 34th Position in the Anticodon Loop of tRNA

Conformational preferences of modified nucleoside, N(4)-acetylcytidine, ac⁴C have been investigated using quantum chemical semi-empirical RM1 method. Automated geometry optimization using PM3 method along with ab initio methods HF SCF (6-31G**), and density functional theory (DFT; B3LYP/6-31G**) have also been made to compare the salient features. The most stable conformation of N(4)-acetyl group of ac⁴C prefers “proximal” orientation. This conformation is stabilized by intramolecular hydrogen bonding between O(7)···HC(5), O(2)···HC2′, and O4′···HC(6). The “proximal” conformation of N(4)-acetyl group has also been observed in another conformational study of anticodon loop of E. coli elongator tRNA^Met. The solvent accessible surface area (SASA) calculations revealed the role of ac⁴C in anticodon loop. The explicit molecular dynamics simulation study also shows the “proximal” orientation of N(4)-acetyl group. The predicted “proximal” conformation would allow ac⁴C to interact with third base of codon AUG/AUA whereas the ‘distal’ orientation of N(4)-acetyl cytidine side-chain prevents such interactions. Single point energy calculation studies of various models of anticodon–codon bases revealed that the models ac⁴C₍₃₄₎(Proximal):G₃, and ac⁴C₍₃₄₎(Proximal):A₃ are energetically more stable as compared to models ac⁴C₍₃₄₎(Distal):G₃, and ac⁴C₍₃₄₎(Distal):A₃, respectively. MEPs calculations showed the unique potential tunnels between the hydrogen bond donor–acceptor atoms of ac⁴C₍₃₄₎(Proximal):G₃/A₃ base pairs suggesting role of ac⁴C in recognition of third letter of codons AUG/AUA. The “distal” conformation of ac⁴C might prevent misreading of AUA codon. Hence, this study could be useful to understand the role of ac⁴C in the tertiary structure folding of tRNA as well as in the proper recognition of codons during protein biosynthesis process.     

Proton and carbon magnetic resonance studies of the synthetic polypentapeptide of elastin.

Proton and ¹³C magnetic resonance studies are reported on the synthetic polypentapeptide of elastin, HCO-(Val₍₁₎-Pro₍₂₎-Gly₍₃₎-Val₍₄₎-Gly₍₅₎)_n-Val-OMe, where n ∼- 18. Temperature and solvent dependence of peptide N$\text{H}$ chemical shift and solvent dependence of peptide carbonyl chemical shift were used to delineate these moieties preliminary to identification of secondary structure.Based on these studies it is proposed, for the organic solvents of dimethyl sulfoxide, methanol, and low-temperature trifluoroethanol, that dynamic hydrogen bonds form in order of decreasing frequency of occurrence between the Val₍₁₎$\text{C}$O and the Val₍₄₎ N$\text{H}$ (a β-turn), between the Gly₍₃₎ N$\text{H}$ and the Gly₍₅₎$\text{C}$O (an 11-atom, hydrogen-bonded ring), and a more limited interaction between the Gly₍₃₎$\text{C}$O and the Gly₍₅₎ N$\text{H}$ (a γ-turn).Arguments are presented that relate the conformational features proposed above to the coacervate, which is a filamentous state.     

Acylated des-(Ala1-Gly2)-somatostatin analogs: prolonged inhibition of growth hormone secretion

The following eight analogs of somatostatin were synthesized by solid phase: des-[Ala¹-Gly²]-somatostatin (I); des-[Ala¹-Gly²]-H₂somatostatin (II); $\text{N}$-acetyl-Cys³-somatostatin (III); $\text{N}$-acetyl-Cys³-H₂somatostatin (IV); $\text{N}$-pyvalyl-Cys³-H₂somatostatin (V); $\text{N}$-acrylyl-Cys³-H₂somatostatin (VI); $\text{N}$-benzoyl-Cys³-H₂somatostatin (VII); $\text{N}$-hexanoyl-Cys³-H₂somatostatin (VIII). Deletion of the N-terminal dipeptide Ala¹-Gly² is compatible with high biological activity. A single s.c. injection of these analogs as a microsuspension in saline inhibits for 24–72 hours (depending on the compound) the secretion of growth hormone normally stimulated in rats by pentobarbital.