Novel Hoogsteen-like Bases for Recognition of the C-G Base Pair by DNA Triplex Formation

Effective sequence-specific recognition of duplex DNA is possible by triplex formation with natural oligonucleotides via Hoogsteen H-bonding. However, triplex formation is in practice limited to pyrimidine oligonucleotides that bind duplex A-T or G-C base pair DNA sequences specifically at homopurine sites in the major groove as T·A-T and C⁺ ·G-C triplets. Here we report the successful modelling of novel unnatural nucleosides that recognize the C-G DNA base pair by Hoogsteen-like major groove interaction. These novel Hoogsteen nucleotides are examined within model A-type and B-type conformation triplex structures since the DNA triplex can be considered to incorporate A-type and/or B-type configurational properties. Using the same deoxyribose-phosphodiester and base-deoxyribose dihedral angle configuration, a triplet comprised of a C-G base pair and the novel Hoogsteen nucleotide, Y2, replaces the central T·A-T triplet in the triplex. The presence of any structural or energetic perturbations due to the central triplet in the energy-minimized triplex is assessed with respect to the unmodified energy minimized (T·A-T)₁₁ starting structures. Incorporation of this novel triplet into both A-type and B-type natural triplex structures provokes minimal change in the configuration of the central and adjacent triplets.     

Properties of Oligonucleotide with Phenyl-Substituted Carbocyclic Nucleoside Analogs for the Formation of Duplex and Triplex DNA

(1S,3S,4R)-1-Phenyl-1-thymidyl-3-hydroxy-4-hydroxymethylcyclopentane (10) and their analogs were synthesized, incorporated into the oligodeoxynucleotides, and their properties were evaluated for the formation of duplex and triplex DNA. The known chiral cyclopentanone derivative was converted into the corresponding ketimine sulfonamide derivative, which was subjected to a stereoselective PhLi addition. The formed sulfonamide was hydrolyzed to afford the primary amino group, on which the thymine moiety was built. The benzyl protecting groups were removed to form the nucleoside analog having a phenyl group and the thymine unit at the 1′ position of a carbocyclic skeleton (10). In the estimation of the oligodeoxynucleotides incorporating 10 for duplex and triplex formation, the carbocyclic nucleoside analog 10 did not show the stabilizing effect for duplex formation; on the other hand, it stabilized the triplex. Therefore, the skeleton of the phenyl-substituted carbocyclic nucleoside analog 10 may be a platform for the formation of stable triplex DNA.     

An Improved Synthesis of 1-(2-Deoxy-β-D-erythro-pentofuranosyl)quinazoline-2,4(3H)-dione and Its Incorporation Into G-Rich Triple Helix Forming Oligonucleotides

Abstract

A convenient synthesis of 1-(2-deoxy-β-D-erythro-pentofuranosyl)quinazoline-2,4(3H)-dione ( 6 ) has been accomplished. The structural conformation of ( 6 ) was derived by 2D NMR, COSY and NOESY experiments. Nucleoside ( 6 ) was incorporated into G-rich triplex forming oligonucleotides (TFOs) by solid-support, phosphoramidite method. The triplex forming capabilities of modified TFOs (S2, S3 and S4) has been evaluated in antiparallel motif with a target duplex (duplex-31) 5′d(GTCACTGGCCCTTCCTCCTTCCCGGTCTCAG)3′-5′d(CAGTGACCGGGAAGGAGGAAGGGCCAGAGT)3′ (D1) at pH 7.6. The parallel triplex formation of a shorter TFO (S6) containing Q has also been studied with a target duplex-11 (D2) at pH 5.0.     

A Practical Synthesis of N1-Methyl-2′-deoxy-ψ-uridine (ψ-Thymidine) and Its Incorporation into G-Rich Triple Helix Forming Oligonucleotides

Abstract

A convenient synthesis of N1-methyl-2′-deoxy-ψ-uridine (ψ-thymidine, ψT, 7a) has been accomplished in good yield. The structural conformation of 7a was derived by 2D NMR and 1D NOE experiments. The nucleoside 7a has been incorporated into G-rich triplex forming oligonucleotides (TFOs) by solid-support, phosphoramidite method. The triplex forming capabilities of the modified TFOs (S4, S5 and S6) containing ψT has been evaluated in antiparallel motif with a target duplex (duplex-31) 5′d(CTGAGACCGGGAAGGAGGAAGGGCCAGTGAC)3′-5′d(GACTCTGGCCCTTCCTCCTTCCCGGTCACTG)3′(D1) at pH 7.6. The triplex formation of modified homopyrimidine-oligomers (S1, S2 and S3) has also been studied in parallel motif with a duplex-10 (A₁₀:T₁₀) at pH 7.0.     

