Synthesis and Incorporation of 2′-O-Methyl-Pseudouridine into Oligonucleotides

Abstract

A short multigram synthesis of 2′-O-methylpseudouridine and its phosphoramidite derivative is described which avoids the use of protecting groups on the nitrogens. A binding study of oligonucleotides containing this modification suggest an increased binding affinity to RNA when compared to oligonucleotides incorporating 2′-O-methyluridine.     

2′-Deoxyisoinosine: Synthesis of a Highly Fluorescent Nucleoside and Its Incorporation into Oligonucleotides

Abstract

The synthesis of 2′-deoxyisoinosine (2a) and the related 2′, 3′- dideoxynucleosides 2b and 3 is reported. The 3′-phosphonate 4b as well as the phosphoramidite 4c were prepared and employed in solid-phase oligonucleotide synthesis.     

Chemical and Enzymatic Synthesis of 2′-Deoxy-iso-inosine and Its Incorporation into DNA

Abstract

Two procedures for the preparation of 2′-deoxy-iso-inosine (1) are presented. Synthesis of 3′-phosphoramidite (7) and 3′-phosphonate (8) derivatives are described, as well as an oligodeoxynucleotide containing iso-I.     

Introduction of 5′-Terminal Amino and Thiol Groups into Synthetic Oligonucleotides

Abstract

Oligonucleotides terminating in a 5′-primary amine group are synthesized using solid phase phosphoramidite chemistry. The 5′-terminal amine group in the deprotected oligonucleotide is further derivatized with N-succinimidyl-3-(2-pyridyldithio) propionate (SPDP) followed by treatment with dithiothreitol (DTT) to produce 5′-thiol terminated oligonucleotides. Introduction of 5′-thiol group is further confirmed by reading the absorbance of the released chromophore, pyridine-2-thione at 343 nm; ?₃₄₃=8080/M.     

A Convenient High Yield Synthesis of N4-Isobutyryl-2′-O-Methylcytidine and Its Monomer Units For Incorporation into Oligonucleotides

Abstract

We designed an efficient three step procedure for the synthesis of N⁴-isobutyryl-2′-O-methylcytidine. This protected nucleoside was then used to prepare a methylphosphonamidite monomer for incorporation into oligonucleotides. Transamination at the C⁴ position of cytidine using ethylenediamine, which has been reported for the N⁴-benzoyl cytidine, was not observed with N⁴-isobutyryl protected 2′-O-methylcytidine.     

A New Odorless Procedure for the Synthesis of 2′-Deoxy-6-Thioguanosine and Its Incorporation into Oligodeoxynucleotides

6-S-[2-[(2-ethylhexyl)oxycarbonyl]ethyl)}-3′,5′-O-bis(tert-butyldimethylsilyl)-2′-deoxy-6-thiogua nosine (2) was synthesized in high yield from the corresponding 6-O-mesitylenesulfonyl derivative by the reaction with 2-ethylhexyl 3-mercapto-propionate. The phosphoramidite precursor derived from 2 was successfully applied to an automated DNA synthesizer to produce 2′-deoxy-6-thioguanosine containing ODN. The results showed that 2-ethylhexyl 3-mercaptopropionate is useful as an odor less reagent and also as an S-protecting group of 2′-deoxy-6-thioguanosine.     

Incorporation of 5′-N-BOC-2′, 5′-Dideoxynucleoside-3′-O-Phosphoramidites Into Oligonucleotides by Automated Synthesis

Abstract

An efficient method for synthesizing 5′-Boc-5′-amino-2′, 5′- dideoxynucleoside phosphoramidites and conditions for their incorporation in solid-phase oligonucleotide synthesis are presented.     

Efficient Synthesis of 5-Carboxy-2′-Deoxypyrimidine Nucleoside 5′-Triphosphates

An efficient P(V)–N activation method for the synthesis of 5-carboxy-2′-deoxyuridine and 5-carboxy-2′-deoxycytidine triphosphates directly from the corresponding phosphoropiperidate precursors has been developed.     

Synthesis and Properties of Oligonucleotides Containing 5-Aza-2′-deoxycytidine

Abstract

The preparation of a protected derivative of 5-aza-2′-deoxycytidine carrying the 2-(p-nitrophenyl)ethyl group is described. The new derivative is useful for the preparation of oligonucleotides containing 5-aza-2′-deoxycytidine using a special methodology that avoids the use of ammonia.     

Synthesis and anticancer activity of some 5-fluoro-2′-deoxyuridine phosphoramidates

Two series of novel 4-chlorophenyl N-alkyl phosphoramidates of 3′-O-(t-butoxycarbonyl)-5-fluoro-2′-deoxyuridine (3′-BOC-FdU) (9a–9j) and 5-fluoro-2′-deoxyuridine (FdU) (10a–10j) were synthesized by means of phosphorylation of 3′-BOC-FdU (4) with 4-chlorophenyl phosphoroditriazolide (7), followed by a reaction with the appropriate amine. Phosphoramidates 9a–9j were converted to the corresponding 10a–10j by removal of the 3′-t-butoxycarbonyl protecting group (BOC) under acidic conditions. The synthesized phosphoramidates 9a–9j and 10a–10j were evaluated for their cytotoxic activity in five human cancer cell lines: cervical (HeLa), nasopharyngeal (KB), breast (MCF-7), liver (HepG2), osteosarcoma (143B) and normal human dermal fibroblast cell line (HDF) using the sulforhodamine B (SRB) assay. Two phosphoramidates 9b and 9j with the N-ethyl and N-(methoxy-(S)-alaninyl) substituents, respectively, displayed remarkable activity in all the investigated cancer cells, and the activity was considerably higher than that of the parent nucleoside 4 and FdU. Among phosphoramidates 10a–10j compound 10c with the N-(2,2,2-trifluoroethyl) substituent showed the highest activity. Phosphoramidate 10c was more active than the FdU in all the cancer cell lines tested.     

