共查询到20条相似文献,搜索用时 15 毫秒
1.
We synthesized pyrrolidino-C-nucleosides, incorporated them into oligodeoxynucleotides and investigated their pairing properties. The thermal duplex and triplex stabilities were measured. While triplex formation is destabilized in the case of pyrrolidino-pseudo-U and -T, pyrrolidino-pseudo-iso-C leads to an increase of the Tm value for third strand dissociation. Duplexes are destabilized with all pyrrolidino-C-nucleosides. 相似文献
2.
Maurice Durand Nguyen Thanh Thuong Jean Claude Maurizot 《Journal of biomolecular structure & dynamics》2013,31(6):1191-1202
Abstract The interaction of berenii molecule, a minor groove binding drug, with T-A-T triple helix and A-T double helix was studied using circular dichroism spectroscopy and thermal denaturation. The triple helix was made by an oligonucleotide (dA)12?x-(dT)12?x-(dT)12, where x is a hexaethylene glycol chain bridged between the 3′ phosphate of one strand and the 5′ phosphate of the following strand. This oligonucleotide is able to fold back on itself to form a very stable triplex. Circular dichroism spectroscopy demonstrates that berenil can bind to the triple helical structure. Spectral analysis shows that in the same ionic strength the drug bound to a double-stranded structure exhibits a conformation and an environment close to those observed in triple-stranded structure. The influence of the ionic strength on the interaction between the berenil molecule and the 36-mer is clearly demonstrated. We showed that when no NaCl salt is added in the buffer the triplex form of (dA)12?x-(dT)12-x-(dT)12 is stabilized by berenil whereas it is destabilized slightly by the dye when NaCl concentration is 1 M. 相似文献
3.
Effective sequence-specific recognition of duplex DNA is possible by triplex formation with natural oligonucleotides via Hoogsteen H-bonding. However, triplex formation is in practice limited to pyrimidine oligonucleotides that bind duplex A-T or G-C base pair DNA sequences specifically at homopurine sites in the major groove as T·A-T and C+ ·G-C triplets. Here we report the successful modelling of novel unnatural nucleosides that recognize the C-G DNA base pair by Hoogsteen-like major groove interaction. These novel Hoogsteen nucleotides are examined within model A-type and B-type conformation triplex structures since the DNA triplex can be considered to incorporate A-type and/or B-type configurational properties. Using the same deoxyribose-phosphodiester and base-deoxyribose dihedral angle configuration, a triplet comprised of a C-G base pair and the novel Hoogsteen nucleotide, Y2, replaces the central T·A-T triplet in the triplex. The presence of any structural or energetic perturbations due to the central triplet in the energy-minimized triplex is assessed with respect to the unmodified energy minimized (T·A-T)11 starting structures. Incorporation of this novel triplet into both A-type and B-type natural triplex structures provokes minimal change in the configuration of the central and adjacent triplets. 相似文献
4.
Birendra K. Bhattacharya Rodrigo V. Devivar Ganapathi R. Revankar 《Nucleosides, nucleotides & nucleic acids》2013,32(6):1269-1287
Abstract A convenient synthesis of N1-methyl-2′-deoxy-ψ-uridine (ψ-thymidine, ψT, 7a) has been accomplished in good yield. The structural conformation of 7a was derived by 2D NMR and 1D NOE experiments. The nucleoside 7a has been incorporated into G-rich triplex forming oligonucleotides (TFOs) by solid-support, phosphoramidite method. The triplex forming capabilities of the modified TFOs (S4, S5 and S6) containing ψT has been evaluated in antiparallel motif with a target duplex (duplex-31) 5′d(CTGAGACCGGGAAGGAGGAAGGGCCAGTGAC)3′-5′d(GACTCTGGCCCTTCCTCCTTCCCGGTCACTG)3′(D1) at pH 7.6. The triplex formation of modified homopyrimidine-oligomers (S1, S2 and S3) has also been studied in parallel motif with a duplex-10 (A10:T10) at pH 7.0. 相似文献
5.