Thermodynamic and Kinetic Analyses of DNA Triplex Formation: Application of Filter-Binding Assay

Abstract

We have developed a simple and efficient method for studying equilibrium thermodynamics and kinetics of DNA triplex formation, which utilizes a filter-binding procedure. The application of this method to the triplex formation between a double-stranded homopurine-homopyrimidine and a single-stranded homopyrimidine oligonucleotides has demonstrated its ability in the quantitative estimation of equilibrium binding constants and rate constants under various conditions. Thus, this simple method can serve as a powerful tool for the systematic analysis of sequence and environmental effects on the equilibrium and kinetic quantities in the triplex formation.     

Novel Hoogsteen-like bases for configurational recognition of the T-A base pair by DNA triplex formation

Effective sequence-specific recognition of duplex DNA is possible by triplex formation with natural oligonucleotides via Hoogsteen H-bonding. However, triplex formation is in practice limited to pyrimidine oligonucleotides binding duplex A-T or G-C base-pair DNA sequences specifically at homopurine sites in the major groove as T·A-T and C⁺·G-C triplets. Here we report the successful modeling of novel unnatural nucleosides that recognize the T-A DNA base pair by Hoogsteen interaction. Since the DNA triplex can be considered to assume an A-type or B-type conformation, these novel Hoogsteen nucleotides are tested within model A-type and B-type conformation triplex structures. A triplet consisting of the T-A base pair and one of the novel Hoogsteen nucleotides replaces the central T·A-T triplet in the triplex using the same deoxyribose-phosphodiester and base-deoxyribose dihedral angle configuration. The entire triplex is energy minimized and the presence of any structural or energetic perturbations due to the central triplet is assessed with respect to the unmodified energy-minimized (T·A-T)₁₁ proposed starting structures. Incorporation of these novel triplets into both A-type and B-type natural triplex structures provokes minimal change in the configuration of the central and adjacent triplets. The plan is to produce a series of Hoogsteen-like bases that preferentially bind the T-A major groove in either an A-type or B-type conformation. Selective recognition of the T-A major groove with respect to the G-C major groove, which presents similar keto and amine placement, is also assessed with configurational preference. Evaluation of the triplex solution structure by using these unnatural bases as binding conformational probes is a prerequisite to the further design of triplet forming bases. © 1996 John Wiley & Sons, Inc.     

Single-Stranded DNA and RNA Targeted Triplex-Formation: UV,CD and Molecular Modeling Studies of Foldback Triplexes Containing Different RNA, 2′-OMe-RNA and DNA Strand Combinations

Abstract

We studied the influence of different 2′-OMe-RNA and DNA strand combinations on single strand targeted foldback triplex formation in the Py.Pu:Py motif using ultraviolet (UV) and circular dichroism (CD) spectroscopy, and molecular modeling. The study of eight combinations of triplexes (D D:D, R* D:D, D D:R*, R* D:R*, D R:D, R* R:D, DR:R*, and R*-R:R*; where the first, middle, and last letters stand for the Hoogsteen Pyrimidine, Watson-Crick [WC] purine and WC pyrimidine strands, respectively, and D, R and R* stand for DNA, RNA and 2′-OMe-RNA strands, respectively) indicate more stable foldback triplex formation with a DNA purine strand than with an RNA purine strand. Of the four possible WC duplexes with RNA/DNA combinations, the duplex with a DNA purine strand and a 2′-O-Me-RNA pyrimidine strand forms the most thermally stable triplex, although its thermal stability is the lowest of all four duplexes. Irrespective of the duplex combination, a 2′-OMe-RNA Hoogsteen pyrimidine strand forms a stable foldback triplex over a DNA Hoogsteen pyrimidine strand confirming the earlier reports with conventional and circular triplexes. The CD studies suggest a B-type conformation for an all DNA homo-foldback triplex (D.D.D), while hetero-foldback triplex spectra suggest intermediate conformation to both Atype and B-type structures. A novel molecular modeling study has been carried out to understand the stereochemical feasibility of all the combinations of foldback triplexes using a geometric approach. The new approach allows use of different combinations of chain geometries depending on the nature of the chain (RNA vs. DNA).     