A Practical Synthesis of N1-Methyl-2′-deoxy-ψ-uridine (ψ-Thymidine) and Its Incorporation into G-Rich Triple Helix Forming Oligonucleotides

Abstract

A convenient synthesis of N1-methyl-2′-deoxy-ψ-uridine (ψ-thymidine, ψT, 7a) has been accomplished in good yield. The structural conformation of 7a was derived by 2D NMR and 1D NOE experiments. The nucleoside 7a has been incorporated into G-rich triplex forming oligonucleotides (TFOs) by solid-support, phosphoramidite method. The triplex forming capabilities of the modified TFOs (S4, S5 and S6) containing ψT has been evaluated in antiparallel motif with a target duplex (duplex-31) 5′d(CTGAGACCGGGAAGGAGGAAGGGCCAGTGAC)3′-5′d(GACTCTGGCCCTTCCTCCTTCCCGGTCACTG)3′(D1) at pH 7.6. The triplex formation of modified homopyrimidine-oligomers (S1, S2 and S3) has also been studied in parallel motif with a duplex-10 (A₁₀:T₁₀) at pH 7.0.     

Synthesis of Artificially Bent Oligonucleotides by Incorporation of Conformationally Rigid 5′-Cyclouridylic Acid Derivatives

Abstract

This paper describes the design and synthesis of a conformationally rigid dimer building block Umpc3Um having a propylene bridge linked between the uracil 5-position and 5′-phosphate group of pUm. Oligonucleotides incorporating the dimer unit with either the Sp or Rp configuration were synthesized by use of the phosphoramidite approach. The conformational properties of the dimer units and these oligonucleotides were studied in detail.     

Synthesis and DNA Duplex Stabilities of Oligonucleotides Containing C-5-(3-Methoxypropynyl)-2′-deoxyuridine Residues

Abstract

5′-Dimethoxytrityl-5-(3-methoxypropynyl)-2′-deoxyuridine phosphoroamidite was synthesized with the use of commercial 3- methoxypropyne. Oligonucleotides (ODNs) containing 5-(3- ethoxypropynyl)- 2′-deoxyuridine in different positions were prepared. The stabilities of the duplexes formed by these ODNs with the complementary templates are increased in comparison with the unmodified counterparts. On average modified residue incorporated, the Tm is raised by 1°C.     

The Synthesis of 2′-C-Functionalised Nucleosides for Incorporation into Catalytic RNA

Abstract

Five 2′-C-functionalized nucleosides (1–5) have been prepared and incorporated into dinucleoside monophosphates. The effect of the functionality on the stability of the adjacent phosphodiester bond toward hydrolysis by nuclease enzymes and extremes of pH has been assessed.     

3′-C-Hydroxymethylthymidine: Synthesis and Incorporation into Oligodeoxynucleotide Analogues

Abstract

The stereoselective synthesis of 3′-C-hydroxymethylthymidine (5) in five steps from thymidine has been accomplished and this nucleoside has been incorporated into oligodeoxynucleotides (ODNs) in different ways.     

Synthesis and Incorporation of 5″-Amino- and 5′-Mercapto-5′-Deoxy-2′-O-Methyl Nucleosides Into Hammerhead Ribozymes

Abstract

Novel 5′-amino-5′-deoxy-2′-O-methyl uridine, guanosine and adenosine 3′-O-phosphoramidites 5, 11, and 20, as well as protected 5′-mercapto-5′-deoxy-2′-O-methyl uridine 3′-O-phosphoramidite 23 were synthesized from 2′-O-methyl nucleosides. These analogs were incorporated at the 5′-ends of hammerhead ribozymes to evaluate achiral bridging 5′-N- phosphoramidates and 5′-S-phosphorothioates as alternatives for non- bridging phosphorothioates commonly used for end stabilization against nucleases. Oligonucleotide synthesis and deprotection conditions were optimized for better yields of these modified ribozymes.     

Synthesis and Photochemical Conversion of Oligonucleotides Containing 2-Chloro-2′-Deoxyadenosine

Abstract

The rate and velocity of the photoconversion of 2-chloro-2′-deoxyadenosine into 2′-deoxyisoguanosine within oligonucleotides was found to be sequence-specific and depends on the nearest neighbor.     

Synthesis and Properties of 2′-O-Methylribonucleotide Methylphosphonate Containing Chimeric Oligonucleotides

Abstract

2′-O-methylribonucleoside methylphosphonamidites are synthesized and incorporated into oligonucleotides to obtain chimeric antisense oligonucleotides. The resulting oligonucleotide binds to their target RNA/DNA sequences efficiently and stable in a medium containing bovine serum.     

Synthesis and Antiviral Activity of New 5-Substituted 2′-Deoxyuridine Derivatives

New 5-azole- and 5-oxime-substituted analogues of 2′-deoxyuridine are synthesized. The analogues with azole ring manifest low toxicities and antiherpetic activities on Vero cell culture, the imidazole derivative being the most active. The inhibitory effects of oximes of 5-formyl-deoxyuridine are comparable with those of the azole-containing nucleoside analogues, although their cytotoxicities are found to be higher; oxime of 5-formyldeoxyuridine is particularly toxic. The nucleoside analogues synthesized exhibit no marked activity on cell cultures infected with various variants of poxvirus.