David M. Noll Jessica L. O'Rear Cynthia D. Cushman Paul S. Miller 《Nucleosides, nucleotides & nucleic acids》2013,32(4):997-1005
Abstract An intramolecular duplex/triplex chimera is formed between d-CTTCCT-(T)4-TCCTTCAGCACA and target d-GTT TGTGCTGAAGGA CACAC. The high Tm and hypochromicity of the triplex part of the chimera may be due to additional interactions outside the underlined binding site of the 20-mer. 相似文献
6.
Toshihiro Ihara Yoshinobu Sato Hiroshi Shimada Akinori Jyo 《Nucleosides, nucleotides & nucleic acids》2013,32(9):1084-1096
The flexible polypyridine ligand, 2,2′:6′,2″-terpyridine (terpy), was built into the backbone of oligonucleotides to form DNA conjugates. The terpy unit functioned as a good loop when the conjugates formed the bimolecular triplexes with complementary oligopurine. The triplex structure was destabilized by the specific interaction with divalent transition metal ions (Cu2+, Zn2+, and Fe2+), in particular Cu2+ ions. This ion destabilized one of the triplexes by 4.2 kcalmol?1 or made the triplex formation constant less than 1/103 at 298 K. This result is attributed to the substantial turbulence of the terminal structure of the triplexes. 相似文献
7.
Abstract The replacement of phosphodiester linkages of the polyanion DNA with S-methylthiourea linkers provides the polycation deoxyribonucleic S-methylthiourea (DNmt). Molecular dynamics studies to 1,220 ps of the hybrid triplex formed from octameric DNmt strands d(Tmt)8 with a complementary DNA oligomer strand d(Ap)8 have been carried out with explicit water solvent and Na counterions under periodic boundary conditions using the CHARMM force field and the Ewald summation method. The Watson-Crick and Hoogsteen hydrogen-bonding patterns of the A/T tracts remained intact without any structural restraints for triplex structures throughout the simulation. The duplex portion of the triplex structure equilibrated at a B-DNA conformation in terms of the helical rise and other helical parameters. The dynamic structures of the DNmt·DNA·DNmt triplex were determined by examining histograms from the last 800 ps of the dynamics run. These included the hydrogen-bonding pattern (sequence recognition), three-centered bifurcating occurrences, minor groove width variations, and bending of tracts for the hybrid triplex structures. Together with the Watson-Crick hydrogen-bondings, the strong Hoogsteen hydrogen-bondings, the partially maintained three-centered bifurcatings in the Watson-Crick pair, and the medium-strength three-centered bifurcatings in the Hoogsteen pair suggest that the hybrid triplex is energetically favorable as compared to a duplex with similar base stacking, van der Waals interactions, and helical parameters. This is in agreement with our previously reported thermody- namic study, in which only triplex structures were observed in solution. The bending angle measured between the local axis vectors of the first and last helical axis segments is about 20° for the Watson-Crick portion of the averaged structure. Propeller twist (associated with three-centered hydrogen-bonding) up to ?30°, native to DNA AT base pairing, was also observed for the triplex structure. The sugar pseudorotation phase angles and the ring rotation angles for the DNA strand are within the C3′-endo domain and C2′-endo domain for the DNmt strand. Water spines are observed in both minor and major grooves throughout the dynamics run. The molecular dynamics simulations of the structural properties of DNmt·DNA·DNmt hybrid triplex is compared to the DNG·DNA·DNG hybrid triplex (In DNG the -O-(PO2-)-O- linkers in DNA is replaced by -NH-C(=N2)-NH-). 相似文献
8.