Interaction of Oligodeoxyribonucleotides Through Formation of Chimeric Duplex/Triplex Complexes

Abstract

An intramolecular duplex/triplex chimera is formed between d-CTTCCT-(T)₄-TCCTTCAGCACA and target d-GTT TGTGCTGAAGGA CACAC. The high Tm and hypochromicity of the triplex part of the chimera may be due to additional interactions outside the underlined binding site of the 20-mer.     

Poly(L-Lysine)-Graft-Dextran Copolymer Remarkably Promotes Pyrimidine-Motif Triplex Formation at Neutral Ph: Thermodynamic and Kinetic Studies

Abstract

The binding constant of a homopyrimidine oligonucleotide with its target duplex for the pyrimidine-motif triplex formation at neutral pH was analyzed and found to be remarkably higher in the presence of the poly (L-lysine)-graft-dextran copolymer than that without any triplex stabilizer or in the presence of spermine. The promoting effect mainly results from the considerable increase in the association rate constant.     

Pyrrolidino-DNA

Abstract

We synthesized pyrrolidino-C-nucleosides, incorporated them into oligodeoxynucleotides and investigated their pairing properties. The thermal duplex and triplex stabilities were measured. While triplex formation is destabilized in the case of pyrrolidino-pseudo-U and -T, pyrrolidino-pseudo-iso-C leads to an increase of the T_m value for third strand dissociation. Duplexes are destabilized with all pyrrolidino-C-nucleosides.     

Synthesis and DNA Binding Properties of DNA-PNA Chimeras

Abstract

A systematic study to evaluate the ability of 5′-DNA-3′-p-(N)-PNA-(C) chimeras to form triple helix structures has been undertaken. Preliminary results carried out on a 16-mer chimera with three PNA monomers at the 3′-end showed the formation of a stable DNA-PNA/DNA/DNA triplex, having similar conformational behaviour to a canonical DNA/DNA/DNA triplex.     

Sequence-Dependent Stability of Intramolecular DNA Triple Helices

Abstract

A set of 21 oligodeoxynucleotides were designed to fold into intramolecular triple helices of the pyrimidine motif under appropriate conditions. UV melting experiments on the triplexes which only differ in the number and distribution of third strand cytosines reveal the influence of sequence and pH on triplex stability and can be summarized as follows: (1) increasing the cytosine content in the third strand results in a higher thermal stability of the triplex at acidic pH but lowers the triplex to duplex melting temperature at neutral pH; (2) cytosines at terminal positions destabilize the triple helical structure as compared to non-terminal positions; (3) contiguous cytosines lead to a pH dependent destabilization of the triplex, the destabilizing effect being more pronounced at higher pH. Analysis of these effects in terms of the various interactions within a triple helical complex indicate that the sequence-dependent stabilities are largely determined by the extent of protonation for individual third strand cytosines.     

New Nucleoside Analogues for the Recognition of Pyrimidine-Purine Inversion Sites

Abstract

A new nucleoside designed to enhance triplex stability has been synthesised in 15 steps starting from sugar 2. This pathway contains the sugar derivative 9 which is a useful intermediate for the introduction of other natural and unnatural bases into the 2′-aminoethoxy nucleoside containing scaffold.     

Triplex Formation Between DNA and Mixed Purine-Pyrimidine PNA Analog with Lysines in Backbone

Abstract

Melting UV experiments and mixing curves indicated slow triplex formation between lysine comprising PNA and DNA complement in 100mM Na⁺ solution.     

Selective Recognition of Triplex and Duplex Melting in Triple-Helical Nucleic Acids by Circular Dichroism Spectroscopy

Abstract

Here we present a method based on CD spectroscopy to evaluate duplex and triplex melting independent from each other in cases where UV melting curves show only one transition.     

Stabilization of DNA Double and Triple Helices by Conjugation of Minor Groove Binders to Oligonucleotides

Abstract

New conjugates containing two parallel or antiparallel carboxamide minor groove binders (MGB) attached to the same terminal phosphate of one oligonucleotide strand were synthesized. The conjugates interact with their target DNA stronger than the individual components. Effect of conjugated MGB on DNA duplex and triplex stability and their sequence specificity was demonstrated on the short oligonucleotide duplexes and on the triplex formed by model 16-mer oligonucleotide with HIV polypurine tract.     