Abstract We examined the effects of 1–(2-deoxy -2-fluoro-β-D-arabinofuranosyl)-thymine (or FMAU, a potent antiviral nucleoside) on the stability of duplex and triplexes. When compared the stability of the self-complementary 5′-A5T5 duplex with 5′-A5X5 (X = FMAU), duplex containing FMAU has much higher melting temperature (Tm). 5′-A6T5T3X3T5F3X3 and T3X3T5A6T5F3X3 form the parallel and antiparallel triplexes T3X3: A6:X3X3, respectively. The former exhibited the typical T:A:T triplex behavior with only one melting temperature at 70 °C and 45 °c in 1.0 M and 0.2 M NaCl solution, respectively, whereas the latter has two Tm values at 56 °C and 28 °C in 1.0 M solution. FMAU clearly stabilize the triplex structure as A6T22 which forms the parallel triplex T6:A6:T6 has also only one Tm at 54 °C and 37 °C in high and iow salt concentration solutions, respectively. A 31mer 5′-TCCTCCTTTTTTAGGAGGATTTTTTGGTGGT and 5′-TCCTCCTTTTTTAGGAGGATTTTTTX'X'TX'X'T (X' = 2′-deoxy-5-methylcytidine) were prepared to study their triplex forming potential. The former was found to have a week interaction of the Watson-Crick duplex with the mismatched third-strand at all pH. The latter formed a stable triplex at lower pH consistent with required protonation on the 5-methylcytosine base. For these studies we developed a simple PC desktop spreadsheet program to calculate the first derivative profile of the melting curve data. This paper is dedicated to Prof. Jacques H. van Boom on the occasion of his 60th birthday. 相似文献
9.
Tamer Nasr Yosuke Taniguchi Tomoko Takaki Hidenori Okamura Shigeki Sasaki 《Nucleosides, nucleotides & nucleic acids》2013,32(12):841-860
(1S,3S,4R)-1-Phenyl-1-thymidyl-3-hydroxy-4-hydroxymethylcyclopentane (10) and their analogs were synthesized, incorporated into the oligodeoxynucleotides, and their properties were evaluated for the formation of duplex and triplex DNA. The known chiral cyclopentanone derivative was converted into the corresponding ketimine sulfonamide derivative, which was subjected to a stereoselective PhLi addition. The formed sulfonamide was hydrolyzed to afford the primary amino group, on which the thymine moiety was built. The benzyl protecting groups were removed to form the nucleoside analog having a phenyl group and the thymine unit at the 1′ position of a carbocyclic skeleton (10). In the estimation of the oligodeoxynucleotides incorporating 10 for duplex and triplex formation, the carbocyclic nucleoside analog 10 did not show the stabilizing effect for duplex formation; on the other hand, it stabilized the triplex. Therefore, the skeleton of the phenyl-substituted carbocyclic nucleoside analog 10 may be a platform for the formation of stable triplex DNA. 相似文献
10.
Rong Cao Carl F. Venezia Bruce A. Armitage 《Journal of biomolecular structure & dynamics》2013,31(6):844-857
Abstract The DNA binding behavior of a tricationic cyanine dye (DiSC3+(5)) was studied using the [Poly(dA-dT)]2, [Poly(dI-dC)]2 and Poly(dA)?Poly(dT) duplex sequences and the Poly(dA) ?2Poly(dT) triplex. Optical spectroscopy and viscometry results indicate that the dye binds to the triplex structure by intercalation, to the nonalternating Poly(dA)?Poly(dT) duplex through minor groove binding and to the alternating [Poly(dA-dT)]2 duplex by a combination of two binding modes: intercalation at low concentration and dimerization within the minor groove at higher concentration. Dimerization occurs at lower dye concentrations for the [Poly(dI-dC)]2 sequence, consistent with our previous investigations on an analogous monocationic cyanine dye. [Seifert, J.L., et al. (1999) J. Am. Chem. Soc. 121, 2987–2995] These studies illustrate the diversity of DNA binding modes that are available to a given ligand structure. 相似文献
11.
Ye Fangt Chunli Bai Youqi Tang Shwu-Bin Lin Lou-sing Kan 《Journal of biomolecular structure & dynamics》2013,31(4):485-493
Abstract Hydrated water molecules of pyrimidine/purine/pyrimidine DNA hairpin triplex was studied by a comparison of triplex (CC·AG6) formed by a host oligodeoxypyrimidine of 5′- d(TC)3T4(CT)3 (CC) with a target hexadeoxypurine 5′-d(AG)3 (AG6) strand and by triplexes (MM·AG6, MC·AG6, and CM·AG6) formed by oligonucleotides with the exact sequences as above except 5-methylcytosine replaced all (MM), 5′ end half (MC), and 3′ end half (CM) cytosine bases in CC via FT-IR spectroscopy in hydrated film. Results revealed that: (i) all these triplexes have a similar hydration pattern, in which water molecules probably bound in the N7 sites of adenines and guanines in the Crick-Hoogsteen groove, and to the methyl group of thymidines in the Watson-Hoogsteen groove. There are also some bound water molecules found at the O2 sites of thymines in both Watson-Crick and Crick-Hoogsteen grooves, (ii) In the CC·AG6 triplex the S-type sugars are always dominant in all hydrated states, whereas in MM·AG6 triplex the relative population of the N-type sugars is very close to that of the S-type between 86% and 66% of humidity. Furthermore, the sugar conformation in two partially modified triplexes (CM·AG6, and MC·AG6) are dominant by the N-type at lower humidity. This phenomenon might reflect that the degree of bound water varies among the binding sites of bases, (iii) The effect of introducing a methyl group on cytosine is to generates spine of hydrophobic region in MM (MC and MC). The enlarging hydrophobic area not only increase the stability in solution, and also the stability in sodium hydrated films of the pyrimidine/purine/pyrimidine hairpin triplexes. 相似文献
12.
《Nucleosides, nucleotides & nucleic acids》2013,32(5-8):1331-1333
Abstract To expand the triplex recognition repertoire of Nucleic Acids, novel nucleobases that recognize thymine in a T-A base pair are still required. A novel conformationally constrained PNA-monomer (II) capable of binding T in a triplex motif was designed and synthesized in 7 steps starting from commercially available dimethyl 2-oxoglutarate. 相似文献
13.
Birendra K. Bhattacharya Mohan V. Chari Ross H. Durland Ganapathi R. Revankar 《Nucleosides, nucleotides & nucleic acids》2013,32(1-2):45-63
Abstract A convenient synthesis of 1-(2-deoxy-β-D-erythro-pentofuranosyl)quinazoline-2,4(3H)-dione ( 6 ) has been accomplished. The structural conformation of ( 6 ) was derived by 2D NMR, COSY and NOESY experiments. Nucleoside ( 6 ) was incorporated into G-rich triplex forming oligonucleotides (TFOs) by solid-support, phosphoramidite method. The triplex forming capabilities of modified TFOs (S2, S3 and S4) has been evaluated in antiparallel motif with a target duplex (duplex-31) 5′d(GTCACTGGCCCTTCCTCCTTCCCGGTCTCAG)3′-5′d(CAGTGACCGGGAAGGAGGAAGGGCCAGAGT)3′ (D1) at pH 7.6. The parallel triplex formation of a shorter TFO (S6) containing Q has also been studied with a target duplex-11 (D2) at pH 5.0. 相似文献
14.
O. I. Kovalsky G. A. Dvoryankin E. I. Budowsky 《Journal of biomolecular structure & dynamics》2013,31(6):933-943
Abstract Supercoiling-induced structural transition of the d(C24GC21,) · d(G21CG24) sequence in plasmid DNA in the presence of Mg2+ at neutral pH results in alterations of efficiencies of not only single-quantum (pyrimidine[6–4]pyrimidone adducts) but also two-quantum (alkalisensitive lesions of dG residues) photomodifications of nucleoside residues within this sequence. The generation of both types of photoreactions was achieved by the application of high-intensity laser UV radiation (intensity ~ 1011 W/m2, pulse duration ~ 10?8 s, λ= 266 nm) for irradiation of a plasmid DNA The modification extent sufficient for analysis of photoreaction efficiency distributions along both strands of the insert (photofootprinting) was obtained by the action of a single nanosecond pulse of laser UV radiation. The pattern of a laser photofootprinting is consistent with the d(C) · d(G) · d(G) triplex formation in the presence of Mg2+ within the insert and shows some details of this triplex structure. 相似文献
15.