Structural Properties of Hybrid Triplex of Polycation Deoxyribonucleic S-methylthiourea (DNmt) Strands with a Complementary DNA Strand,Probed by Nanosecond Molecular Dynamics

Abstract

The replacement of phosphodiester linkages of the polyanion DNA with S-methylthiourea linkers provides the polycation deoxyribonucleic S-methylthiourea (DNmt). Molecular dynamics studies to 1,220 ps of the hybrid triplex formed from octameric DNmt strands d(Tmt)₈ with a complementary DNA oligomer strand d(Ap)₈ have been carried out with explicit water solvent and Na counterions under periodic boundary conditions using the CHARMM force field and the Ewald summation method. The Watson-Crick and Hoogsteen hydrogen-bonding patterns of the A/T tracts remained intact without any structural restraints for triplex structures throughout the simulation. The duplex portion of the triplex structure equilibrated at a B-DNA conformation in terms of the helical rise and other helical parameters. The dynamic structures of the DNmt·DNA·DNmt triplex were determined by examining histograms from the last 800 ps of the dynamics run. These included the hydrogen-bonding pattern (sequence recognition), three-centered bifurcating occurrences, minor groove width variations, and bending of tracts for the hybrid triplex structures. Together with the Watson-Crick hydrogen-bondings, the strong Hoogsteen hydrogen-bondings, the partially maintained three-centered bifurcatings in the Watson-Crick pair, and the medium-strength three-centered bifurcatings in the Hoogsteen pair suggest that the hybrid triplex is energetically favorable as compared to a duplex with similar base stacking, van der Waals interactions, and helical parameters. This is in agreement with our previously reported thermody- namic study, in which only triplex structures were observed in solution. The bending angle measured between the local axis vectors of the first and last helical axis segments is about 20° for the Watson-Crick portion of the averaged structure. Propeller twist (associated with three-centered hydrogen-bonding) up to ?30°, native to DNA AT base pairing, was also observed for the triplex structure. The sugar pseudorotation phase angles and the ring rotation angles for the DNA strand are within the C3′-endo domain and C2′-endo domain for the DNmt strand. Water spines are observed in both minor and major grooves throughout the dynamics run. The molecular dynamics simulations of the structural properties of DNmt·DNA·DNmt hybrid triplex is compared to the DNG·DNA·DNG hybrid triplex (In DNG the -O-(PO₂-)-O- linkers in DNA is replaced by -NH-C(=N₂)-NH-).     

Different Effects of Nonintercalative Antitumor Drugs on DNA Triple Helix Stability: SN-18071 Promotes Triple Helix Formation

Abstract

The interaction of the nonintercalating bisquaternary ammonium heterocyclic drugs SN- 18071 and SN-6999 with a DNA triple helix has been studied using thermal denaturation and CD spectroscopy. Our data show, that both minor groove binders can bind to the triple helix of poly(dA)-2poly(dT) under comparable ionic conditions, but they influence the stability of the triplex relative to the duplex structure of poly(dA)-poly(dT) in a different manner. SN- 18071, a ligand devoid of forming hydrogen bonds, can promote triplex formation and thermally stabilizes it up to 500 mM Na+ concentration. SN-6999 destabilizes the triplex to duplex equibilirium whereas it stabilizes the duplex. The binding constant of SN-18071 is found to be greater than that to the duplex. The stabilizing effect of SN-18071 is explained by electrostatic inetractions of three ligand molecules with the three grooves of the triple stranded structure. From the experiments it is concluded that SN-6999 binds to the triplex minor groove thereby destabilizing the triplex similar as previously reported for netropsin.     

Approaches to Enhance the Binding Affinity and Nuclease Stability of Triplex Forming Oligonucleotides

Abstract

The ability of simple azole nucleosides to promote antiparallel triplex formation at non-homopurine duplex targets was explored. It was also shown that spermidine-cholesterol conjugation is effective in enhancing cellular uptake and stability of oligonucleotides.     

Relative Effects of Graft Copolymer and Polyamines on Triplex Stabilization Under Physiological Conditions

Abstract

Triplex-stabilizing effect of a graft copolymer under physiologically relevant conditions has been evaluated and compared with other polyamines. Here we show that the graft copolymer significantly stabilizes triplex DNAs with amazingly higher efficicacy than that of physiological concentrations of spermine and spermidine.