L.-S. Kan D. E. Callahan T. L. Trapane P. S. Miller P. O.P. Ts'o D. H. Huang 《Journal of biomolecular structure & dynamics》2013,31(5):911-933
Abstract Triplex and duplex formation of two deoxyribohexadecamers d-A-(G-A)7-G (a) and d-C-(T-C)7-T (b) have been studied by UV, CD, fluorescence, and proton NMR spectroscopy. Optical studies of a and b at dilute concentrations (μM range) yielded results similar to those seen for polymers of the same sequence, indicating that these hexadecamers have properties similar to the polymers in regard to triplex formation. The CD spectra of concentrated NMR samples (mM range) are similar to those observed at optical concentrations at both low and high pH, making possible a correlation between CD and NMR studies. In NMR spectra, two imido NH-N hydrogen bonded resonance envelopes at 12.6 and 13.7 ppm indicate that only the duplex conformation is present at pH > 7.7. Four new NH-N hydrogen-bonded resonance envelopes at 12.7, 13.5, 14.2. and 14.9 ppm are observed under acidic conditions (pH 5.6) and the two original NH-N resonances gradually disappear as the pH is lowered. Assignment of these four peaks to Watson-Crick G · C, Hoogsteen T · A. Watson-Crick A · T. and Hoogsteen C+ · G hydrogen-bonded imidos, respectively, confirm the formation of triple-stranded DNA NMR results also show that triplex is more stable than duplex at the same salt condition and that triplex melts to single strands directly without going through a duplex intermediate. However, in the melting studies, a structural change within the triple-stranded complex is evident at temperatures significantly below the major helix-to-coil transition. These studies demonstrate the feasibility of using NMR spectroscopy and oligonucleotide model compounds a and b for the study of DNA triplex formation. 相似文献
16.
We have targeted the d[G(AG)5] · d[C(TC)5] duplex for triplex formation at neutral pH with either d[G(AG)5] or d[G(TG)5]. Using a combination of gel electrophoresis, uv and CD spectra, mixing and melting curves, along with DNase I digestion studies, we have investigated the stability of the 2:1 pur*pur · pyr triplex, d[G(AG)5] * d[G(AG)5] · d[C(TC)5], in the presence of MgCl2. This triplex melts in a monophasic fashion at the same temperature as the underlying duplex. Although the uv spectrum changes little upon binding of the second purine strand, the CD spectrum shows significant changes in the wavelength range 200–230 nm and about a 7 nm shift in the positive band near 270 nm. In contrast, the 1:1:1 pur/pyr*pur · pyr triplex, d[G(TG)5] * d[G(AG)5] · d[C(TC)5], is considerably less stable thermally, melting at a much lower temperature than the underlying duplex, and possesses a CD spectrum that is entirely negative from 200 to 300 nm. Ethidium bromide undergoes a strong fluorescence enhancement upon binding to each of these triplexes, and significantly stabilizes the pur/pyr*pur · pyr triplex. The uv melting and differential scanning calorimetry analysis of the alternating sequence duplex and pur*pur · pyr triplex shows that they are lower in thermodynamic stability than the corresponding 10-mer d(G3A4G3) · d(C3T4C3) duplex and its pur*pur · pyr triplex under identical solution conditions. © 1997 John Wiley & Sons, Inc. 相似文献
17.
Implications of DNA, RNA and RNA.DNA hybrid triplexes in diverse biological functions, diseases and therapeutic applications call for a thorough understanding of their structure-function relationships. Despite exhaustive studies mechanistic rationale for the discriminatory preference of parallel DNA triplexes with G*GC & T*AT triplets still remains elusive. Here, we show that the highest nonisostericity between the G*GC & T*AT triplets imposes extensive stereochemical rearrangements contributing to context dependent triplex destabilisation through selective disruption of Hoogsteen scheme of hydrogen bonds. MD simulations of nineteen DNA triplexes with an assortment of sequence milieu reveal for the first time fresh insights into the nature and extent of destabilization from a single (non-overlapping), double (overlapping) and multiple pairs of nonisosteric base triplets (NIBTs). It is found that a solitary pair of NIBTs, feasible either at a G*GC/T*AT or T*AT/G*GC triplex junction, does not impinge significantly on triplex stability. But two overlapping pairs of NIBTs resulting from either a T*AT or a G*GC interruption disrupt Hoogsteen pair to a noncanonical mismatch destabilizing the triplex by ~10 to 14 kcal/mol, implying that their frequent incidence in multiples, especially, in short sequences could even hinder triplex formation. The results provide (i) an unambiguous and generalised mechanistic rationale for the discriminatory trait of parallel triplexes, including those studied experimentally (ii) clarity for the prevalence of antiparallel triplexes and (iii) comprehensive perspectives on the sequence dependent influence of nonisosteric base triplets useful in the rational design of TFO’s against potential triplex target sites. 相似文献
18.
Françoise Vovelle Chantal Prévost Maurice Durand Jean Claude Maurizot 《Journal of biomolecular structure & dynamics》2013,31(3):293-302
Abstract A detailed molecular mechanical study has been made on the complexes of netropsin with the double stranded oligonucleotide (dA)12.(dT)12 and with the triple helix (dA)12.(dT)12.(dT)12. The complexes were built using computer graphics and energy refined using JUMNA program. In agreement with circular dichroïsm experiments we have shown that 3 netropsins can bind the minor grooves of the triple helix and of the double helix. The groove geometry in the duplex and in the triplex is very similar. However a detailed analysis of the energetic terms shows, in agreement with thermal denaturation studies, that the affinity of netropsin toward the double helices is larger than towards triple helices. 相似文献
19.
Calorimetric and fluorescence techniques were used to characterize the binding of aminoglycosides-neomycin, paromomycin, and ribostamycin, with 5′-dA12-x-dT12-x-dT12-3′ intramolecular DNA triplex (x = hexaethylene glycol) and poly(dA)·2poly(dT) triplex. Our results demonstrate the following features: (1) UV thermal analysis reveals that the Tm for triplex decreases with increasing pH value in the presence of neomycin, while the Tm for the duplex remains unchanged. (2) The binding affinity of neomycin decreases with increased pH, although there is an increase in observed binding enthalpy. (3) ITC studies conducted in two buffers (sodium cacodylate and MOPS) yield the number of protonated drug amino groups (Δn) as 0.29 and 0.40 for neomycin and paromomycin interaction with 5′-dA12-x-dT12-x-dT12-3′, respectively. (4) The specific heat capacity change (ΔCp) determined by ITC studies is negative, with more negative values at lower salt concentrations. From 100 mM to 250 mM KCl, the ΔCp ranges from −402 to −60 cal/(mol K) for neomycin. At pH 5.5, a more positive ΔCp is observed, with a value of −98 cal/(mol K) at 100 mM KCl. ΔCp is not significantly affected by ionic strength. (5) Salt dependence studies reveal that there are at least three amino groups of neomycin participating in the electrostatic interactions with the triplex. (6) FID studies using thiazole orange were used to derive the AC50 (aminoglycoside concentration needed to displace 50% of the dye from the triplex) values. Neomycin shows a seven fold higher affinity than paromomycin and eleven fold higher affinity than ribostamycin at pH 6.8. (7) Modeling studies, consistent with UV and ITC results, show the importance of an additional positive charge in triplex recognition by neomycin. The modeling and thermodynamic studies indicate that neomycin binding to the DNA triplex depends upon significant contributions from charge as well as shape complementarity of the drug to the DNA triplex Watson–Hoogsteen groove. 相似文献
20.
Maozi Liu Linjing Yang Wenli Deng Ming Su Chen Wang Shuu-Bin Lin 《Journal of biomolecular structure & dynamics》2013,31(5):895-903
Abstract Three triplex DNAs containing 5-bromocytosine[BrC] were studied by vibrational spectroscopy and molecular modelling. Firstly, three oligodeoxypyrimidines of 5′-(TC)3- T4-(BrCT)3 [CBrC], 5′-(TBrC)3-T4-(CT)3 pCC] and 5′-(TBC)3-T4-(BrCT)3 [BrCBC] were synthesized and then reacted with an oligodeoxypurine of 5′-(AG)3 at pH=4.5 in phosphate buffer respectively to form three comparative hairpin triplex named CY,YC and YY. The results of FT-Raman and IR revealed that YY is almost in A-like form, CY and YC are combinations of A-like form and B-like form, but A-form dominates in CY while B-form is equivalent as A-form in YC. The result is consistent with the theoretical analysis. 相似文献